SEARCH

SEARCH BY CITATION

Keywords:

  • H19 downregulation;
  • tyrosinase overexpression;
  • increased melanosome transfer;
  • estrogen;
  • melasma

Summary

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

A variety of factors, including ultraviolet (UV) exposure, have been implicated in the pathogenesis of melasma. However, UV-induced hyperpigmentation usually recovers spontaneously, whereas melasma does not. Recently, we detected downregulation of the H19 gene on microarray analysis of hyperpigmented and normally pigmented skin from patients with melasma, and identified significant clinical correlations. The H19 downregulation was not accompanied by a reciprocal change of the imprinted gene, insulin-like growth factor II. Moreover, methylation pattern of the H19 promoter region in maternal ICR was variable. The H19 knockdown in melanocyte monoculture did not result in obvious tyrosinase overexpression, whereas the knockdown in a mixed cell culture system, composed of H19 siRNA transfected normal human keratinocytes and non-transfected normal human melanocytes, did induce not only a tyrosinase overexpression but also an increase of melanosome transfer. Estrogen treatment of the H19 RNA knockdown in the mixed cell culture was more than an additive effect on the tyrosinase overexpression, whereas UV irradiation was not. These findings suggest that downregulation of H19 and a sufficient dose of estrogen might be involved in the development of melasma.


Significance

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

Ultraviolet (UV)-induced hyperpigmentation recovers spontaneously, whereas melasma does not. Recently, we detected downregulation of the H19 gene on microarray analysis of hyperpigmented and normally pigmented skin from melasma patients, and identified significant clinical correlations. The H19 knockdown in a mixed cell culture system, composed of H19 siRNA transfected normal human keratinocytes and non-transfected normal human melanocytes, induced both a tyrosinase overexpression and an increase of melanosome transfer. Estrogen treatment of the H19 RNA knockdown in the mixed cell culture was more than an additive effect on the tyrosinase overexpression, whereas UV irradiation was not.

Introduction

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

Melasma is a pattern of pigmentation that affects the upper lip, cheeks, forehead, and chin, particularly during the reproductive lifespan of women. With respect to pigmentation, melasma does not appear to be different from other conditions with hyperpigmentaiton, such as post-inflammatory hyperpigmentation and ultraviolet (UV)-induced pigmentation. In fact, hyperpigmentation results from an increase in the melanin pigment, which is common to all hyperpigmentation disorders. Most prior studies have sought to identify the underlying mechanisms causing an increase in melanin common to all hyperpigmentation disorders. Melanins are synthesized in the melanosomes that contain specific enzymes, including tyrosinase. Melanogenesis is likely regulated by complicated pathways. The cAMP pathway is considered one of the most pivotal signaling pathways. During the molecular events involved in the regulation of melanogenesis, cAMP activates protein kinase A (PKA) and simultaneously the cAMP response element binding protein (CREB) transcriptional factor, which leads to upregulation of the expression of microphthalmia-associated transcription factor (MITF)-M (Bertolotto et al., 1998a), a melanocyte-specific transcription factor crucial for melanocyte development and differentiation (Hodgkinson et al., 1993). MITF-M then binds to and activates the tyrosinase promoter, resulting in an increase of melanin synthesis (Bertolotto et al., 1998b). CREB is a common downstream target for melanocyte differentiation, as well as proliferation. cAMP can join with CREB activation through PKA activation, as well as ERK1/2 activation (Tada et al., 2002). However, agents which increase cAMP can stimulate melanogenesis, through an increase of MITF by inhibition of a phosphatidylinositol 3-kinase (PI3K)/apoptosis signal-regulating kinase (Akt; Oka et al., 2000; Khaled et al., 2003), or by upregulation of protein kinase C (PKC)-beta (Park et al., 2006).

The hyperpigmentation caused by inflammation and UV exposure usually recovers spontaneously after discontinuation of further exposure; however, this is not the case for melasma. The different outcomes suggest the involvement of different regulatory mechanisms associated with melanogenesis among these conditions, even though UV exposure has been considered one of the causative factors associated with the development of melasma (Kang et al., 2002; Sanchez et al., 1981). In fact, a variety of factors have been implicated in the pathogenesis of melasma, including pregnancy (Sodhi and Sausker, 1988), changes in uterine and ovarian hormones, and genetic predisposition (Sanchez et al., 1981).

