SEARCH

SEARCH BY CITATION

Molecular Ecology Notes,5, 554–557. doi: 10.1111/j.1471-8286.2005.00987.x

Clarification of the microsatellite loci developed for the locust Locusta migratoria

In Chapuis et al. (2005), there were errors in sequences of three of the primers written in Table 1: the forward and reverse primers of the marker LM2-Λ and the reverse primer of the marker LM2-Β.

The correct primer sequences are presented here:

LM2-Λ

F: GCTTCACTTTGTCGTTGTAGG

R: GCGTAAAATCCTCAGAATGC

LM2-Β

R: CGAATCACCAGTCTATGACAAAC

The authors apologize for this error and any inconvenience caused.

Reference

  1. Top of page
  2. Reference