SEARCH

SEARCH BY CITATION

Keywords:

  • melanoma;
  • voltage-gated calcium channels;
  • PCR;
  • calcium imaging;
  • viability;
  • cell cycle;
  • pharmacology;
  • siRNA

Summary

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

The expression of voltage-gated calcium channels (VGCCs) has not been reported previously in melanoma cells in spite of increasing evidence of a role of VGCCs in tumorigenesis and tumour progression. To address this issue we have performed an extensive RT-PCR analysis of VGCC expression in human melanocytes and a range of melanoma cell lines and biopsies. In addition, we have tested the functional expression of these channels using Ca2+ imaging techniques and examined their relevance for the viability and proliferation of the melanoma cells. Our results show that control melanocytes and melanoma cells express channel isoforms belonging to the Cav1 and Cav2 gene families. Importantly, the expression of low voltage-activated Cav3 (T-type) channels is restricted to melanoma. We have confirmed the function of T-type channels as mediators of constitutive Ca2+ influx in melanoma cells. Finally, pharmacological and gene silencing approaches demonstrate a role for T-type channels in melanoma viability and proliferation. These results encourage the analysis of T-type VGCCs as targets for therapeutic intervention in melanoma tumorigenesis and/or tumour progression.


Significance

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

The involvement of pathophysiological Ca2+ signalling in cancer promises new therapeutic strategies. We present the first report of the expression of VGCCs in human melanocytes and a wide range of melanoma cells. Gene expression is correlated with the function of VGCCs in mediating Ca2+ influx. In addition, T-type Ca2+ channels are shown to be relevant for the viability and proliferation of melanoma cells. As T-type channel isoforms are expressed at detectable levels in melanoma cells but not in untransformed melanocytes, they may represent targets for melanoma treatment.

Introduction

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

Ionic calcium (Ca2+) as a universal second messenger is an essential regulator of the cell cycle and is indispensable for cell proliferation. The extracellular milieu is the ultimate source of cell Ca2+, which flows into the cells through specific channels present in the plasma membrane. Up to 10 genes have been described to encode the pore-forming subunits of voltage-gated Ca2+ channels (VGCCs), the most highly selective protein channels for Ca2+ ions. VGCCs activate and inactivate by depolarization of the plasma membrane and are classified in three different families based on sequence homology analysis and functional properties: (i) Cav1 family members encode mainly high voltage-activated L-type channels; (ii) Cav2 family members encode high voltage-activated P/Q-type, N-type and R-type channels; and (iii) Cav3 family members encode low voltage-activated T-type channels. The unique biophysical properties of T-type Ca2+ channels, i.e. low voltage activation ranges and transient kinetics of inactivation, confer a pattern of Ca2+ influx (in the shape of oscillatory Ca2+ waves) that appears crucial for cell cycle progression. The functional expression of T-type channels has been shown to increase in the proliferative stages of cultured smooth muscle (Kuga et al., 1996; Richard et al., 1992) and neonatal cardiomyocytes (Guo et al., 1998; Li et al., 2005). Conversely, the use of pharmacological inhibitors of T-type Ca2+ channels such as mibefradil or pimozide has proved effective in decreasing cell proliferation of a variety of cells, including smooth muscle, endothelial, glioma and breast cancer cells (Bertolesi et al., 2002; Schmitt et al., 1995; see Gray and Macdonald, 2006 for review).

Ca2+-dependent signalling is frequently deregulated in cancer cells and, importantly, VGCCs may play a role in remodelling Ca2+ homeostasis. An up-regulation of L-type channel Cav1.2 mRNA has been reported in colorectal cancer (Wang et al., 2000), whereas the enhanced expression of Cav3.1 and/or Cav3.2 T-type channels are common findings in a variety of tumour cells (see Taylor et al., 2008a for review). In melanoma cells, the expression of VGCCs has not been investigated thoroughly, even when available evidence indicates that Ca2+ signalling plays an important role in their viability and motility (Cox et al., 2002; Deli et al., 2007; Glass-Marmor et al., 1992). In the present study we examined whether VGCCs are functionally expressed in melanoma and play a critical role in the homeostasis of these cells.

Results

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

Expression of VGCCs in control normal melanocytes and melanoma cells

Standard reverse transcriptase PCR (RT-PCR) was performed to determine the expression of the three gene families encoding VGCCs in three fast-growing metastatic melanoma cell lines (M28, M36, JG), two average-growing metastatic cell lines (M16, M17), one slow-growing metastatic melanoma cell line (M29), one very slow growing primary tumour-derived cell line (M9) and three tumour biopsies (named B1, B2 and B3). In the first set of data, we compared the expression of VGCCs in control normal melanocytes and three selected melanoma cell lines (M16, M28 and JG) that were cultured in parallel, using melanocyte growth medium (see Methods) (Figure 1A). As the Ca2+-imaging experiments demonstrated the functional relevance of L-type and T-type channels in the melanoma cells (see below), we additionally checked up the expression of these channels by quantitative RT-PCR (Q-PCR) (Supporting Information Figure S1). Subsequently, we extended the analysis of VGCCs expression to all melanoma cell lines grown in standard high-glucose DMEM, and to the biopsies (Figure 1B).

image

Figure 1.  RT-PCR expression analysis of human genes encoding VGCCs. (A) Comparison of VGCC expression in control normal melanocytes (M) and three selected melanoma cell types (M16, JG and M28) cultured in melanocyte growth media. (B) Extended analysis for the same melanoma cell lines as in (A), plus M9, M29, M17 and M36, all cultured in melanoma standard high-glucose medium. The analysis included three biopsies taken from metastatic melanomas (B1, B2, B3). Results were validated at least three times from independent RT-PCR reactions. The first lane shows the MW markers, the 250-bps band being the most prominent. RT−, minus reverse transcriptase.

Download figure to PowerPoint

L-type channels

We tested the expression of L-type Ca2+ channels by RT-PCR using specific primers for Cav1.2 and Cav1.3 pore-forming subunits. Both channel isoforms have been suggested recently to play a role in the Ca2+-dependent events underlying mitotic progression in endocrine cells (Loechner et al., 2009). Expression of Cav1.2 channels was found to be widespread, with positive results in all melanoma cells and two metastatic cell lines (M17 and JG), whereas the channels were undetectable in control normal melanocytes. In contrast, Cav1.3 channels were ubiquitously expressed in all metastatic cell lines, the primary tumour and the biopsies, while showing the highest levels in control normal melanocytes (Figures 1A,B and S1).