Recently, we performed microarray analysis to compare hyperpigmented with normally pigmented biopsied skin specimens from patients with melasma to identify the specific factors associated with the hyperpigmentation in melasma. There was a twofold or greater downregulation in the expression of H19 RNA in the hyperpigmented skin of the patients (data not shown). The H19 gene transcribes a 2.3 kb non-coding RNA (Gabory et al., 2006). The importance of different types on non-coding RNAs, including H19, has been determined with respect to the control of gene expression. In fact, the H19 gene is thought to have a possible role in certain malignancies. H19 consists of an imprinted cluster with insulin-like growth factor II (IGF2; Reese and Bartolomei, 2006), and the imprinting control region (ICR) between the two genes regulates their expression (Jinno et al., 1996). In fact, methylation of the ICR of the maternal chromosome induces downregulation of the H19 gene simultaneously with IGF2 overexpression, resulting in tumorigenesis.

In this study, we showed an association between downregulation of the H19 gene and melasma.

Results

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

Downregulation of H19 RNA expression in melasma, but not UV-exposed hyperpigmented skin

Levels of H19 RNA expression were analyzed semi-quantitatively in the epidermal specimens from eight patients with melasma and three patients exposed to UV. The levels of H19 RNA expression were significantly (P = 0.003) decreased in the hyperpigmented epidermis compared to the normally pigmented epidermis of the melasma patients, whereas the levels of H19 RNA expression were similar in the UV-exposed hyperpigmented epidermis (Figure 1).

image

Figure 1.  Downregulation of H19 RNA expression in melasma, but not UV-exposed hyperpigmented skin. Biopsied skin specimen sets of hyperpigmented and normal skin from eight melasma patients (Mel) and three UV-exposed individuals (UV) were compared and their levels of H19 RNA expression were determined with semi-quantitative RT-PCR. The levels were significantly (P = 0.003) decreased in the melasma, whereas the levels were not clearly changed with UV exposure. The data in the graph represent the means ± SD of three individuals.

Download figure to PowerPoint

No reciprocal changes between H19 and IGF2 RNA expression

The quantitative assay using real time-PCR was performed to confirm the RT-PCR results, showing a consistent and significant (P = 0.001) reduction in level of H19 RNA expression in the hyperpigmented skin from all 14 patients with melasma, including the above-mentioned eight patients (Figure 2). However, the real time-PCR showed that the mRNA levels of IGF2 were increased in the hyperpigmented skin specimens of 6 of 14 patients, whereas they were decreased in eight patients (Figure 2). The levels of IGF2 mRNA were not significantly different (P = 0.778) between the hyperpigmented and normally pigmented skin specimens (Figure 2).

image

Figure 2.  No reciprocal changes between H19 and IGF2 RNA expression. To confirm the H19 RT-PCR results, real time-PCR with the skin specimen sets from 14 melasma patients were performed. The H19 RNA expression levels were significantly (P = 0.001) lower in the lesion (L) compared to the normal (N) skin. Quantitative real time-PCR of IGF2 mRNA expression was examined in the same 14 melasma patients. Differing from the H19 RNA results, the levels of IGF2 expression in the lesions were not statistically significant (P = 0.778) with a wide range of difference.

Download figure to PowerPoint

No reciprocal changes were detected between H19 and IGF2 expression in the hyperpigmented skin, however, epigenetic silencing by biallelic methylation of H19 promoter has been found in Wilms tumor and adjacent kidney (Frevel et al., 1999). Therefore, bisulfate genomic sequencing was performed in three additional patients with melasma. The methylation pattern of the 12 CpGs located in the H19 promoter region of the maternal ICR was variable without showing a consistent increase in the hyperpigmented compared to normal skin, regardless of gender (Figure 3).

image

Figure 3.  Bisulfite genomic sequencing analysis of the H19 promoter region in the ICR of the maternal chromosome. Genomic DNAs from the hyperpigmented and normally pigmented skin of three melasma patients were bisulfite-treated and PCR-amplified. Single clones were sequenced to give the methylation pattern of 12 CpGs located in the H19 promoter region of the maternal ICR (closed circle for methylated, open circle for unmethylated). The letter A indicated maternal origin. (L for lesion, N for normal, the number 1 in L1A for allele of clones, the numbers from 1 to 12 for 12 CpGs).

