SEARCH

SEARCH BY CITATION

Keywords:

  • Adenovirus;
  • Cardiomyocytes;
  • Hypoxia/Reoxygenation injuries;
  • Vasostatin-1

SUMMARY

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References

Introduction: Vasostatin-1 (VS-1) has been suggested in protecting hypoxia/reoxygenation (H/R) injuries in isolated hearts. However, the molecular mechanisms remained to be elucidated. Methods: Cardiomyocytes were treated with recombinant Ad-VS-1 adenoviral vector before H/R. Cell viability was studied using MTT methods and annexin V-FITC flow cytometry. Intracellular oxidative stress was measured by superoxide dismutase (SOD) and malondialdehyde (MDA), and inflammatory reactions by enzyme-linked immunosorbent assay (ELISA). Measurement of myocardial nitrous oxide synthase (NOS) was determined by serum nitric oxide (NO) concentrations using nitrite reductase and endothelial nitric oxide synthase (eNOS) by Western blotting. Inhibitors of the NOS system, including hemoglobin and KT5823, were applied to verify the results. Results: In comparison of the blank group, cardiac myocytes overexpressing VS-1 showed significant decrease in apoptosis, intracellular oxidative stress, and inflammatory reactions (P < 0.05). In addition, serum NO concentrations and expression of eNOS were notably enhanced (P < 0.05). These protective effects of VS-1 were suppressed in the presence of apoptosis-inducing agents. Conclusions: Overexpression of VS-1 in cardiomyocytes could limit the H/R injuries at molecular levels. The protective effects were independent of endothelial cell function, suggestive of a potential therapeutic target for patients with myocardial ischemia in the future.


Introduction

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References

Prompt and effective reperfusion of the ischemic myocardium plays an important role in minimizing cardiomyocyte injury associated with myocardial ischemia/reperfusion (I/R). However, myocardial reperfusion itself results in enhanced myocardial injury [1,2]. This process is mainly characterized by enhanced intracellular oxidative stress [3], inflammatory responses [4], and consequent myocardial apoptosis and heart failure [5,6]. Preservation of cardiac myocytes against I/R insults is therefore crucial to cardiac function restoration.

Vasostatin-1 (VS-1) is a recently identified regulatory peptides derived from chromogranin A, a secretory protein of the diffuse neuroendocrine system [7]. The protective effects of VS-1 have been reported in the isolated rat heart. In their study, the human recombinant VS-1–containing peptide was administrated before 30 min of ischemia followed by 2 h of reperfusion. Results showed reduced the infarct area to the same extent as ischemic preconditioning, indicating a protective role of VS-1 [8]. Negative inotropic effect was abolished in a VS-1–dependent mechanism by the blockade of beta-adrenergic receptors, Gi/o protein and NO-cGMP-PKG pathway [9–11]. In vivo studies indicated that VS-1 may ameliorate the myocardial injuries via NO-dependent mechanisms. However, the mechanisms were not explored in details at cellular or molecular levels. In endothelial cells, VS-1 could inhibit the effects of activators, such as TNF-α induced disruption of endothelial integrity [12]. The mechanism is sensitive to pertussis toxin and coupled to the stress-activated signaling pathways [13]. These results suggested that VS-1 could limit myocardial I/R insults in an endothelial-dependent mechanism. However, since cardiomyocytes have been reported to modulate stress in a myriad of pathways when undergoing I/R exposure [5,6], we therefore hypothesize that VS-1 may directly contribute to myocardial preservation in the absence of endothelial cell. Oxidative stress has been addressed as a major culprit in I/R process. In this study, we used the hypoxia/reoxygenation (H/R) model to simulate the I/R process. The effects of VS-1 were investigated in cardiomyocytes transfected by recombinant adenovirus containing VS-1 before exposure to H/R. Our findings could provide evidence to clarify the underlying mechanisms at molecular levels and thus illuminate potential therapeutic values of VS-1 in clinical settings.