N-type, P-Q-type and R-type channels

Melanocytes are specified from pluripotent neural crest cells that delaminate from the developing neural tube in the initial stages of development (Silver and Pavan, 2006). Because of the common embryological origin with peripheral nervous and neuroendocrine tissue, we examined the expression of Ca2+ channels belonging to the Cav2 family, which play a well known role in neurotransmitter release and neurosecretion (Evans and Zamponi, 2006 for review). Our results show that control normal melanocytes expressed transcripts for Cav2.1, Cav2.2 (low expression) and Cav2.3 channels (Figure 1A). Melanoma cells also expressed the three Cav2 isoforms, with the following exceptions: Cav2.2 was not amplified from M17 and JG metastatic cell lines, Cav2.3 was not amplified from M16 and JG metastatic cell lines or the M9 primary tumour cell line (Figure 1B).

T-type channels

Low voltage-activated T-type channels are involved in cell proliferation and the expression of T-type channel isoforms is up-regulated in different tumours (Panner and Wurster, 2006; Taylor et al., 2008a). As shown in Figure 1B, the expression of T-type channels was detected in all melanoma cell lines and biopsies, although we found qualitative and quantitative differences in the expression of the different isoforms: the M9 primary tumour cells, the M29 and M16 metastatic cells and the B3 biopsy expressed the highest levels of Cav3.1, while showing lower levels of Cav3.2 transcripts. Interestingly, this pattern of expression was linked to a slower proliferation rate (see Table 1 and Supporting Information Figure S2). Only two cell lines derived from skin metastasis (M28 and M29) and two melanoma biopsy samples (B1, B2) expressed Cav3.3 channels, with no concomitant decrease in the level of Cav3.2 expression.

Table 1.   Origin, nomenclature, proliferation rate and expression of VGCC types on the different samples of cells of melanocytic lineage (1 – control normal melanocytes, 2 – cutaneous melanoma cell lines and 3 – melanoma tissue samples)
Origin of samplesName of sample (cell proliferation rate)T-typeL-typeN, P-Q, R-type
  1. LPR, low proliferation rate; MPR, medium proliferation rate; HPR, high proliferation rate; CSF, cerebrospinal fluid.

1 – Neonatal human epidermal melanocytesHEMn-LPCav3.1 (very low)Cav1.3Cav2.1 Cav2.2 (low) Cav2.3
2 – Melanoma cell lines
 Primary tumorM9 (LPR)Cav3.1 Cav3.2 (low)Cav1.2 Cav1.3 (low)Cav2.1 Cav2.2 Cav2.3 (low)
 Metastasis (skin)M29 (LPR)Cav3.1 Cav3.2Cav1.2 Cav1.3Cav2.1 Cav2.2 (low) Cav2.3
M16 (MPR)Cav3.1 Cav3.2 (low)Cav1.2Cav2.1 Cav2.2 (low)
M17 (MPR)Cav3.1 (low) Cav3.2Cav1.3Cav2.1 Cav2.3
JG (HPR)Cav3.2 Cav3.3NoneCav2.1
M28 (HPR)Cav3.2 Cav3.3Cav1.2 Cav1.3Cav2.2 Cav2.3
 Metastasis (CSF)M36 (HPR)Cav3.2Cav1.2 Cav1.3Cav2.1 (low) Cav2.2 Cav2.3
3 – Melanoma biopsies
 Metastasis (skin)B1Cav3.2 Cav3.3Cav1.2 Cav1.3Cav2.1 Cav2.2 Cav2.3
 Metastasis (lymph node)B2Cav3.1 Cav3.2 Cav3.3Cav1.2 Cav1.3Cav2.1 (low) Cav2.2 Cav2.3
 Metastasis (intraparotid)B3Cav3.2Cav1.2 Cav1.3Cav2.1 Cav2.2 Cav2.3

Importantly, very low levels of Cav3.1 transcripts were detected as the only T-type channel isoform expressed in control normal melanocytes (Figures 1A and S1). As stated above, for these RT-PCR experiments we used three melanoma cell lines (M16, M28 and JG) as positive controls, cultured in parallel with control normal melanocytes in melanocyte growth medium, although in these conditions their proliferation rate was significantly lower than that attained in standard high-glucose medium (data not shown).

Moderate hypoxia induces the selective up-regulation of T-type and L-type channels

Physiological skin hypoxia has proved to be a relevant factor for melanocyte transformation and melanoma development (Bedogni and Powell, 2006). It had been shown that Cav3.2 channels are up-regulated via the activation of hypoxia inducible factor-2 (HIF-2) in PC12 cells (Del Toro et al., 2003), and that Cav3.1 channels are down-regulated by HIF-1 in neonatal cardiomyocytes (Pluteanu and Cribbs, 2009). Therefore, we decided to test whether the expression of Cav3 channels was regulated by hypoxia in control normal melanocytes and melanoma cells. JG, M16 and M28 cells at 70–80% confluence were placed in a hypoxic incubator and exposed to 2% O2 for 24 h. Control plates were kept in a normoxic state and processed in parallel. RT-PCR data showed the up-regulation of selective T-type channels by hypoxia, which was specific to the cell type. Thus, Cav3.1 (and Cav3.2 to a minor extent) were up-regulated in fast-growing JG and M28 cells but not in average-growing M16 cells (Figure 2B). Hypoxia did not induce the up-regulation of any of the three T-type channel isoforms in control normal melanocytes but did induce a down-regulation of the already low levels of Cav3.1 (Figure 2A).

image

Figure 2.  Hypoxic up-regulation of T-type channel isoforms in control normal melanocytes and a selection of melanoma cell lines (M16, JG and M28). RT-PCR was performed to amplify T-type channel transcripts from the cells incubated in a normoxic (N) or hypoxic (H, 2% O2) atmosphere for 24 h. (A) None of the transcripts for Cav3 channel isoforms was amplified from control normal melanocytes, irrespective of the O2 concentration. (B) Induction of Cav3.1 and Cav3.2 channel transcripts by hypoxia in fast-growing JG and M28 metastatic melanoma cells. (C) VGCC gene expression analysis by Q-PCR in the same cell lines as above. Histograms show mean fold expression in hypoxia related to the mean of the normoxic control (‘ratio to control’). Absence of bars indicates undetectable levels in control conditions. Data was obtained from triplicate measurements in each of three to six independent experiments. *Significant differences related to control group (P < 0.05). RT−, minus reverse transcriptase.

Download figure to PowerPoint

We also checked the effect of a moderate hypoxic environment on the expression levels of L-type channels, by RT-PCR. Under hypoxic conditions, the expression of L-type Cav1.2 channels was increased in the JG cell line compared with normoxia conditions. In contrast, the expression of Cav1.3 channels was slightly reduced by hypoxia in control normal melanocytes (Figure 2A).

We complemented these data by performing a series of Q-PCR experiments. This approach confirmed that the up-regulation of Cav3.1 (up to 60-fold) and Cav3.2 (≈two-fold) T-type channels by hypoxia was restricted to the fast-proliferating JG and M28 cell lines, whereas the expression of both isoforms was reduced by hypoxia in medium-proliferating M16 cells. Consistent with the RT-PCR data, these experiments also showed that the expression of the L-type Cav1.2 channels was increased by hypoxia in JG cells (≈three-fold), remaining unchanged in M16 and M28 cells, whereas Cav1.3 channels were down-regulated by hypoxia in all cell lines (Figure 2C).