Download figure to PowerPoint

H19 RNA knockdown increased tyrosinase expression

The H19 knockdown was performed two kinds of siRNAs, Stealth 243 and Stealth 472. In the real time-PCR, the levels of H19 RNA in both Stealth 243 and Stealth 472 siRNA transfected keratinocytes were significantly lower than those in negative control siRNA transfected cells (P < 0.001 and P < 0.01, respectively) (Figure 4A). Similar degrees of downregulation were found in melanocytes (data not shown). The melanocyte monoculture knocked down H19 RNA did not show obvious tyrosinase overexpression (Figure 4B). As a microRNA derived from H19 has been detected in human keratinocytes (Cai and Cullen, 2007), in vitro studies were done using a mixed cell culture system, in which H19 RNA was knocked down in normal human keratinocytes and then co-cultured with non-transfected normal human melanocytes. Of course no detectable tyrosinase expression was confirmed in the keratinocyte monoculture, regardless of H19 RNA knockdown (Figure 4B). The results from two different H19 siRNAs, Stealth 243 and Stealth 472, were similar (data not shown).

image

Figure 4.  H19 RNA knockdown induced tyrosinase overexpression. For the downregulation of H19, melanocytes and keratinocytes were transfected with two different H19 siRNAs (siRNA) and a negative control siRNA (C). (A) The H19 RNA levels were measured with real time-PCR and compared in keratinocytes transfected with either Stealth 243 or Stealth 472 siRNA with in those transfected with a negative control siRNA, with detecting significant differences (P < 0.001 or P < 0.01, respectively). Similar degrees of downregulation were found in melanocytes (data not shown). (B) Although the levels of tyrosinase expression were examined with Western blot analysis at different times (4, 24, and 48 h) after the knockdown, the results at 48 h, which were the highest, were shown. With H19 knockdown with two different siRNAs, Stealth 243 and Stealth 472, tyrosinase overexpression was not detected in the melanocyte monoculture (MC), whereas it was remarkable in a mixed cell culture (KC + MC), in which normal human keratinocytes were knocked down, and then cultured non-transfected normal human melanocytes were added into each side. The effect of H19 RNA knockdown on the tyrosinase expression was also examined in the cultured keratinocyte monoculture (KC). (C) With the knockdown at 48 h in the mixed cell culture, the levels of tyrosinase expression, increased significantly (P = 0.007), compared to the control. The data in the graph represent the means ± SD of five independent experiments.

Download figure to PowerPoint

Knockdown of H19 RNA increased tyrosinase expression in the mixed cell culture during the experimental periods (4, 24, and 48 h), with the maximum effect 48 h after incubation (Figure 4B). No difference in tyrosinase levels was detected between the mixed cell culture composed of non-transfected keratinocytes and non-transfected melanocytes and the culture composed of keratinocytes transfected with a negative control siRNA and non-transfected melanocytes (data not shown). The tyrosinase overexpression 48 h after H19 RNA knockdown was statistically significant (P = 0.007; Figure 4C).

Downstream signaling molecules of H19 RNA knockdown-induced tyrosinase overexpression

The knockdown of H19 RNA in melanocyte monoculture did not result in greater phosphorylation of Erk, Akt, and CREB, whereas the knockdown in the mixed cell culture, composed of transfected keratinocytes and non-transfected melanocytes, and in the keratinocyte monoculture did (Figure 5A). The results using two different H19 siRNAs, Stealth 243 and Stealth 472, were also similar (data not shown).

image

Figure 5.  Downstream signaling molecules of H19 knockdown-induced tyrosinase overexpression. (A) The H19 RNA knockdown using two different siRNAs was induced in keratinocyte monoculture (KC), melanocyte monoculture (MC), and mixed cell culture (KC + MC) which was composed of transfected keratinocytes and non-transfected melanocytes. The knockdown from two different siRNAs similarly induced more phosphorylation of Erk, Akt, and CREB in the keratinocyte and mixed cell cultures, whereas no significant change in the melanocyte monoculture. (B) The Erk, Akt, and PKA pathways were inhibited with the treatment of U0126, LY294002, and H89 for 24 h, respectively, in the mixed cell culture. The treatment of U0126 or H89 markedly inhibited tyrosinase overexpression, showing a rather flat line between treatments with and without inhibitor. The LY294002 treatment inhibited the tyrosinase overexpression, but less than the other inhibitors. The data in the graph represent the means ± SD of three independent experiments.