Materials and Methods

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References

Construction of VS-1 Recombinant Adenovirus

The human VS-1 gene was amplified by PCR from pcDNA-CgA1–58 using the following primers: VS-1-F (5′-GGGGTACC ATGCGCTCCGCCGCTGTCCT-3′) and VS-1-R (5′-CGAGATCTCT GCTGATGTGCCCTCTCCTTGGCGCCTTGGAGAGCGAGGTCTTGG AGCTCCTTCAGTAAATTCTGATGTCT-3′). The amplified VS-1 fragment was ligated into pAd-Track under CAG cassette, forming shuttle vectors pAdTrack-VS-1. After sequence confirmation, the shuttle vector plasmid was linearized by Pme I and then cotransformed with the adenoviral genome vector pAdEasy-1 into Escherichia coli BJ5183. The successful recombinant was selected by Kanamycin resistance and confirmed by Pac I digestion. The recombinant vector Ad-VS-1 was finally linearized and transfected into QBI-293 cells to pack into viral particles. The viruses were amplified in QBI-293 cells and used to infect cardiomyocytes at 100MOI for 1, 2, 3, 5, and 7 day(s). Western blotting analysis was used to demonstrate the expression of VS-1. To avoid the emergence of E1-containing Ad, we purify the adenoviral stocks to be amplified, and keep the passage number in 293 cells no higher than 4.

Cell Preparation and Transfection

Ventricular myocytes of one-day old neonatal Sprague–Dawley rat (Shanghai Institutes of Biological Science, China) were harvested and cultured with routine methods. Briefly, cardiomyocytes were prepared from ventricles and cultured in 60-mm dishes at a density of 1×105 cells/cm2 in Dullbecco modified Eagle medium supplemented with 10% fetal bovine serum. After 24 h incubation at 37°C and 5% CO2, cell density reached about 70%. Incubation continued for 4–5 h following medium replacement. Cardiomyocytes were then transfected with Ad-VS-1 at 100MOI.

Experimental Protocol

Cells are grouped as follows: blank (B), H/R, vector-infected H/R (Ad-Null) and Ad-VS-1-treated H/R (Ad-VS-1). After 48 h incubation, all except B group were treated with hypoxia for 60 min using Genbox (Biomerieux) (95% N2 and 5% COz) and then reoxygenated for 120 min (70%N, 25%O2, and 5% CO2) to simulate the H/R process.

Cell Viability and Apoptosis Assay

Myocardial viability was determined by measuring 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction ability of cardiomyocytes, according to the method of Mosmann [14]. In brief, MTT was dissolved in phosphate buffer solution (PBS) at 5 mg/ml and was added to culture medium at the end of incubated time. After 4-h incubation at 37°C, MTT was removed and 200 μl dimethyl sulfoxide was added to each well. The absorbance at 580 nm, of solubilized MTT formazan products, was measured. Results were expressed as the percentage (%) of MTT reduction, assuming the absorbance of the blank group as 100%.

Apoptosis was measured by staining cells with a combination of fluoresceinated (FITC) annexin V and propidium iodide (PI) [15]. Briefly, for annexin V-PI analysis, cells were resuspended in 500 μl of binding buffer (140 mM NaCl, 2.5 mM CaCl2, 10 mM HEPES; pH 7.4). After that, 5 μl of annexin V-FITC (Biovision, CA, USA) and 10 μl of PI-PBS solution (50 mg/ml, PI, Sigma, St Louis, MO, USA) were applied to 1×105 cells and subsequently incubated for 15 min at room temperature, preserved of the light. Immediate data acquisition was obtained within 1 h in the flow cytometry in order to avoid cell damage and the diffusion of PI through cell membrane. Results were analyzed using Cellquest software.

Intracellular Oxidative Status Assay

Intracellular oxidative status was determined by the superoxide dismutase (SOD) activity and malondialdehyde (MDA) released into medium during hypoxia. SOD activity in the cytosolic fraction of the cardiomyocyte was determined using the pyrogallol autoxidation inhibition assay following the method of Marklund and Marklund [16]. An inhibition of 50% by standard SOD was defined as 1 unit SOD.

MDA was measured using an MDA assay kit (Jian Cheng Biochemical Engineering, Co., Nanjing, China) following the manufacturer's instruction. Briefly, the cells were lysed by repetitive freeze-thawing and were mixed with reagent R1 (N-methyl-2-phenylindole in acetonitrile and methanol) for a total 120 min at 95°C. The samples were centrifuged at 3500–4000 g/min for 10 min to clarify the supernatant just before being read, and absorbance of the supernatant was determined by a spectrophotometer at a 532-nm wavelength. The MDA concentration was calculated using standard curves and values were expressed as micromoles per gram of proteins.