Functional expression by calcium imaging

To examine the functional expression of the VGCCs and their contribution to Ca2+ influx, we performed a series of Ca2+ imaging experiments using the membrane permeable acetoxymethylester (AM) form of the fluorescent dye FURA-2 in a dynamic fluorescence set-up in control normal melanocytes and a selection of melanoma cells.

The following different experimental paradigms were used to demonstrate the functional expression of high and low voltage-activated channels.

Voltage-dependent Ca2+ influx: depolarization and Bay K 8644

To demonstrate the function of high voltage-activated Ca2+-channels, untransformed melanocytes and melanoma cells were perfused with a high K+ Ringer solution. KCl-mediated depolarization did not induce detectable changes in the cytosolic Ca2+ levels in melanocytes, with only small elevations in melanoma JG cells. In contrast, high K+ triggered consistent increases of the F340/F380 ratio in Cav1.2-expressing M16 and M28 cells. The addition of Bay K 8644 (an L-type channel activator) resulted in equivalent increases of F340/F380 in M16 and M28 cells, indicating that L-type Cav1.2 channels were the main carriers of depolarization-mediated Ca2+-influx (Figure 3A,B).

image

Figure 3.  Increases of cytosolic Ca2+ in response to sequential membrane depolarization, and pharmacological activation of L-type channels in control melanocytes (M) and melanoma cells (JG, M16 and M28). Cytosolic Ca2+ levels in Fura-2-loaded cells were monitored as the fluorescence ratio at 340 and 380 nm (F340/F380). In ‘double pulse’ experiments, KCl-driven depolarization and Bay K 8644 application failed to induce changes in the F340/F380 ratio of control melanocytes, and only minor increases could be recorded in JG cells. However, both stimuli elicited consistent increases of F340/F380 in the M28 and M16 melanoma cell lines, demonstrating the functional expression of L-type Cav1.2 channels. (A) Average F340/F380 data points from six to 12 cells recorded in a single experiment, as indicated. Standard deviation values are represented as error bars every 50 points, for clarity. (B) Fold-increase of the F340/F380 ratio values induced by paired-KCl and Bay K 8644 pulses. Values are represented as means ± SD (n = 37 for melanocytes, n = 37 for JG, n = 17 for M28, n = 21 for M16).

Download figure to PowerPoint

All M16 and M28 melanoma cells responded to the high K+ and Bay K 8644 challenges, even when showing individual differences. Often, either the depolarizing or the pharmacological stimuli triggered secondary increases of the intracellular Ca2+, suggesting a coupling of L-type channels to the intracellular Ca2+ reservoirs (Figure S3).

Constitutive Ca2+ influx: Mn2+ quenching at the FURA-2 isosbestic point

The function of low voltage-activated Ca2+-channels was confirmed by measuring the rate of Mn2+ influx into the cells, following the approach first described by Jacob in 1990 (see Methods). A rapid quenching of the FURA-2 fluorescence (excitation at the Ca2+-insensitive excitation wavelength of 360 nm) resulted from 200 μM Mn2+ perfusion in the two tested melanoma cell lines, M16 and M28, in contrast to a 10-fold slower decay of the fluorescence in control normal melanocytes (Figure 4A,D). This result is consistent with the increased expression of T-type channels in melanoma cells, compared with melanocytes. Furthermore, when we included the T-type channel blocker mibefradil in the perfusate for M16 and M28 melanoma cells, the rate of fluorescence quenching by Mn2+ was four- to five-fold slower, indicating a participation of T-type channels in the constitutive Ca2+ influx (Figure 4B–D).

image

Figure 4.  Basal Mn2+ influx and its inhibition by mibefradil. Fura-2-loaded cells were exposed to 200 μM MnCl2 dissolved in a Ca2+-free Ringer solution, as indicated. The Mn2+-induced decrease of the normalized Fura-2 fluorescence was recorded at the isosbestic (Ca2+-independent) excitation wavelength (360 nm). (A) Comparison of the Mn2+-induced quenching of control normal melanocytes (open circles), M28 (closed circles) and M16 (open triangles) Fura-2-loaded cells. (B) Mn2+-induced quenching of Fura-2 fluorescence in M28 melanoma cells in the absence (closed circles, same curve as in A) and presence of mibefradil (open circles), displaying a much slower time course. (C) Mn2+-induced quenching of Fura-2 fluorescence in M16 melanoma cells in the absence (closed circles, same curve as in A) and presence (open circles) of mibefradil (10 μM), which again slowed down of the quenching. Traces shown in (A–C) were obtained by averaging three independent experiments. (D) Quantification of the Mn2+-induced quenching rate of all analyzed cell types as the time taken for the fluorescence signal to decay to 67% of the initial value (decay time constant). Histogram bars represent mean ± SD values from at least three independent experiments (n = 20 for melanocytes, n = 28 for M28 cells, n = 29 for M28 cells in the presence of mibefradil, n = 40 for M16 cells, n = 27 for M16 cells in the presence of mibefradil). *Statistical significance of P < 0.001 achieved by application of the Mann–Whitney rank sum test (means compared: melanocytes versus M28 cells, M28 cells versus M28 cells in the presence of mibefradil, M16 cells versus M16 cells in the presence of mibefradil).

Download figure to PowerPoint

Effect of the pharmacological blockade of VGCCs on viability of melanoma cells

To investigate a possible role of VGCCs in melanoma cell proliferation and survival, we examined the effect of VGCC blockade on cell viability. We performed WST-1 metabolic assays on a selection of melanoma cell lines (M16, JG, M28) treated with some of the most specific VGCC blockers available: the neurotoxins kurtoxin (T-type channel blocker), ω-agatoxin IVA (P-Q type channel blocker), ω-conotoxin GVIA (N-type channel blocker), rSNX-482 (R-type channel blocker) and the dihydropyridines nimodipine and nifedipine (L-type channel blockers). After treatment for 24 h, kurtoxin had the strongest effect and reduced the viability of all melanoma cells by an average of 38–41% (Figure 5). Kurtoxin treatment was non-effective in control normal melanocytes (non-significant 3% reduction of viability; Figure 5), consistent with the lack of expression of T-type channels in these cells. In contrast, L-type channel blockers nimodipine and nifedipine negatively affected the viability of both control normal melanocytes (11 and 6%, respectively) and melanoma cells (12–15 and 8–10%, respectively; Figure 5). The rest of the VGCC channel blockers also had a moderate effect on control normal melanocytes and melanoma cells (2–11% reduction of viability; Figure 5).

image

Figure 5.  Effect of VGCC pharmacological blockers on cell viability. The viability of melanoma cells was measured using the WST-1 proliferation assay. Absorbance values at 440 nm, obtained from cells subjected to the different treatments, are expressed as the percent reduction with respect to control untreated cells. T-type channel blocker kurtoxin (KTx, 250 nM) did not significantly affect the viability of control normal melanocytes, consistent with the lack of expression of T-type channels in these cells (Figures 1 and 2). In contrast, kurtoxin induced a similar reduction of viability in all cell lines tested (M28, M16 and JG, values ranging from 38 to 41% reduction in viability). Blockers specific for L-type (nimodipine and nifedipine, 10 μM), P-Q-type (ω-Aga-IVA, 500 nM), N-type (ω-Cntx, 1 μM) and R-type (SNX-482, 250 nM) channels had a moderate effect on the viability of melanocytes and melanoma cell lines, ranging from 6 to 15% reduction. Three to four independent experiments were performed per cell type and treatment, using parallel controls and triplicate measurements of each. *Significant differences related to control (melanocytes), P < 0.01.