Download figure to PowerPoint

Specific inhibition of the Erk, Akt, and PKA pathways using U0126, LY294002, and H89, respectively, clearly downregulated the tyrosinase expression and CREB phosphorylation in the cultured mixed cells with H19 RNA knockdown (Figure 5B). The degree of tyrosinase downregulation was more prominent in the presence of U0126 and H89 than LY294002 (Figure 5B).

Increased melanosome transfer with H19 RNA knockdown

Because increase in tyrosinase expression with H19 RNA knockdown was detected in the mixed cell culture, but not in melanocyte monoculture (Figure 4A), a role of melanosome transfer to adjacent keratinocytes was considered in hyperpigmentation. Therefore, the effect of H19 RNA knockdown on melanosome transfer was examined.

The melanosomes were labeled using an antibody to the melanosomal protein Trp-1 in keratin 14-containing keratinocytes in the mixed cell culture. Greater number of keratinocytes with H19 RNA knockdown compared to those without knockdown H19 RNA, contained the transferred melanosomes from the adjacent melanocytes, showing a significant (P = 0.006) difference (Figure 6).

image

Figure 6.  More melanosome transfer with H19 RNA knockdown. Double immunolabelling with anti-Trp-1 antibody (red) to detect melanosomes and anti-keratin 14 antibody (green) to identify keratinocytes (KC) in the mixed cell culture. Greater number of keratinocytes contained melanosomes with H19 knockdown (B) compared to negative control siRNA (A). At the magnification, the merged image (F) showed intracytoplasmic Trp-1-positive red spots in keratin 14-positive adjacent keratinocytes. Double immunostaining in the keratinocyte monoculture did not show the melanosome (data not shown). (A), (B) scale bars = 100 μm. (C), (D) scale bars = 10 μm. For the statistical analysis, the number of keratinocytes containing melanosomes was counted in 10 random microscopic fields, and represented as the percentage of negative control (C). The cells containing melanosomes were significantly more (P = 0.006) with H19 RNA knockdown (siRNA) (MC for melanocytes).

Download figure to PowerPoint

H19 RNA knockdown-induced melanogenesis increased more in the presence of estrogen, but not UV irradiation

Although the knockdown of H19 RNA in the mixed cell culture induced tyrosinase overexpression, pregnancy (Sodhi and Sausker, 1988), changes in uterine and ovarian hormones, and UV exposure (Kang et al., 2002; Sanchez et al., 1981) have been considered to be causative factors of melasma. Therefore, the effect of H19 RNA knockdown in the mixed cell culture was examined in the presence or absence of estrogen or UV exposure.

The expression of tyrosinase was significantly (P < 0.05, P < 0.005) increased in a dose-dependent manner at 0, 10, and 100 nM of estrogen, regardless of H19 RNA knockdown. With H19 knockdown, tyrosinase expression was significantly (P < 0.05) higher with increasing concentrations of estrogen. Moreover, dose-dependent tyrosinase overexpression was more marked whenever H19 RNA was knocked down, showing significant (P < 0.05) tyrosinase overexpression at the same concentration of estrogen with and without H19 knockdown (Figure 7A). The phosphorylation of downstream signaling molecules, such as Erk and CREB, was clearly increased along with tyrosinase overexpression (Figure 7A).

image

Figure 7.  H19 knockdown induced-melanogenesis increased more in the presence of estrogen, but not UV irradiation. (A) Based on the previous results (Figures 4 and 5), Western blot analysis was done in the mixed cell culture. Treatment with estrogen (ES) alone at concentrations of 0, 10, and 100 nM, increased tyrosinase expression (P < 0.05, P < 0.005) with phosphorylation of Erk and CREB in a dose-dependent manner. With H19 RNA knockdown, these effects of estrogen alone became more exaggerated, showing not only dose-dependent overexpression (P < 0.05) but also overexpression between the same estrogen concentration with and without H19 RNA knockdown (P < 0.05). The data in the graph represent the means ± SD of five independent experiments. (B) UV irradiation induced tyrosinase overexpression with more phosphorylation of Erk and CREB. UV irradiation or H19 knockdown significantly (P < 0.05) induced tyrosinase overexpression, however, the effect of UV irradiation was not enhanced in the presence of H19 RNA knockdown. The data in the graph represent the means ± SD of five independent experiments.

