SEARCH

SEARCH BY CITATION

Keywords:

  • hyaluronan;
  • hyaluronan synthase;
  • porcine hyalocyte cell line;
  • vitreous

Abstract.

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Purpose:  Previously, we established a porcine vitreous tissue-derived hyalocyte cell line (PH5) and investigated the regulation of hyaluronan synthesis in these cells by cytokines. The objective of the current study was to establish human vitreous tissue-derived cells and to compare their characteristics with those of PH5 cells.

Methods:  Human vitreous specimens from two patients were cultured in the presence of 10% foetal bovine serum and immortalized by infection with human papilloma virus 16 genes E6 and E7. We used reverse transcription polymerase chain reaction (RT-PCR) to analyse and compare the expression profiles for several genes in the human vitreous tissue-derived cells and PH5 cells. To investigate the regulation of hyaluronan production in response to cytokine stimulation, the expression of hyaluronan synthase isoforms was examined using RT-PCR, and hyaluronan production was measured using enzyme-linked immunosorbent assay (ELISA).

Results:  Two types of cells, HV64 and HV65, were derived from human vitreous tissue. The HV64 and HV65 cell-doubling times were 58 hr and 76 hr, respectively. The cells expressed messenger RNA (mRNAs) encoding collagen type I α1 (COL1A1), collagen type II α1 (COL2A1), CD11b, CD14, CD68, CD204 and CD206 but did not express mRNA for glial fibrillary acidic protein (GFAP). Cytokine stimulation did not induce the expression of hyaluronan synthase mRNA or the production of hyaluronan. In contrast, mRNAs for GFAP and hyaluronan synthase-2 were expressed in the porcine PH5 cells, and treatment with transforming growth factor-β1 and/or platelet-derived growth factor-BB induced the production of hyaluronan in PH5 cells.

Conclusion:  The new human vitreous tissue-derived cells have macrophage-like characteristics and are different from our previously developed porcine hyalocyte cells. These human vitreous tissue-derived cells might be useful for studies of human intraocular diseases.


Introduction

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The main compartment of the posterior eye is the vitreous body, a gel-like structure consisting primarily of water (about 98%), collagen type II and hyaluronan. Although the central region of this highly transparent vascular tissue is free of cells, the vitreous cortex is occupied by a single layer of cells known as hyalocytes (Balazs et al. 1980; Lazarus & Hageman 1994), which have a macrophage-like structure (Lang & Bishop 1993). Recent studies have shown that hyalocyte cells are physiologically renewed every several months (Qiao et al. 2005) and that human, bovine and rat hyalocytes derive from the monocyte–macrophage lineage (Lazarus & Hageman 1994; Noda et al. 2004; Qiao et al. 2005). However, the physiological origin and functions of hyalocytes have not been investigated fully.

Pathologically, hyalocytes are associated with some vitreoretinal diseases, including epiretinal membrane formation, diabetic macular oedema and macular holes (Heidenkummer & Kampik 1996; Badrinath et al. 1999). Research using bovine hyalocytes grown in media rich in platelet-derived growth factor (PDGF) has shown that hyalocytes are involved in intraocular proliferative diseases. Furthermore, hyalocytes secrete cytokines, which are associated with the development of proliferative vitreoretinal diseases in eyes with diabetic retinopathy and proliferative vitreoretinopathy (Sakamoto 2003; Hirayama et al. 2004; Noda et al. 2004).

Hyaluronan is an important constituent of the extracellular matrix. It plays an essential role in regulating cell migration, proliferation, adhesion, development and differentiation (Laurent & Fraser 1992; Knudson & Knudson 1993). Hyaluronan synthesis is catalysed by membrane-bound hyaluronan synthase (HAS) enzymes (Spicer et al. 1997; Weigel et al. 1997). The expression levels of each HAS isoform are differentially regulated by several cytokines and growth factors, such as PDGF-BB and transforming growth factor-β (TGF-β) (Heldin et al. 1989, 1992; Suzuki et al. 1995; Sugiyama et al. 1998; Usui et al. 1999, 2000, 2003; Jacobson et al. 2000).