Download figure to PowerPoint

Role for T-type channels in melanoma cell cycle progression

We further studied the effects of T-type channel blockers on the viability of melanoma JG cells by analyzing the DNA content after propidium iodide staining using flow cytometry. T-type channel blocker kurtoxin induced a significant increase of the percentage of cells at the G1 phase, while reducing the percentage of cells at the S phase, which indicates cell cycle arrest (Figure 6A).

image

Figure 6.  Flow cytometry analysis and cell cycle distribution of JG and M16 melanoma cells: effect of T-type channel pharmacological blockade and gene silencing. (A) JG cells were incubated with 250 nM kurtoxin for 24 h. Kurtoxin treatment slowed down the cell cycle by concomitantly increasing the percentage of cells at the G1 phase and decreasing the percentage of proliferating (S phase) cells. (B) siRNA-mediated Cav3.1 knockdown halted the progression of cell cycle from G1 to S phase of M16 melanoma cells. (C) Similarly, siRNA-mediated Cav3.2 knockdown in JG melanoma cells promoted cell cycle arrest at the G1 and S phases. (D) Q-PCR analysis of the level of Cav3.1 and Cav3.2 knockdown in M16 and JG cells, respectively, for the experiments displayed in (B) and (C). (A–C, left and center) Graphs display the cell cycle profiles of representative experiments. (A–C, right) Histograms for the mean values (±SEM) (n = 3) of the different cell cycle phases using flow cytometric analysis. *Significant differences related to control group (P < 0.05).

Download figure to PowerPoint

To ascertain a direct role of Cav3 channels in the regulation of cell cycle progression, we performed a set of siRNA-mediated Cav3.1 knockdown experiments in M16 cells and Cav3.2 knockdown experiments in JG cells. Q-PCR demonstrated a 58% reduction of Cav3.1 transcripts in M16 cells and a 63% reduction of Cav3.2 transcripts in JG cells compared with the cells transfected with control siRNA (Figure 6D). These reduced levels of Cav3.1 and Cav3.2 genes induced cell cycle arrest at the G1 and S phases (Figure 6B,C), in a pattern similar to that induced by kurtoxin, albeit to a lesser extent.

Cell proliferation in hypoxia

Having shown that hypoxia regulates T-type channel expression, and that T-type channels are directly involved in the melanoma cell cycle progression, we next examined the effect of hypoxia on the cell cycle parameters. A 2% O2 atmosphere (applied for 24 h) had opposite effects on the growth rate, depending on the melanoma cell type: the percentage of proliferating M16 cells was reduced, whereas the percentage of proliferating JG cells was increased (Figure 7). These opposite effects of hypoxia on the proliferation rate of M16 and JG cells correlate with the opposite effects of hypoxia on T-type channel expression in these cell types (see Figure 2).

image

Figure 7.  Flow cytometry analysis and cell cycle distribution of JG and M16 melanoma cells: effect of hypoxia. (A, Left and center graphs) Representative profiles for M16 cells grown in normoxia and 2% O2, respectively. Hypoxia induced a small increase of the percentage of cells in the G1 phase, and a concomitant reduction of cells in the proliferative S phase. (B, Left and center graphs) Representative profiles for JG cells grown in normoxia and 2% O2, respectively. Hypoxia induced G1-S progression, contrary to the effect in M16 melanoma cells. (A–B, right) Histograms summarize data for cell cycle parameters in M16 and JG melanoma cells, respectively. *Significant differences related to control group (P < 0.05).

Download figure to PowerPoint

To further elucidate the relationship between hypoxia, T-type channels expression and proliferation rate, we silenced Cav3.1 and Cav3.2 genes in JG cells subject to hypoxia. Under these conditions the Cav3.1/Cav3.2 expression ratio is increased by about 30-fold (Figure 2C). The transfection of Cav3.1 siRNA completely prevented its hypoxia-mediated up-regulation and, in fact, the Cav3.1 transcripts were reduced to a 57% of the normoxia levels (Supporting Information Figure S4A). In comparison, the Cav3.2 transcripts were reduced to 30% of the normoxia levels in the JG cells transfected with Cav3.2 siRNA (Figure S4A). Both siRNAs were able to reverse the hypoxia-mediated effects on cell cycle parameters and, for Cav3.2 knockdown, the percentage of cells arrested at the G1/S phase was significantly higher than in JG cells grown in normoxia (Figure S4B).

Discussion

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

VGCCs are expressed in different tumours and the role they play in cancer progression is a lively field of research. In the present work we have performed a comprehensive analysis of the expression of the different VGCC families in a variety of melanoma tumours and cell lines. We have found that human melanoma cells express VGCCs from three different families: (i) high voltage-activated L-type channels, which require significant depolarization to open and thus are widely distributed in excitable tissues; (ii) high voltage-activated N-type, P-Q type and R-type channels, classically involved in neurotransmitter and hormone release; and (iii) low voltage-activated T-type channels, which can operate at potentials near the typical membrane potentials of most cells.

Expression of L-type channels

Our results show that transcripts for Cav1.2 were undetectable in control normal melanocytes and strongly expressed in all melanoma cells except for JG and M17 skin metastasis. In contrast, the Cav1.3 isoform was ubiquitously expressed in control normal melanocytes and all melanoma cells.

L-type channels are functionally diverse. Whereas Cav1.2 channels are characterized by a high threshold and slow kinetics of activation, Cav1.3 channels have been shown to be mid-threshold activating and to display faster activation kinetics (Koschak et al., 2001; Lipscombe et al., 2004). These properties would enable Cav1.3 channels to operate at voltages near the resting membrane potential, mediating oscillatory Ca2+ entry along with T-type channels. Even though the viability assays presented in Figure 5 are not suggestive of a principal role for L-type channels in proliferation or survival, it should be taken into account that dihydropyridine actions are channel state-dependent (Triggle, 2003), and that Cav1.3 are less sensitive than other L-type channels to dihydropyridines (Koschak et al., 2001). These considerations, together with the lack of Cav1.2 expression in untransformed melanocytes and the up-regulation of Cav1.2 channels by hypoxia in JG melanoma cells, encourage further investigation of the role of L-type channels in the melanoma cell physiology.