Download figure to PowerPoint

Based on previous experiments with UV irradiation on cultured cells, 10 mJ was considered an optimal dosage for the experiment (data not shown). UV irradiation significantly (P < 0.05) increased the levels of expression of tyrosinase in the absence of H19 RNA knockdown. However, the effect of UV irradiation under H19 RNA knockdown was hardly detected, although H19 RNA knockdown itself increased the levels of expression (P < 0.05). The phosphorylation of Erk and CREB showed similar patterns of change as tyrosinase expression (Figure 7B).

Discussion

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

The common mechanism for hyperpigmentation has been identified, however, no specific mechanism of melasma has been addressed. This study showed the significant role of non-coding H19 RNA on melasma through the identification of a clinical correlation and mechanisms of action with and without estrogen and UV exposure.

The results from quantitative real time-PCR and semi-quantitative RT-PCR identified the clinical correlation between downregulation of H19 RNA and melasma (Figures 1 and 2). H19 RNA downregulation was consistent in the hyperpigmented skin compared with adjacent normally pigmented skin of all patients with melasma, whereas H19 downregulation was not detected in UV-induced hyperpigmented skin (Figure 1). Further studies with more patients are required to elucidate this observation, however, these results suggest a specific role of H19 RNA downregulation on melasma.

Reports in the literature have suggested that the H19 gene is reciprocally imprinted (Zemel et al., 1992) with the IGF2 gene, a growth promoter gene. The IGF2 gene is expressed from the paternally-derived allele (Giannoukakis et al., 1993; Ohlsson et al., 1993) with methylated ICR, whereas the H19 gene is expressed from the maternally-derived allele (Ferguson-Smith et al., 1993; Rachmilewitz et al., 1992; Zhang et al., 1993) with unmethylated ICR. Therefore, ICR methylation on the maternal chromosome could decrease H19 expression with simultaneously induced biallelic IGF2 expression (Bell and Felsenfeld, 2000; Hark et al., 2000), however, the H19 promoter region in the ICR of the maternal chromosome showed highly variable methylation patterns in both hyperpigmented and normally pigmented skin of melasma patients (Figure 3). Moreover, no association between the two genes was detected (Figure 2), showing downregulation of IGF2 mRNA in more than one-half of the melasma patients. As non-methylated CpG-containing sequences within ICR has been selectively bound by CTCF, a known enhancer-blocking protein (Kanduri et al., 2000; Szabó et al., 2000), this data suggested that CTCF/ICR insulator function was not disturbed and mechanisms other than CTCF insulator function at the IGF2/H19 locus were involved in H19 downregulation, although it is uncertain how H19 RNA downregulation could occur without IGF2 mRNA overexpression in melasma. In fact, a similar phenomenon or lack of reciprocity has been reported, such as downregulation of H19 gene transcription in curcumin-treated tumor cells without making any change in monoallelic IGF2 expression (Novak Kujundzić et al., 2008) or loss of IGF2 imprinting without alteration of H19 imprinting in hepatoblastomas and Beckwith-Wiedemann syndrome (Brown et al., 1996; Joyce et al., 1997; Rainier et al., 1995). Moreover, the lack of an association between tumor development and melasma would not be explained if reciprocal regulation is detected in the patients.

As H19 downregulation was significantly correlated with melasma (Figures 1 and 2), it was expected that H19 knockdown in the cultured melanocytes could induce greater melanin synthesis through tyrosinase overexpression. However, the knockdown in the melanocyte monoculture did not result in tyrosinase overexpression (Figure 4B). For an adequate in vitro model for the experiment, the main source of H19 RNA should be identified. A report involving microRNA-derived from H19 in human keratinocytes (Cai and Cullen, 2007) provided an important clue regarding the source of H19. H19 RNA expression in the depigmented vitiligo epidermis (data not shown), also suggested that keratinocytes may be the main source. Moreover, H19 RNA expression was significantly higher in the cultured normal human keratinocytes than the melanocytes (data not shown). These results indicated that keratinocytes are the main source of H19 RNA and supported an important role of keratinocytes in the development of melasma. With this background information, a mixed cell culture system (composed of keratinocytes with H19 RNA knockdown and normal melanocytes) was used in the current study. In fact, H19 RNA knockdown in the mixed cell culture system induced more dramatic tyrosinase overexpression than in cultured normal melanocytes (Figure 4B). As a mechanism of tyrosinase overexpression in H19 knockdown, the inhibition study using specific inhibitors for each pathway concerning melanogenesis showed a role for the PKA and Erk pathways, and to a lesser extent, the Akt pathway (Figure 5B). The similar results were obtained from the experiments using two different H19 siRNAs, suggesting less chance for off-target effect of H19 knockdown.