To investigate the roles of hyalocytes in ocular diseases, we established and characterized a porcine hyalocyte cell line (PH5) (Nishitsuka et al. 2007). Our findings suggested that hyalocytes play a role in intraocular proliferative diseases by expressing HAS. In the present study, to investigate human eye disease more thoroughly, we attempted to establish immortalized cells derived from human vitreous tissue. We used reverse transcriptase polymerase chain reaction (RT-PCR) to examine and compare the expression profiles of several genes in the resulting human vitreous tissue-derived cells and in PH5 cells. We also examined the effects of TGF-β1 and/or PDGF-BB stimulation on HAS expression and hyaluronan production in these cells.

In this article, we report the cloning and characterization of 11 human vitreous tissue-derived cell strains derived from two patients, as well as our findings concerning the regulation of hyaluronan synthesis by growth factors in these cells. The human vitreous tissue-derived cells have macrophage-like characteristics and are different from our porcine hyalocyte cells. The results suggested that hyalocytes in different animal species have a variety of origins. These human vitreous tissue-derived cells may be useful tools for studies of human intraocular diseases.

Materials and Methods

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Isolation, culturing, immortalization and growth of human vitreous tissue-derived cells

We were able to culture two types of primary cells derived from human vitreous tissue. One of these cell types, designated HV64, was isolated from a 57-year-old woman who underwent evisceration surgery for the treatment of neovascular glaucoma; the other type, designated HV65, was isolated from a 59-year-old man who underwent enucleation surgery for the treatment of choroidal tumour. Informed consent was obtained from both patients, and the protocol was approved by the Yamagata University Faculty of Medicine.

The vitreous bodies were dissected carefully under a microscope as follows. The extracted vitreous body was chopped into several pieces and placed on a 100-mm well culture plate (Cellstar; Greiner Bio-One, Dresden, Germany) in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco BRL, Grand Island, New York, USA) supplemented with 10% foetal bovine serum (FBS) (Nichirei, Tokyo, Japan), 100 U/ml penicillin, 100 mg/ml streptomycin and 250 ng/ml amphotericin B (Wako, Osaka, Japan) in a humidified 5%-CO2 atmosphere at 37°.

To immortalize the cells, we stably transfected the amphotropic packaging cell line PA317 with the retroviral vector pLXSN 16 containing the human papilloma virus (HPV)-16 E6/E7 open reading frames (American Type Culture Collection, Manassas, Virginia, USA). After the PA317 cells transfected with pLXSN HPV16 E6/E7 and retroviruses were grown to 80% confluence, the supernatant fractions were collected and stored at −80°. The primary cells derived from human vitreous tissue were then infected with 2 ml of the virus supernatant stock solution in a 35-mm dish for 3 days. The infected cells were subcultured using 100-mm cell plates, and the medium was replaced by DMEM containing 10% FBS. After 3 days, the medium was replaced by selection media containing 250 μg/ml G418 (Wako), and the cells were cultured for 3 weeks.

The clone cells were isolated using a small piece of filter paper soaked in a solution containing 0.05% trypsin (Gibco) and 0.02 mm ethylenediamine tetraacetic acid (EDTA) (Wako). The filter paper was placed on each colony, thereby causing the cells to detach from the culture dish and adhere onto the filter paper, and then placed into another culture dish. The filter paper was removed when the subcultured clone cells became confluent. We obtained four and seven clones from HV64 and HV65, respectively. Each clone was cultured in DMEM supplemented with 10% FBS in a humidified 5%-CO2 atmosphere at 37°. Each cell migrated from the tissue explant and was passaged with trypsin–EDTA (Gibco). The cells were grown to 70–80% confluence in 100-mm wells of culture plates, and the cells at passage 3 were diluted. The cell-doubling time was calculated by cell number and days of subculture. The cells were examined using a Leica DMI3000B inverted microscope (Leica, Wetzlar, Germany) and photographed using an attached DP-70 CCD camera (Olympus, Tokyo, Japan).

