SEARCH

SEARCH BY CITATION

Molecular Ecology Resources, 9(3), 843–845. doi: 10.1111/j.1755-0998.2008.02289.x

Article first published online: 22 Jan 2009

Development and characterization of microsatellite loci in western larch (Larix occidentalis Nutt.)

C. CHEN,* C. LIEWLAKSANEEYANAWIN,* T. FUNDA,* A. KENAWY,* C.H. NEWTON † and Y.A. EL-KASSABY*

*Department of Forest Sciences, University of British Columbia, 2424 Main Mall, Vancouver, BC, Canada V6T 1Z4, †ATG genetics Inc., 900 Fifth Street, Nanaimo, BC, Canada V9R 5S5

Table 1 of CHEN et al. (2009) had incorrect primer sequences for the loci UBCLXtet_2-11 (forward), UBCLXA4_1 (reverse) and UBCLXdi_21 (forward and reverse). A corrected version of Table 1 is given in the next page. The authors apologize for this error and any inconvenience caused.

Table 1.   Characterization of microsatellite primers for western larch: primer sequences, annealing temperatures, size ranges, genetic polymorphism (HO and HE: observed and expected heterozygosities) and the GenBank accession nos.
LocusPrimer sequences (5′ to 3′)ta (°C)Repeat motifSize (bp)AHoHe*G.A.N.
UBCLXtet_2-11F: ACACGAGAACAATAGATGTGTC58(TATC)8(TA)8135–20090.510.54*EU306571
R: CTTGCAGGTGATCTCTTAAC
UBCLXA4_1F: GATAAATTTGAAGCCTTGAACAC62(ACAT)17(AT)11190–230110.630.72EU306573
R: GCAATTCCTCTCAAGCCATAC
UBCLXdi_21F: CTAGAGTGTGCTCTTTTAAAACC55(TC)16300–35070.270.65*EU306574
R: CTACCTTTATTCTCCTGCACC