Greater phosphorylation of Erk and CREB was also detected in the keratinocyte monoculture knocked down with H19 RNA, whereas it was not in the melanocyte monoculture (Figure 5A). Recently, an effective model system using double labeling with Trp-1 and keratin 14, has been developed to quantify the melanosome transfer efficacy from melanocytes to keratinocyte in vitro (Lin et al., 2008). Therefore, a role of melanosome transfer from melanocytes to keratinocytes was examined with respect to hyperpigmentation. In fact, H19 RNA knockdown increased the number of keratinocytes containing transferred melanosomes from the neighboring melanocytes (Figure 6).

Pregnancy (Sodhi and Sausker, 1988) and UV exposure (Kang et al., 2002; Sanchez et al., 1981) have been suggested to be important causes of melasma. Indeed, more than one factor may be involved in the development of melasma. Therefore, the combined effects of H19 RNA downregulation and estrogen treatment, and the effects of H19 RNA downregulation and UV exposure were examined. Interestingly, more than an additive effect on tyrosinase overexpression and CREB phosphorylation was detected with the combination of H19 RNA knockdown and estrogen treatment, whereas no such effect with the combination of H19 RNA knockdown and UV irradiation (Figure 7A, B). Although the full meaning of these results may not be apparent at this time, H19 RNA downregulation may induce a susceptibility for melasma development and the estrogen level achieved during pregnancy or contraceptive use may be sufficiently high to augment the effect of H19 RNA knockdown.

In summary, we have shown that downregulation of the H19 gene, which was detected in the patients with melasma, stimulates melanogenesis. These results suggest that H19 downregulation could be a novel mechanism in the development of melasma, proposing modulation of H19 downregulation as a new therapeutic approach for melasma.

Materials and methods

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

Patients

Fourteen female patients diagnosed with melasma between 34 and 63 yr of age (mean age, 48 yr) were included in the study. The Institutional Review Board of Dongguk University International Hospital approved this study, and the study was conducted according to the Declaration of Helsinki Principles. After obtaining informed written consent, skin specimens were obtained from biopsy. Pairs of normally pigmented and hyperpigmented samples were taken for direct comparisons. The location of the hyperpigmented lesions were the lateral side of the forehead or upper cheek. Control skin was taken from the retroauricular area. These specimens were used for RT-PCR and real time-PCR.

For UV-induced hyperpigmented skin specimens, normally pigmented skin of three patients with vitiligo, who were supposed to have autologous epidermal graft, was irradiated UVA after application of topical psoralen (topical PUVA) more than 10 times. All patients were female and between 19 and 35 yr of age (mean age, 27 yr). The skin color of the repeatedly irradiated abdomen showed dark brown in all three patients. Pairs of normally pigmented and hyperpigmented samples were biopsied from the abdomen. Two other females and one male patient with melasma between 49 and 53 yr of age were also included for determination of ICR methylation.