ELISA Assays of Cellular Inflammatory Reactions

Expression of cellular inflammatory cytokines, including intracellular adhesion molecular 1 (ICAM-1), vascular cell adhesion protein 1 (VCAM-1) and tumor necrosis factor-α(TNF-α), were determined by ELISA following the manufacturer's instruction. In brief, antibodies (anti-ICAM/VCAM/ TNF-α, Boster, Wuhan, China) and streptatividin-biotinylated horseradish peroxidase (1:3000 in 0.1% reduced bovine serum albumin [BSA], 1% Tween 20 solution) were added to supernatant. Ninety microliters tetramethylbenzidine was added to each well and incubated at 37°C for 30 min preserved of light. Absorbance was read with a 450-nm filter using a Dynatech microplate reader. Results were calculated using standard curves and values were expressed as micromoles per gram of proteins.

Impacts of Apoptosis-Inducing Agents on VS-1 Overexpressing Cardiomyocytes

Apoptosis rate was measured as described above to verify the protective effects of VS-1 on cardiomyocytes. KT5823, Wortmanin, and SB203580 were applied to induce apoptosis in VS-1 overexpressing cardiomyocytes. Wortmanin (100 nmol/L) and SB203580 (10 μmol/L) were inhibitors of phosphoinositide 3-kinase (PI3K) and p38 mitogen-activated protein kinase (P38MAPK), respectively.

Analysis of NOS Signaling Pathways in VS-1 Overexpressing Cardiomyocytes

Nitrous oxide synthase (NOS) signaling pathways were determined by serum nitric oxide (NO) concentration and endothelial nitrous oxide synthase (eNOS) expression. Serum NO concentration was measured by nitrate reductase following manufacturer's instructions. Absorbance was read with a 550-nm filter. Results were expressed as micromoles per gram of proteins. Western blot analysis was used to determine the expression of eNOS. In brief, equal amount of rat cardiomyocytes lysates were separated on 12% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes. The membranes were blocked in 5% BSA and then incubated with anti-eNOS (1:5000) at 4°C overnight (Santa Cruz, CA, USA). The antigen was detected by the luminescence method (ECL Western blotting detection kit, Amersham Biosciences, USA) with peroxidase-linked anti-rabbit IgG (1:5000). The intensity of immunoblot bands was detected with a Bio-Rad Calibrated Densitometer (model GS-800).

To further confirm the involvement of NOS system in the VS-1 function, hemoglobin (Hb) (10 μmol/L) and KT5823 (0.1 μmol/L) were applied to eliminate the serum NO and protein kinase C (PKC) activity. Apoptosis was then measured as described above.

Statistical Analysis

Data are expressed as mean ± SD using Graphpad Prism 5.0. Statistical significance among the experimental groups was examined by one-way ANOVA. P value < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References

VS-1 Overexpressed in Cardiomyocytes

The mRNA expression of VS-1 gene was confirmed by PCR (Figure 1a). Ad-VS-1 adenovirus was harvested at day 5 or 6 when 80–90% QBI-293 cells displayed cytopathological effects (Figure 1b). Cardiomyocytes transfected with Ad-VS-1 at 100 MOI showed significant VS-1 overexpression at day 5 by Western blot analysis (Figure 1c). However, the VS-1 levels decreased after day 5 (Figure 1c).

image

Figure 1. (a) Electrophoresis of PCR product of pAd-VS-1 recombinant plasmid. (b) Comparison of cytopathological effects (CPE) after Ad-VS-1 infection. (c) Expression of VS-1 in cardiomyocytes after Ad-VS-1 infection it different time points (day) Figure 1(a) showed the mRNA expression of VS-1 gene by PCR. QBI-293 cells displayed cytopathological effects (Figure 1b). Cardiomyocytes transfected with Ad-VS-1 at 100 MOI showed significant VS-1 overexpression at day 5 by Western blot analysis (Figure 1c). However, the VS-l levels decreased after day 5 (Figure 1c).