Expression of N-type, P-Q type and R-type channels

Experimental evidence shows that melanocytes display a variety of neuroendocrine functions and release neurotransmitters, neuropeptides and hormones, and this production is stimulated by ultraviolet radiation and different biological factors (reviewed by Slomisnky, 2009). On the other hand, the role of VGCCs Cav1 and Cav2 family members in neurosecretion is well established, particularly in the chromaffin and pheochromocytoma neurosecretory cells (Marcantoni et al., 2007 for review). Our results show that both control normal melanocytes and melanoma cells (primary tumours and metastasis) express Cav2 channels, although the expression profile of the individual isoforms is variable. As for Cav1 channels, the data from the viability assays discard a direct participation of Cav2 channels in cell cycle regulation. However, the ability to correlate qualitative or quantitative changes in Cav2 expression with the neuroendocrine activity of tumours, may shed light on how melanocyte transformation may be accompanied by neuroendocrine differentiation (Eyden et al., 2005).

Expression of T-type channels

Our finding regarding the up-regulation of T-type channels in melanoma cells was expected, as a role for T-type channels in cancer cell proliferation has been established (Gray and Macdonald, 2006; Taylor et al., 2008b; Toyota et al., 1999). The relevance of T-type channel expression in melanoma cells is highlighted by the fact that Cav3 isoforms may be selectively up-regulated in moderate hypoxic conditions which approach the real hypoxic environment of skin and the high oxygen demand in metastasis. The effect of kurtoxin in reducing the percentage of proliferating melanoma cells further suggests a relevant role for Cav3.1 and Cav3.2 channels (as the primary targets of kurtoxin, see Chuang et al., 1998) in cell cycle control. Nonetheless, the stronger effect of kurtoxin on the viability of melanoma cells as measured by a colorimetric assay (compare Figures 5 and 6) suggests that these T-type channels play an additional role in cell homeostasis maintenance. In line with this, it has been shown that T-type channel blockers are inducers of autophagy in PC12 cells (Williams et al., 2008).

The Ca2+ imaging experiments indicate that cultured melanoma cells display a basal Ca2+ influx which can be reduced by mibefradil. This result is consistent with the occurrence of T-type channel window currents, providing the pattern of Ca2+ signalling required for cell cycle progression. Ca2+ transients are evident during certain stages of mitotic progression and these signals are transduced principally by direct binding of Ca2+ to intracellular receptors such as calmodulin (Kahl and Means, 2003 for review). A few models have been put forward to explain the role of T-type channels in promoting transient elevations of cytosolic Ca2+, acting in concert with K+ channels (Panner and Wurster, 2006).

The precise signalling mechanisms for specific T-type channel subunits remain unknown (but see Mariot et al., 2002). In this regard, our finding about the counter-balanced expression of Cav3.1 and the other Cav3 channels, and the linkage between Cav3.1 expression and a low proliferation rate, is intriguing. On one hand, we have shown that melanoma JG or M28 cells (expressing mainly Cav3.2 channels in normoxia) display a faster proliferation rate compared with Cav3.1-expressing M16 cells. Furthermore, other cell lines expressing Cav3.1 channels are either average-proliferating (M17) or slow-proliferating (M9 and M29). On the other hand, the siRNA experiments show a direct involvement of both Cav3.1 and Cav3.2 isoforms in the proliferation of M16 and JG cells, respectively, as the percentage of cells in the S phase is decreased upon silencing. Importantly, hypoxia experiments point in the same direction. In JG cells, in which both Cav3.1 and Cav3.2 are up-regulated by low O2, the percentage of cells in the S phase is increased. In contrast, M16 cells under hypoxia experience a down-regulation of both Cav3.1 and Cav3.2 T-type channels and consequently are arrested at the G1 and S phases. The reversal of hypoxic effects on cell proliferation by Cav3.1 and Cav3.2 gene silencing further confirms the pivotal role of these T-type channels in the control of the cell cycle. Altogether, our data suggest that, whereas both Cav3.1 and Cav3.2 channels promote the progression of the melanoma cell cycle, Cav3.1 channels associate to slow cycling and are induced in environmentally stressful conditions.

Conclusion

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

Melanoma incidence has increased up to three-fold in the last three to four decades (Kwong et al., 2007). Because melanoma tumours respond poorly to chemotherapy and radiotherapy, diverse therapies targeting specific molecules involved in melanoma progression are under evaluation (Martinez-Alonso et al., 2009; Mayorga et al., 2006; Yeramian et al., 2011).

The involvement of pathophysiological Ca2+ signalling in cancer promises new therapeutic strategies. There are a growing number of publications describing the expression of Ca2+ channel types in cancer, and the functional consequences of channel blockade on tumour parameters such as growth, migration or invasion. Here we present seminal data demonstrating the expression of a wide range of VGCCs in melanoma cells and the involvement of T-type channels in cell cycle control. Beyond physiological implications, our findings encourage the analysis T-type channels as possible targets for pharmacological or gene therapy against melanoma metastasis.

Methods

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

Cell cultures, tumour tissues and treatment procedures

Seven human malignant melanoma cell lines of cutaneous origin were obtained from the Department of Immunology of the Hospital Clínic de Barcelona (Spain). These cell lines were already being employed in human immunization protocols. M9 was derived from a primary tumour, whereas M16, M17, M28, M29, M36 and JG originated from malignant melanoma metastasis. The melanocytic lineage of these cell lines was previously confirmed by immunodetection of the specific melanoma cell markers S100 and HMB-45 (see Table 1, modified from Sorolla et al., 2008). Cell lines were classified as low-, average- (medium) or high-proliferating, depending on the time needed to double the cell population (Table 1). The cells were cultured in DME medium supplemented with 10% fetal calf serum, penicillin-streptomycin and fungizone amphotericin B (Invitrogen, Carlsbad, CA, USA) at 37°C and 5% CO2. Where indicated, hypoxia (2% O2, 93% N2, 5% CO2) was achieved using an In Vivo2 hypoxic workstation (Ruskin Technologies, Leeds, UK).

The sampling of melanoma cells was completed by additional examination of three metastatic tumour biopsies (B1, B2 and B3), which were performed and diagnosed as melanoma tumours in the Hospital Universitari Arnau de Vilanova (Lleida, Spain) (Table 1). These samples were obtained with the approval of the local Ethical Committee and a specific informed consent was used. The biopsies were frozen embedded with Tissue Tek OCT (Sakura Finetechnical, Tokyo, Japan) for cryoprotection, and maintained at −80°C until use.