ICR methylation determination

Genomic DNA was extracted from skin samples by a standard phenol-chloroform method or using a Genomic DNA Extraction kit (iNtRON Biotechnology, Seongnam, Korea) according to the manufacturer’s directions. Bisulfate treatment was performed using a EZ DNA Methylation-Gold kit (Zymoresearch Corp., Orange, CA, USA) in accordance with the manufacturer’s instructions. To obtain the PCR product, nested PCR for bis1 were performed using 5 μl of bisulfate-treated DNA in the first amplification and 5 μl of the PCR product as a template in the second amplification (Frevel et al., 1999). The following primer pairs were used under the given conditions. For bis1, outer primer 1133 (5′-TGATGGTGGTAGGAAGGGGT-TTT TTGTGTT) and 1134 (5′-CTCCTC CAACACCCCATCTTCCCCTAATTA) at 0.75 mM MgCl2 and 57°C annealing temperature (AT); inner primers 1143 (5′-GGTATGGTGTTT TTT GAG GGGAGAT) and 1144 (5′-CATCCCACCCCCTCCCTCACCCTA) at 1 mM MgCl2 and 53°C AT. The PCRs were performed on a DNA Thermal Cycler 9600 (Applied Biosystems, Foster City, CA, USA). The bis1 PCR product was gel-purified using a GLASSMILK gel extraction kit (Q-BIOgene, Cambridge, UK). Each DNA fragment was cloned using a TOPO TA Cloning kit (Invitrogen, Frederick, MD, USA), in which the PCR product with a single 3′ adenine overhang was inserted into a PCR2.1-TOPO vector. The recombinant vector was transformed into competent E. coli. The amplified DNA was extracted using an AccuPrep Plasmid Extraction kit (Bioneer, Seoul, South Korea). Sequencing of the DNA was performed by Macrogen Co. (Seoul, South Korea).

Normal human epidermal melanocyte culture with H19 knockdown

Skin specimens obtained from repeated cesarean sections and circumcisions were used for cultures. Epidermis was separated from dermis after treatment with 2.4 U/ml of dispase (Roche, Mannheim, Germany) for 1 h. The epidermal sheets were treated with 0.05% trypsin for 10 min to produce a suspension of individual epidermal cells. The cells were suspended in Medium 254 (Cascade Biologics, Portland, OR, USA) supplemented with bovine pituitary extract, fetal bovine serum, bovine insulin, hydrocortisone, bFGF, and bovine transferrin (Cascade Biologics), heparin, and phorbol 12-myristate 13-acetate (Cascade Biologics). When the cells reached confluence, they were detached from the flask and seeded into other culture flasks. For the H19 downregulation, melanocytes cultured in 6-well plates were transfected with two different stealth™ siRNAs (Stealth 243 and Stealth 472) and a negative control stealth siRNA (Invitrogen) using Lipofectamine LTX (Invitrogen) and 60 nM siRNA, according to the manufacturer’s instructions. The each experiment was done after incubation for 48 h.

Normal human epidermal keratinocyte culture with H19 knockdown

Skin specimens obtained from repeated cesarean sections and circumcisions were used for cultures. Epidermis was separated from dermis after treatment with 2.4 U/ml of dispase (#295 825; Roche) for 1 h. The epidermal sheets were treated with 0.05% trypsin for 10 min to produce a suspension of individual epidermal cells. The cells were suspended in EpiLife Medium (#M-EPI-500-CA; Cascade Biologics) supplemented with bovine pituitary extract, bovine insulin, hydrocortisone, human epidermal growth factor, and bovine transferrin (#S-001–5; Cascade Biologics). When the cells reached confluence, they were detached from the flask and seeded into other culture flasks. For the H19 downregulation, keratinocytes cultured in 6-well plates were transfected with two different stealth™ siRNAs (Stealth 243 and Stealth 472) and a negative control stealth siRNA (Invitrogen) using Lipofectamine LTX (Invitrogen) and 60 nM siRNA, according to the manufacturer’s instructions. The each experiment was done after incubation for 48 h.

Mixed cell culture with H19 RNA knockdown with and without inhibitors, estrogen treatment, or UV irradiation

Custom Stealth™ RNAi duplexes for H19 were chemically synthesized by Invitrogen. Keratinocytes cultured in 6-well plates were transfected with two different stealth™ siRNAs (Stealth 243 and Stealth 472) and a negative control stealth siRNA (Invitrogen) using Lipofectamine LTX (Invitrogen) and 60 nM siRNA, according to the manufacturer’s instructions. After H19 knockdown for 24 h, normal human melanocytes were added to the keratinocytes. The mixed cells were incubated for 24 h in the media containing 2.5 μM U0126 (a MEK inhibitor) 15 μM LY294002 (a PI3K inhibitor), or 10 μM H89 (a PKA inhibitor) for the inhibition experiments. The estrogen treatment or UV irradiation was also done 24 h after H19 knockdown on the cells.