Download figure to PowerPoint

VS-1 Enhanced Cellular Viability

H/R induced cellular injuries were determined by cell viability and apoptosis rate. Flow cytometry assay revealed a significant decrease of cell apoptosis in Ad-VS-1 group (10.53 ± 0.50%) compared with the Ad-null (16.94 ± 0.53%) and H/R groups (17.80 ± 1.12%; P < 0.05; Figure 2a). Similarly, MTT analysis indicated an increase in cell viability in comparison to other groups (P < 0.05; Figure 2b).

image

Figure 2. a Comparison of Myocardial Vitality in groups((x±s) aP < 0.05 bP > 0.05 vs Blank Group; cP > 0.05 vs Hypoxia/Reoxygenation(H/R) Group, dP < 0.05 vs H/R Group and Ad-null. (b) Comparison of MIT in groups (inline image). aP < 0.01, bP > 0.05 versus Blank Group; cP > 0.05, dP < 0.01 versus Hypoxia Reoxygenation (H/R) Groups. Flow cytometry assay revealed a significant decrease of cell apoptosis in Ad-VS-1 group (10.53 ± 0.50%) compared with the Ad-null (l6.94 ± 0.53%) and H/R groups (17.80 ± 1.12%; P < 0.05; Figure 2a). Similarly, MIT analysis indicated an increase in cell viability in comparison to other groups (P < 0.05; Figure 2b).

Download figure to PowerPoint

VS-1 Attenuated Intracellular Oxidative and Inflammatory Reactions

To further explore the protective role(s) of VS-1 in cardiomyocytes during H/R, intracellular oxidative status and inflammatory reactions were evaluated. Figure 3(a) showed marked increase of SOD in Ad-VS-1 group compared with other two groups (p < 0.05). However, cellular MDA levels were significantly decreased in Ad-VS-1 group (p < 0.05) (Fig.3(b)). ELISA assay showed that expressions of inflammatory cytokines, including ICAM-1, VCAM-1, and TNF-α were attenuated in Ad-VS-1 group (P < 0.05; Figure 4a–c).

image

Figure 3. (a) Comparison of SOD in groups (inline image). *aP < 0.05, bP > 0.05 versus Blank Group; cP > 0.05, dP < 0.05 versus Hypoxia/Reoxygenation (H/R) Group. (b) Comparison of MDA in groups (inline image). aP < 0.01, bP > 0.05 versus Blank Group; cP > 0.05, dP < 0.01 versus Hypoxia/Reoxygenation (H/R) Group Figure 3(a) showed marked increase of SOD in Ad-VS-1 group compared with other two groups (p < 0.05). However, cellular MDA levels were significantly decreased in Ad-VS-1 group (p < 0.05) (Fig.3(b)).

Download figure to PowerPoint

image

Figure 4. (a) Comparison of ICAM-1 in groups (inline image). aP < 0.05, bP > 0.05 versus Blank Group; cP > 0.05, dP< 0.05 versus Hypoxia/Reoxygenation (H/R) Group. (b) Comparison of VCAM-1 in groups (inline image). aP < 0.01, bP > 0.05 versus Blank Group; cP > 0.05, dP < 0.05 versus Hypoxia/Reoxygenation (H/R) Group. (c) Comparison of TNT-α in groups (inline image). aP < 0.01, bP > 0.05 versus Blank Group; cP > 0.05, dP< 0.01 versus Hypoxia/Reoxygenation (H/R) Group Figure 4(a)–(c) showed that expressions of inflammatory cytokines, including ICAM-1. VCAM-1 and TNF-α were attenuated in Ad-VS-1 group (P < 0.05).

Download figure to PowerPoint

Apoptosis-Induced Agents Counteracted the Protective Effects of VS-1

To verify the effects of VS-1 against oxidative stress and inflammatory reactions in cardiomyocytes, a variety of apoptotic agents were applied to induce myocardial apoptosis. The group treated with Wortmanin, an inhibitor of PI3K activity, showed apoptosis rate increased up to the H/R group (P > 0.05) compared with Ad-VS-1 group (P < 0.05; Figure 5a). Similar results were also indicated in groups treated with SB203580, which induced cell death by inhibiting P38MAPK (Figure 5a).