Neonatal human epidermal melanocytes (HEMn-LP) were purchased from Cascade Biologicals Inc. (Portland, OR, USA) and cultured according to the provider’s instructions. Melanocytes were maintained in Medium 254 supplemented with HMGS-2 (hereafter referred as melanocyte growth media; Invitrogen) at 37°C and 5% CO2.

Chemical reagents

2-(2-Methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-1) was obtained from Roche Applied Science (Indianapolis, IN, USA). The Ca2+ channel modulators nimodipine, nifedipine, (S)-(−)-Bay K 8644, kurtoxin and mibefradil were purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA). The Ca2+ channel modulators ω-agatoxin IVA, ω-conotoxin GVIA and rSNX-482 were obtained from Alomone Labs Ltd (Jerusalem, Israel).

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Total RNA was prepared from each human melanoma cell line/biopsy and melanocyte culture using Trizol reagent (Invitrogen). Messenger RNA was reverse-transcribed (RT) to cDNA (42°C for 1 h, 50°C for 1 h and 90°C for 10 min) using random hexamers and Superscript II reverse transcriptase (Applied Biosystems, Carlsbad, CA, USA). Negative control RT-minus reactions were carried out to establish that the target RNA was not contaminated with DNA.

The cDNA product was used as a template for subsequent PCR amplifications for VGCC pore-forming subunits. Primers were designed to be complementary to the published human sequences for each of the pore-forming subunits of the VGCCs and to include as many known variants as possible. Where indicated, RT-PCR primer sequences were obtained from the available scientific literature. The housekeeping gene GAPDH was used as a loading control. Table 2 contains primer sequences, product sizes and PCR conditions. For each set of primers, RT-PCR was repeated a minimum three times in independent samples.

Table 2.   Oligonucleotides used to amplify transcripts of pore-forming Ca2+ channel subunits
 Accession no.SequenceLength (bp)Temp.
  1. Length, length in base-pairs of the PCR product; Temp., annealing temperature used in the PCR reaction.

  2. Primers for amplifying Cav2 transcripts were obtained from the available literature: Cav2.1 as in Wimmers et al. (2008); Cav2.2 as in Chiou (2006); Cav2.3 as in Pereverzev et al. ( 2002).

Cav1.2NM_000719Forward: GCCGAAGACATCGATCCTGA Reverse: GAAAATCACCAGCCAGTAGAAGA26758°C
Cav1.3NM_000720Forward: GCATTGGGAACCTTGAGCATGTGTCTG Reverse: GCGAGCTGTCATCCTCGTAGC25555°C
Cav2.1NM_000068Forward: CGATGCCTCAGGGAACACTTGG Reverse: CCATGTACCCATTGAGCTCACG19758°C
Cav2.2NM_000718Forward: CATCAACCGCCACAACAACT Reverse: ACATCAGAAAGGAGCACAGG20558°C
Cav2.3NM_000721Forward: GGAGAAGATAACATTGTCAGGAAATATGCCAAGAAGCTCAT Reverse: GCCACAATTTTGATCCC21855°C
Cav3.1NM_018896Forward: GGTCCGGCACAAGTACAACT Reverse: CACAATGAGCAGGAACGAGA18755°C
Cav3.2NM_021098Forward: TCGAGGAGGACTTCCACAAG Reverse: TGCATCCAGGAATGGTGAG22555°C
Cav3.3NM_021096Forward: GGTGTCGTGGTGGAGAACTT Reverse: GTGCACATGGAGTGGATGAG17358°C
GAPDHAF261085Forward: AGAAGGCTGGGGCTCATTTG Reverse: AGGGGCCATCCACAGTCTTC25855°C

Quantitative PCR

Total RNA 1 μg was used to generate cDNA with Superscript II reverse transcriptase as above. A 1-μl aliquot of each synthesized cDNA was analyzed by Q-PCR (ABI Prism 7000 HT sequence detection system; Applied Biosystems). All assays were based on TaqMan hydrolysis probes labelled with FAM (green fluorescent fluorophore 6-carboxyfluorescein). Samples were assayed in triplicate for each gene and the mean expression was used during subsequent analysis. Relative expression was calculated using the comparative △△CT method (Bulletin #2; Applied Biosystems).

Pre-designed gene-specific primer pairs and probe were selected for the human target genes CACNA1C (Cav1.2), CACNA1D (Cav1.3), CACNA1G (Cav3.1), CACNA1H (Cav3.2) and CACNA1I (Cav3.3), and an endogenous control (GAPDH) from a list of pre-designed assays (Applied Biosystems).

Cell viability assays

Cell viability was measured by the WST-1 colorimetric assay, which assesses the ability of metabolically active cells to reduce water-soluble forms of tetrazolium. Human melanocytes and melanoma cells were plated on M96 well plates at a density of 4000 cells per well. After 24 h, the cells were treated with the Ca2+ channel modulators as appropriate for further 24 h. After treatment, the drugs were washed out and the cells were incubated for 60–120 min with 0.5 mg/ml of WST-1 reagent. Absorbance was measured at 440 nm wavelength using a reference filter at 620 nm wavelength in a microplate reader (Bio-Rad Laboratories Inc., Hercules, CA, USA). Viability assays were performed at least three times in independent experiments, using triplicate measurements in each.

Gene knockdown by siRNA

Briefly, JG melanoma cells were plated at 50% confluence. Transfection of oligonucleotides was performed in OptiMEM medium containing 25 nM RNA and Lipofectamine™ RNAiMAX reagent (Invitrogen) following the manufacturer’s instructions. After 8 h the medium was changed to regular culture medium. To increase efficiency, a second transfection was performed the following day. Cells were processed 24 h after the second transfection. In each experiment, the knockdown efficiency was analyzed by real-time PCR.

Calcium imaging

Changes in the concentration of intracellular Ca2+, [Ca2+]I, were measured using the membrane permeable acetoxymethylester form of the fluorescent dye FURA-2.

Cells were grown on 10 μg/ml poly-l-lysine-coated glass coverslips for 24 h and incubated for 60 min at 37°C in culture medium containing 10 μM of FURA-2/AM (Invitrogen). This procedure resulted in an even distribution of the fluorescent dye in the melanocytes and selected melanoma cells. The cells were rinsed with physiological solution to remove the extracellular dye and the coverslips were mounted on an inverted epifluorescence microscope Eclipse TE 200 (Nikon, Tokyo, Japan) equipped with a Spectramaster monochromator (Olympus, Tokyo, Japan) and a ORCA-AG CCD camera under the control of aquacosmos software (Hamamatsu Photonics, Hamamatsu, Japan). In the experiments designed to measure Ca2+ influx, the FURA-2 dye was dually excited at wavelengths of 340 and 380 nm and emitted fluorescence was measured at 510 nm. Changes in [Ca2+]i were expressed as changes of the fluorescence ratio of F340/F380. In the experiments designed to measure Mn2+ influx, FURA-2 was excited at the isosbestic (Ca2+-insensitive) wavelength of 360 nm and the emitted fluorescence was measured at 510 nm. This approach is based on the abilities of Mn2+ to permeate Ca2+ channels (and particularly T-type channels) and to quench the FURA-2 dye (Jacob, 1990; Kaku et al., 2003).