RT-PCR

Total RNA from the cultured cells under each condition, was obtained with Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription of the RNA was performed using the First Strand cDNA Synthesis Kit for RT–PCR (AMV; Boehringer Mannheim, Germany). Human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal standard. The primer sequences of H19 were composed of forward 5′-AAAGACACCAT-CGGAACAGC-3′ and reverse 5′-AGAGTCGTGGAG GCTTTGAA-3′. The primer sequences of GAPDH were forward 5′-TCCACTGGC-GTCTTCACC-3′ and reverse 5′-GGCAGAGATGATGACC CTTTT-3′. PCR amplification was conducted in a 40 μl reaction, consisting of 10× reaction buffer, 2.5 mM MgCl2, 250 μM dNTPs, 100 ng each PCR primer, 0.5 U Taq DNA polymerase, and 20–50 ng DNA, using a DNA Thermal Cycler 9600 (Applied Biosystems) at 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min for 30 cycles. The DNA fragments produced by PCR were separated by electrophoresis on a 2% agarose gel.

Real time-PCR

The level of H19 mRNA relative to GAPDH was measured by quantitative real-time PCR using the Light Cycler real-time PCR (Roche). The primers used were as follows: H19 5′-ATGACATGGTCCGGTG-TGA-3′ (Forward) and 5′-AGAAACAGA CCCGCTTCTTG-3′ (Reverse); IGF2 5′-CGCGGCTTCTACTTC AGC-3′ (Forward) and 5′-CGGGGGT-AGCACAGTACG-3′ (Reverse); GAPDH 5′-TCCACTGGCGTCTTCACC-3′ (Forward) and 5′-GGCAGAGATGATGACCCTTT-3′ (Reverse).

Western blot analysis

The cells were homogenized in ice-cold homogenization buffer containing 50 mM Tris-base (pH 7.4), 150 mM NaCl, 10 mM EDTA, 0.1% Tween-20, and protease inhibitors (0.1 mM phenylmethylsulfonylfluoride, 5 μg/ml aprotinin, and 5 μg/ml leupeptin). Equal amounts of extracted proteins (20 μg) were resolved using 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were incubated with anti-phospho-Erk, Erk, phospho-Akt, Akt, phospho-CREB, CREB (rabbit polyclonal; Cell Signaling Technology, Beverly, MA, USA), or tyrosinase (rabbit polyclonal; Santa Cruz Biotechnology, Santa Cruz, CA, USA) antibody, diluted 1:1000 in blocking solution, overnight at 4°C. The membranes were further incubated with anti-rabbit or anti-mouse horseradish peroxidase-conjugated antibody (Santa Cruz Biotechnology) and treated with an enhanced chemiluminescence solution (Thermo, Rockford, IL, USA). The signals were captured on an Image Reader (LAS-3000; Fuji Photo Film, Tokyo, Japan). To monitor the amount of protein loaded into each lane, the membranes were reprobed with mouse monoclonal anti-actin antibody (Sigma, St. Louis, MO, USA) and processed as described above. The protein bands were analyzed by densitometry.

Melanosome transfer

Cultured cells were washed thoroughly with phosphate buffered saline (PBS) and fixed for 20 min with 4% paraformaldehyde. The cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min and preincubated with 3% bovine serum albumin for 1 h at room temperature, and then incubated with two different primary antibodies; 1:100 anti-TRP-1 (goat anti-TRP-1 IgG) antibody and 1:200 anti-keratin 14 (mouse anti-keratin 14 IgG) for 2 h at room temperature. The cells were washed thoroughly with PBS and two secondary antibodies (Alexa Fluor 594-labeled donkey anti-goat IgG and Alexa Fluor 488-labeled goat anti-mouse IgG (Molecular Probes, Eugene, OR, USA) for 1 h at room temperature. The stained specimens were observed using an image analysis system (Dp Manager 2.1; Olympus Optical Co., Tokyo, Japan). Ten random fields per plate were assessed and the number of keratinocytes containing melanin was counted. Pigment transfer is represented as the percentage of control. Data are represented as the average ± SEM of at least five experiments (*P < 0.05).

Statistical analysis

Statistical significance was tested with Student’s t test. All results are presented as the mean ± SE of the combined data from replicate experiments.

Acknowledgements

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References

This study was supported by a grant of the Korea Healthcare Technology R&D Project (A080980), Ministry of Health Welfare and Family Affairs, Republic of Korea.

References

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Materials and methods
  8. Acknowledgements
  9. References