Characterization of early- and late-passage human HV64 and HV65 cells

Early-passage (passage 3; P3) cells and late-passage (P15) cells were characterized using RT-PCR. Total RNA was prepared by disrupting the cells in Isogen reagent (Nippon Gene, Toyama, Japan) according to the manufacturer’s protocol. Total RNA (2 μg) was reverse-transcribed with 200 U reverse transcriptase (Promega, Madison, Wisconsin, USA) in the presence of 0.5 μg oligo(dT)16 primer and 20 U RNase inhibitor (Takara-Bio, Shiga, Japan) for 60 min. The resulting cDNAs were amplified with a KOD-Plus-PCR kit (Toyobo, Osaka, Japan). PCR amplifications were performed in 25-μl reaction mixtures containing cDNA (1.5 μl), 200 μm dNTPs, 1 μm primers and 1 U of KOD-Plus DNA polymerase. Primer sequences and cycling conditions are detailed in Table 1. The target genes were collagen type I α1 (COL1A1), collagen type II α1 (COL2A1), glial fibrillary acidic protein (GFAP), CD11b, CD14, CD68, CD204, CD206, HPV E6 transforming protein (HPV16E6), HPV E7 transforming protein (HPV16E7) and β-actin. The PCR parameters for β-actin (control) were: 1 min at 95°; 20 cycles of 15 seconds at 94° and 30 seconds at 60°; and a final extension step of 30 seconds at 94°, 30 seconds at 62° and 2 min at 68°. The PCR parameters for other experiments were: 1 min at 95°; 22–35 cycles (depending on the primer sequences) of 15 seconds at 94°, 30 seconds at 55–60°; and a final extension step as described earlier. The PCR products were separated by electrophoresis on a 2% agarose gel (Iwai Chemicals, Tokyo, Japan), stained with ethidium bromide, and visualized using ultraviolet light. Results were quantified using CS Analyser software (Atto Corporation, Tokyo, Japan).

Table 1.   Primers List.
GeneNucleoid (5′-3′)Accession no.Product
β-ActinFw: C C CATGC CATC CTGC GTCTGNM_001101573
Rv: C GTCATACTC CTGC1TGCT G
C0L1A1Fw: AGTG G1TACTACTGGA1T GAC CNM_000088339
Rv: TTGC C AGTCTC CTC ATC C
COL2A1Fw: TGATGAAAAGGCT G GTG GC GNM_001844487
Rv: CTGAC C AGC GIT GC CTC G G G
GFAPFw: AAGCTCCAAGATGAAACCAACCTGANM_002055632
Rv: GC GATCTC GATGTC CAG G GC
S-lOObFw: GAAG GC C ATGG1T GC C CTC ATNM_006272210
Rv: C ATAAACTC CTGGAAGTC AC A
CDllbFw: AC AGAGCTGC CTCTC G GTG GC C ANM_000632399
Rv: TTC C C1TCTGC C G GAGAG GCTAC GC
CD14Fw: CACACTCGCCTGCCTnTCCNM_000591450
Rv: GATTC C C GTC C AGT GTC AG G
CD68Fw: GAG GC CTG G GGACTCTCTGTANM_0010400 59276
Rv: C GA G1TGCT GCAACTGAAGCT
CD163Fw: ACCCAGTGAGTrCAGCCTlTANM_004244144
Rv: AATTCAGCAGCAGTC1TAGGA
CD204Fw:’ 1” 1AGAGGAGC GTG1T1ACAA 1G1NM_002445143
Rv: GAATG1TC C CAATC111CAGTCT
CD206Fw: TGGTITCCAITGAAAGTGCTGCNM_002438504
Rv: TTC CTG GGC1T GACTGACTG1TA
HPVT6E6Fw: ATGCACCAAAAGAGAACTGCAF486321476
Rv: TACAGCTGGG111CTCTACG
HPVT6E7Fw: ATGCATG GAGATACAC CTACAF486349297
Rv: TTATGG111CTGAGAACAGA
HAS1Fw: TAC1TGGTA GC C1TC AATGTGGANM_001523367
Rv: C C AC C GC CTC GTAG GTC ATC C A
HAS 2Fw: GAA1TAC C CAGTC CTGGCTTNM_005328626
Rv: GGATAAACTGGTAGCCAACA
HAS 3Fw: CCTAC1T1GGCTGTGTGCAANM_005329526
Rv: AG GCTG GACATATAGAGAAG