Recording solutions

For FURA-2 recordings, cells were perfused at a rate of 4 ml/min with a Ringer physiological solution containing (in mM): 130 NaCl, 5 KCl, 2 CaCl2 (except in Mn2+-quenching experiments), 1 MgCl2, 10 HEPES, 10 glucose, adjusted to pH 7.4 with NaOH. When indicated, cells were depolarized with an iso-osmotic solution in which NaCl was replaced by KCl up to a concentration of 130 mM. In the experiments of FURA-2 quenching by Mn2+, 200 μM MnCl2 was added to a Ca2+-free Ringer solution. To demonstrate the participation of T-type channels in the constitutive Ca2+ entry, we applied the pharmacological T-type channel blocker mibefradil, which was dissolved from frozen stocks to a working concentration of 10 μM in Ringer solution. In these experiments, which required high volumes of perfusion, we omitted the use of the highly specific T-type channel blocker kurtoxin due to its limited availability.

Flow cytometry

Analysis of cell cycle distribution was determined by propidium iodide (PI) staining and flow cytometry. Following treatment, approximately 1 × 106 cells were fixed in 70% ethanol for at least 1 h on ice. The cells were then resuspended in 2 ml of cell cycle buffer (20 μg/ml PI) in PBS, containing 0.1% Triton X-100 and 50 μg/ml RNase A for 1 h at 37° C. PI fluorescence emission was measured with a FACSCanto II flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA), and cell cycle distribution was analysed with modfit lt software (Verity Software House, Topsham, ME, USA).

Statistical analysis

Statistical significance was checked, as appropriate, by application of a Shapiro–Wilk normality test followed by a two-sample Student t-test, or a Mann–Whitney rank sum test.

Acknowledgements

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

We thank Annette C. Dolphin for critical reading of the manuscript, and Josep Esquerda and Olga Tarabal for advice in using the calcium imaging system. This work was supported by grants PI042650 and PI070357 to C.C.; PI060832 to R.M.M.; 2009SGR794, RD06/0020/1034 and RD09/0076/00059 to X.M.G.; BFU2009-11879/BFI to R.P. N.B. was funded by ISCIII (PI070357). A.D. is a predoctoral fellow from Universitat de Lleida. C.P. is a predoctoral fellow from Generalitat de Catalunya (AGAUR). A.S. holds a predoctoral fellowship from AECC. Tumour samples were obtained with the support of Xarxa catalana de Bancs de Tumours and the Tumour Banc Platform of RTICC (RD09/0076/00059).