RT-PCR analysis of HAS mRNA expression

The expression of HAS1, 2 and 3 mRNAs was analysed using RT-PCR. HV64 and HV65 cells were grown on culture plates until they were approximately 70% confluent. They were then incubated in DMEM containing 1% FBS for 24 hr, seeded with recombinant human TGF-β1 (10 ng/ml) and/or PDGF-BB (10 ng/ml; R&D systems, Minneapolis, Minnesota, USA), incubated for 6 hr and harvested. Total RNA was isolated from the harvested cells, and RT-PCR was performed as described earlier. The PCR products were separated by electrophoresis on a 2% agarose gel (Iwai Chemicals), stained with ethidium bromide and visualized using ultraviolet light. Results were quantified using CS Analyser software.

Determination of hyaluronan content in culture media

To investigate the effect of TGF-β1 and PDGF-BB on hyaluronan production, the media from HV64 and HV65 cells treated with TGF-β1 and/or PDGF-BB for 48 hr were quantified. The cells were grown to 70% confluence and treated with TGF-β1 and/or PDGF-BB as described earlier, except that they were exposed to the cytokine(s) for 48 hr rather than 6 hr. The media were collected and assayed for hyaluronan using a hyaluronan assay kit (Seikagaku Corporation, Tokyo, Japan) according to the manufacturer’s instructions. Statistical analysis was performed using the Mann–Whitney U-test. Cell number was determined by using a Burke-Turk Haemocytometer. Hyaluronan production was normalized by 100 000 cell numbers. Statistical analysis was performed using the Mann–Whitney U-test.

Results

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Establishment of human hyalocyte-derived cell strains

Two different types of primary cells derived from vitreous tissues of two human patients were transfected with the retroviral vector pLXSN HPV16 E6/E7. The resulting human vitreous tissue-derived cell lines were termed HV (human vitreous-derived cell strain) 64 and HV65. The 11 clones (four HV64 clones and seven HV65 clones) that exhibited the highest initial growth rate were selected for further subculture. The average doubling times for the HV64 and HV65 clones were approximately 58 ± 2 hr and 76 ± 5 hr, respectively. The 11 clones were able to survive subculture for at least 20 passages.

Figure 1 shows the phase-contrast microscopy findings for cells of HV64 clone #8 (HV64-08) and HV65-08. For HV64-08 and for HV65-08, the cell morphology remained unchanged throughout repeated passages.

image

Figure 1.  Morphology of HV64 and HV65 cells. Clones HV64-08 and HV65-08 are shown. P3, passage 3; P15, passage 15. Bar = 50 μm.

Download figure to PowerPoint

Characterization of mRNA expression in HV64 and HV65 cells at passages 3 and 15

We used RT-PCR to profile mRNA expression in HV64 and HV65 cells and to compare their profiles with that of our porcine hyalocyte cell line PH5 (Fig. 2). Both HV64 and HV65 cells were found to express COL1A1, COL2A1, CD11b, CD14, CD68, CD204, CD206, HPV16E6 and HPV16E7 mRNAs. However, GFAP mRNA was not detected in HV64 or HV65 cells, whereas it was detected in PH5 cells, as we have reported previously (Nishitsuka et al. 2007). Furthermore, the mRNA expression patterns in HV64 and HV65 cells at passage 3 were nearly identical to those observed at passage 15.

image

Figure 2.  Gene expression profiles of PH5 porcine hyalocyte cells, HV64 cells at passage 3 (P3) and HV65 cells at passage 15 (P15). Profiles were obtained using RT-PCR.