References

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information
  • Bedogni, B., and Powell, M.B. (2006). Skin hypoxia: a promoting environmental factor in melanomagenesis. Cell Cycle 5, 12581261.
  • Bertolesi, G.E., Shi, C., Elbaum, L., Jollimore, C., Rozenberg, G., Barnes, S., and Kelly, M.E. (2002). The Ca2+ channel antagonists mibefradil and pimozide inhibit cell growth via different cytotoxic mechanisms. Mol. Pharmacol. 62, 210219.
  • Chiou, W.F. (2006). Effect of Abeta exposure on the mRNA expression patterns of voltage-sensitive calcium channel alpha 1 subunits (alpha 1A-alpha 1D) in human SK-N-SH neuroblastoma. Neurochem. Int. 49, 256261.
  • Chuang, R.S., Jaffe, H., Cribbs, L., Perez-Reyes, E., and Swartz, K.J. (1998). Inhibition of T-type voltage-gated calcium channels by a new scorpion toxin. Nat. Neurosci. 1, 668674.
  • Cox, J.L., Lancaster, T., and Carlson, C.G. (2002). Changes in the motility of B16F10 melanoma cells induced by alterations in resting calcium influx. Melanoma Res. 12, 211219.
  • Del Toro, R., Levitsky, K.L., López-Barneo, J., and Chiara, M.D. (2003). Induction of T-type calcium channel gene expression by chronic hypoxia. J. Biol. Chem. 278, 2231622324.
  • Deli, T., Varga, N., Adám, A. et al. (2007). Functional genomics of calcium channels in human melanoma cells. Int. J. Cancer 121, 5565.
  • Evans, R.M., and Zamponi, G.W. (2006). Presynaptic calcium channels – integration centers for neuronal signaling pathways. Trends Neurosci. 29, 617624.
  • Eyden, B., Pandit, D., and Banerjee, S.S. (2005). Malignant melanoma with neuroendocrine differentiation: clinical, histological, immunohistochemical and ultrastructural features of three cases. Histopathology 47, 402409.
  • Glass-Marmor, L., Penso, J., and Beitner, R. (1992). Ca2+-induced changes in energy metabolism and viability of melanoma cells. Br. J. Cancer 81, 219224.
  • Gray, L.S., and Macdonald, T.L. (2006). The pharmacology and regulation of T type calcium channels: new opportunities for unique therapeutics for cancer. Cell Calcium 40, 115120.
  • Guo, W., Kamiya, K., Kodama, I., and Toyama, J. (1998). Cell cycle-related changes in the voltage-gated calcium currents in cultured newborn rat ventricular myocytes. J. Mol. Cell. Cardiol. 30, 10951103.
  • Jacob, R. (1990). Agonist-stimulated divalent cation entry into single cultured human umbilical vein endothelial cells. J. Physiol. (Lond.) 421, 5577.
  • Kahl, C.R., and Means, A.R. (2003). Regulation of cell cycle progression by calcium/calmodulin-dependent pathways. Endocr. Rev. 24, 719736.
  • Kaku, U., Lee, T.S., Arita, M., Hadama, T., and Ono, K. (2003). The gating and conductance properties of Cav3.2 low-voltage-activated T-type calcium channels. Jpn. J. Physiol. 53, 165172.
  • Koschak, A., Reimer, D., Huber, I., Grabner, M., Glossmann, H., Engel, J., and Striessnig, J. (2001). Alpha 1D (Cav1.3) subunits can form l-type calcium channels activating at negative voltages. J. Biol. Chem. 276, 2210022106.
  • Kuga, T., Kobayashi, S., Hirakawa, Y., Kanaide, H., and Takeshita, A. (1996). Cell cycle-dependent expression of L- and T-type calcium currents in rat aortic smooth muscle cells in primary culture. Circ. Res. 79, 1419.
  • Kwong, L., Chin, L., and Wagner, S.N. (2007). Growth factors and oncogenes as targets in melanoma: lost in translation?. Adv. Dermatol. 23, 99129.
  • Li, M., Zhang, M., Huang, L., Zhou, J., Zhuang, H., Taylor, J.T., Keyser, B.M., and Whitehurst, M.J.R. (2005). T-type calcium channels are involved in high glucose-induced rat neonatal cardiomyocyte proliferation. Pediatr. Res. 57, 550556.
  • Lipscombe, D., Helton, T.D., and Xu, W. (2004). L-type calcium channels: the low down. J. Neurophysiol. 92, 26332641.
  • Loechner, K.J., Salmon, W.C., Fu, J., Patel, S., and McLaughlin, J.T. (2009). Cell cycle-dependent localization of voltage-dependent calcium channels and the mitotic apparatus in a neuroendocrine cell line (AtT-20). Int. J. Cell Biol. 487959, 112.
  • Marcantoni, A., Baldelli, P., Hernandez-Guijo, J.M., Comunanza, V., Carabelli, V., and Carbone, E. (2007). L-type Ca2+ channels in adrenal chromaffin cells: role in pace-making and secretion. Cell Calcium 42, 397408.
  • Mariot, P., Vanoverberghe, K., Lalevee, N., Rossier, M.F., and Prevarskaya, N. (2002). Overexpression of an alpha 1H (Cav3.2) T-type calcium channel during neuroendocrine differentiation of human prostate cancer cells. J. Biol. Chem. 277, 1082410833.
  • Martinez-Alonso, M., Llecha, N., Mayorga, M.E. et al. (2009). Expression of somatostatin receptors in human melanoma cell lines: effect of two different somatostatin analogues, octreotide and SOM230, on cell proliferation. J. Int. Med. Res. 37, 18131822.
  • Mayorga, M.E., Sanchis, D., Perez de Santos, A.M. et al. (2006). Antiproliferative effect of STI571 on cultured human cutaneous melanoma-derived cell lines. Melanoma Res. 16, 127135.
  • Panner, A., and Wurster, R.D. (2006). T-type calcium channels and tumour proliferation. Cell Calcium 40, 253259.
  • Pereverzev, A., Vajna, R., Pfitzer, G., Hescheler, J., Klöckner, U., and Schneider, T. (2002). Reduction of insulin secretion in the insulinoma cell line INS-1 by overexpression of a Ca(v)2.3 (alpha1E) calcium channel antisense cassette. Eur. J. Endocrinol. 146, 881889.
  • Pluteanu, F., and Cribbs, L.L. (2009). T-type calcium channels are regulated by hypoxia/reoxygenation in ventricular myocytes. Am. J. Physiol. Heart Circ. Physiol. 297, H1304H1313.
  • Richard, S., Neveu, D., Carnac, G., Bodin, P., Travo, P., and Nargeot, J. (1992). Differential expression of voltage-gated calcium-currents in cultivated aortic myocytes. Biochim. Biophys. Acta 1160, 95104.
  • Schmitt, R., Clozel, J.P., Iberg, N., and Bühler, F.R. (1995). Mibefradil prevents neointima formation after vascular injury in rats. Possible role of the blockade of the T-type voltage-operated calcium channel. Arterioscler. Thromb. Vasc. Biol. 15, 11611165.
  • Silver, D.L., and Pavan, W.J. (2006). The origin and development of neural crest-derived melanocytes. In Melanocytes to Melanoma, Vol. I, V.J. Hearing, and S.P. Leong, eds. (Totowa, NJ: Humana Press), pp. 326.
  • Slomisnky, A. (2009). Neuroendocrine activity of the melanocyte. Exp. Dermatol. 18, 760763.
  • Sorolla, A., Yeramian, A., Dolcet, X. et al. (2008). Effect of proteasome inhibitors on proliferation and apoptosis of human cutaneous melanoma-derived cell lines. Br. J. Dermatol. 158, 496504.
  • Taylor, J.T., Huang, L., Pottle, J.E., Liu, K., Yang, Y., Zeng, X., Keyser, B.M., Agrawal, K.C., Hansen, J.B., and Li, M. (2008a). Selective blockade of T-type calcium channels suppresses human breast cancer cell proliferation. Cancer Lett. 267, 116124.
  • Taylor, J.T., Zeng, X.B., Pottle, J.E., Lee, K., Wang, A.R., Yi, S.G., Scruggs, J.A., Sikka, S.S., and Li, M. (2008b). Ca2+ signaling and T-type calcium channels in cancer cell cycling. World J. Gastroenterol. 14, 49844991.
  • Toyota, M., Ho, C., Ohe-Toyota, M., Baylin, S.B., and Issa, J.P. (1999). Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5′ CpG island in human tumours. Cancer Res. 59, 45354541.
  • Triggle, D.J. (2003). 1,4-Dihydropyridines as calcium channel ligands and privileged structures. Cell. Mol. Neurobiol. 23, 293303.
  • Wang, X.T., Nagaba, Y., Cross, H.S., Wrba, F., Zhang, L., and Guggino, S.E. (2000). The mRNA of L-type calcium channel elevated in colon cancer: protein distribution in normal and cancerous colon. Am. J. Pathol. 157, 15491562.
  • Williams, A., Sarkar, S., Cuddon, P. et al. (2008). Novel targets for Huntington’s disease in an mTOR-independent autophagy pathway. Nat. Chem. Biol. 4, 295305.
  • Wimmers, S., Coeppicus, L., Rosenthal, R., and Strauss, O. (2008). Expression profile of voltage-dependent calcium channel subunits in the human retinal pigment epithelium. Graefes Arch. Clin. Exp. Ophthalmol. 246, 685692.
  • Yeramian, A., Sorolla, A., Velasco, A. et al. (2011). Inhibition of activated receptor tyrosine kinases by Sunitinib induces growth arrest and sensitises melanoma cells to Bortezomib by blocking Akt pathway. Int. J. Cancer 130, 967978.

Supporting Information

  1. Top of page
  2. Summary
  3. Significance
  4. Introduction
  5. Results
  6. Discussion
  7. Conclusion
  8. Methods
  9. Acknowledgements
  10. References
  11. Supporting Information

Figure S1. Expression analysis of human genes encoding VGCCs.

Figure S2. Cell cycle analysis by flow cytometry (PI staining) of JG, M28 and M16 melanoma cells at 60–70% confluence.

Figure S3. Cytosolic Ca2+ increases in melanoma cells, secondary to membrane depolarization and/or L-type channels activation-induced elevations.

Figure S4. The knockdown of Cav3.1 and Cav3.2 T-type channels prevents the hypoxia-induced JG melanoma cell proliferation.

FilenameFormatSizeDescription
PCMR_978_sm_fS1.eps678KSupporting info item
PCMR_978_sm_fS2.eps1321KSupporting info item
PCMR_978_sm_fS3.eps1126KSupporting info item
PCMR_978_sm_fS4.eps1615KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.