Download figure to PowerPoint

Regulation of HAS isoform mRNA expression in HV64 and HV65 cells

We used RT-PCR to investigate the regulation of HAS1, HAS2 and HAS3 expression by TGF-β1 and PDGF-BB in PH5, HV64-08 and HV65-08 cells. In PH5 cells, HAS2 expression was induced by TGF-β1 treatment alone and by co-treatment with TGF-β1 and PDGF-BB, as reported previously (Nishitsuka et al. 2007). In HV64-08 and HV65-08 cells, the expression of HAS1 and HAS3 mRNAs was observed in the absence of added cytokines, and no change in HAS mRNA expression in response to 10 ng/ml TGF-β1 or 10 ng/ml PDGF-BB was observed.

Effects of TGF-β1 and PDGF-BB on hyaluronan production

To investigate the effect of TGF-β1 and PDGF-BB on hyaluronan synthesis in PH5, HV64-08 and HV65-08 cells, the hyaluronan concentration in the cell growth medium was determined after incubation of the cells with 10 ng/ml TGF-β1 and 10 ng/ml PDGF-BB for 48 hr. In PH5 cells, treatment with either TGF-β1 or PDGF-BB significantly increased hyaluronan production (P < 0.01; Fig. 4); hyaluronan production was increased further by combined treatment with both TGF-β1 and PDGF-BB. However, HV64 and HV65 cells exhibited no observable change in hyaluronan production in response to cytokine either alone or in combination. In fact, HV64-08 and HV65-08 cells produced high levels of hyaluronan in the absence of TGF-β1 and PDGF-BB. On stimulation with PDGF-BB for 48 hr, the doubling times of HV64 and HV65 (about 58 and 76 hr, respectively) were decreased by approximately 96% (data not shown). Meanwhile, alteration of the doubling time of HV64 and HV65 with TGF-β1 alone or in combination was not observed.

Discussion

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

In this article, we describe the cloning and characterization of two human vitreous tissue-derived cell strains, HV64 and HV65, and were able to subculture them for at least 20 passages.

The HV64 and HV65 cellular morphologies and mRNA expression patterns also remained identical between passage 3 and passage 15 (Figs 1 and 2). Primary cells derived from human vitreous tissue cannot usually be subcultured past passage 5, but the expression of HPV16 E6 and E7 mRNAs was not attenuated even with repeated subculture. These results indicate that primary cells derived from human vitreous tissue are capable of prolonged survival after transfection with the HPV16 E6/E7 immortalization genes. However, these cells were not immortal, possibly because of their origin in human tissue of advanced age.

HV64 and HV65 expressed mRNAs for COL1A1, COL2A1, CD11b, CD14, CD68, CD204 and CD206. The CD11b, CD14 and CD68 genes are recognized markers for human macrophage cells (Springer et al. 1979; Goyert et al. 1998; Holness & Simmons 1993), and CD204 and CD206 are known markers of histiocytes (Kim et al. 1992; Takahashi et al. 1992). Hyalocytes have a macrophage-like structure (Lang & Bishop 1993), and recent studies have shown that human, bovine and rat hyalocytes derive from the monocyte–macrophage lineage (Lazarus & Hageman 1994; Noda et al. 2004; Qiao et al. 2005). In accordance with previous reports, the HV64 and HV65 cells appeared to have macrophage-like characteristics.

However, GFAP, an astroglial cell marker, was not detected in either HV64 or HV65 cells. Previous reports have demonstrated that GFAP-positive cells exist in human foetal vitreous humour (Zhu et al. 1999) and that bovine hyalocytes are immunocytochemically negative for GFAP and cytokeratin (Noda et al. 2004). Previously, we found that GFAP mRNA and protein are expressed in PH5 cells (Nishitsuka et al. 2007). The pattern of mRNA expression in HV64 and HV 65 differed from that of PH5.

We compared the regulation of hyaluronan synthesis in response to growth factors in our human vitreous tissue-derived cells with that in PH5 cells to investigate their different cellular functions. In HV64 and HV65 cells, HAS1 and HAS3 mRNAs were expressed in the absence of cytokine treatment, but neither TGF-β1 nor PDGF-BB alone or together increased the expression of HAS1, 2 or 3 mRNA (Fig. 3). However, TGF-β1 and PDGF-BB induced the expression of HAS2 mRNA in PH5 cells, consistent with our previous results (Nishitsuka et al. 2007). We also observed that hyaluronan production in HV64 and HV65 cells was unaffected by TGF-β1 treatment alone or together with PDGF-BB (Fig. 4), whereas both of these cytokines induced hyaluronan production in PH5 cells. Thus, in terms of HAS mRNA expression and hyaluronan production, the response of HV64 and HV65 cells to cytokine stimulation was distinctly different from that seen in PH5 cells. In addition, HV64 and HV65 cells produced a high concentration of hyaluronan, possibly caused by the expression of HAS3.

image

Figure 3.  Levels of hyaluronan synthase (HAS) expression in PH5, HV64 and HV65 cells after stimulation with transforming growth factor-β1 (TGF-β1) (10 ng/ml) and/or platelet-derived growth factor-BB (PDGF-BB) (10 ng/ml).

Download figure to PowerPoint

image

Figure 4.  Measurement of hyaluronan concentrations in culture media from PH5, HV64 and HV65 cells after stimulation with transforming growth factor-β1 (TGF-β1) (10 ng/ml) and/or platelet-derived growth factor-BB (PDGF-BB) (10 ng/ml). Error bars indicate standard deviation; *p < 0.01 (Mann–Whitney U-test); n = 3.

Download figure to PowerPoint

The HAS isoforms synthesize hyaluronan molecules of various sizes, exhibit different kinetic properties and are expressed in a cell-type-specific pattern (Weigel et al. 1997; Brinck & Heldin 1999; Itano et al. 1999). Hyaluronan synthesized by the HAS2 gene product is a critical component of the extracellular matrix for embryogenesis (Camenisch et al. 2000). HAS expression has been reported to play a role in tumour metastasis, growth and progression (Itano & Kimata 2002). HAS1 and HAS3 transfectants secrete hyaluronan with an estimated molecular mass of 2 × 105–2 × 106 Da. However, very large hyaluronan molecules (> 2 × 106 Da) have been detected in the conditioned medium of HAS2 transfectants (Itano et al. 1999). Because the expression of HAS2 mRNA was not induced in HV64 or HV65 cells, these cells may release small-molecule hyaluronan. Because HAS2 and HAS3 mRNA are expressed in the posterior segment (retina and choroid) of rabbit eye (Murata & Horiuchi 2005), the HV64 and HV65 cells might not originate from retinal or choroid tissue. It is notable that the cells derived from two patients exhibited similar characteristics.

In conclusion, we successfully established 11 cell strains derived from human vitreous tissue by transfecting human vitreous cells with the HPV 16 E6 and E7 genes. These cell strains have macrophage-like characteristics and differ in cell type from the porcine hyalocyte cells that we established previously. Our results suggest that there are several types of macrophage-like hyalocyte cells. These human vitreous tissue-derived cell strains may be useful tool for studying human intraocular disease. Further investigation of human vitreous cells in vitro should provide insight into the role of the vitreous in intraocular disease.

Acknowledgements

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was supported by a grant from Senju Pharmaceutical Co. Ltd.

References

  1. Top of page
  2. Abstract.
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References