image

Figure 5. (a) Comparison of serum NO concentrations in groups (±s). aP < 0.05, bP > 0.05 versus Blank Group; cP > 0.05, dP < 0.01 versus Hypoxia/Reoxygenation (H/R) Group. (b) Comparison of eNOS expression in groups by Western-blot. (c) Comparison of apoptosis incidence in groups (±s). aP < 0.05, bP > 0.05 versus Hypoxia/Reoxygenation (H/R) Group, cP < 0.05 versus Ad-Vs-1 Group. Fig. 5a showed that NO levels were significantly increased in the Ad-VS-1 group (p < 0.05). Western blot analysis of eNOS expression was consistent with this finding (Fig. 5b). Figure 5c showed the involvement of NOS. Hb and KT5823 aimed to eliminate the serum NO and PKC activity, respectively. Increased apoptosis comparable to the H/R group (P > 0.05) was found compared with Ad-VS-1 group (P < 0.05). The group treated with Wortmanin, an inhibitor of PI3K activity, showed apoptosis rate increased up to the H/R group (P > 0.05) compared with Ad-VS-1 group (P < 0.05; Figure 5c). Similar results were also indicated in groups treated with SB203580,which induced cell death by inhibiting P38MAPK.

Download figure to PowerPoint

VS-1 Protected Cardiomyocytes Independent of Endothelial Cells Via Additional NOS Pathways

To further determine whether VS-1 could protect cardiomyocytes independently, serum NO levels and eNOS expression were measured in this study. Figure 5(a) showed that NO levels were significantly increased in the Ad-VS-1 group (P < 0.05). Western blot analysis of eNOS expression was consistent with this finding (Figure 5b).

The involvement of NOS was further explored using Hb and KT5823. Hb and KT5823 aimed to eliminate the serum NO and PKC activity, respectively. Increased apoptosis comparable to the H/R group (P > 0.05) was found compared with Ad-VS-1 group (P < 0.05; Figure 5C).

Discussion

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References

This study focused on the protective role(s) of VS-1 in H/R-exposed cardiomyocytes using recombinant Ad-VS-1 adenovirus. Preliminary studies showed that VS-1 expression peaked at day 5. However, cells without VS-1 transfection hardly survived after 5-day incubation followed by H/R exposure. A compromise was made at the time point of 48-h incubation to achieve moderate VS-1 expression and myocardial survival to further the investigation. Our findings implicated that VS-1 could limit the H/R injuries by attenuating intracellular oxidative stress and inflammatory reactions while improving NOS pathway in isolated cardiomyocytes. Of note, these protective effects of VS-1 were exerted in the absence of endothelial cells.

In the mammalian heart, the NOS–NO–cGMP–PKC system plays a key role in mediating specific intracardiac signaling involved in the control of the contractile performance. Previous studies in isolated rat heart indicated a positive role of VS-1 mediated by NO–NOS–cGMP–PKC system [8]. This protective effect was abolished by either NOS inhibition or PKC blockade and was attenuated, but not suppressed, by the blockade of A1 receptors. These results suggested that VS-1 activity triggers two different pathways: one of these pathways is mediated by VS-1 receptors, and the other is mediated by NO release. The two pathways may converge on PKC [8]. In this study, we focused on the effects of VS-1 on myocardial NO release. It would be interesting to study the alternative pathway, VS-1 receptor expression triggered by VS-1 in future investigations. Further studies showed that VS-1 may take effect via an endothelial cell-dependent mechanism [11,13]. In cultured bovine aortic endothelial (BAE-1) cells, VS-1 induced a Ca(2+)-independent increase in NO production that was blocked by the PI3K inhibitor wortmannin [11]. Removal of endocardial endothelium and inhibition of NO synthesis and PI3K activity abolished the antiadrenergic effect of VS-1 on papillary muscle [11]. Since expression of NOS isoforms were well defined in cardiac myocytes [17–19], it is therefore tempting to analyze the effects of VS-1 on the myocardial NO–NOS–cGMP–PKC system alone and provide evidence to elucidate the mechanisms underlying the issue. Recent findings implicated that the three NOS isoforms, neuronal (nNOS), inducible (iNOS), and endothelial (eNOS), possess unequal activities in modulating myocardial activities [20]. For example, eNOS localizes to caveilae, where compartmentalization with beta-adrenergic receptors and L-type Ca2+ channels allows NO to inhibit beta-adrenergic–induced inotropy [21]. Conversely, nNOS-deficient mice have suppressed inotrophic response, suggesting a positive effect of nNOS on contractility [21]. iNOS is calcium independent and appears only in the damaged myocardium with a compromised contractile function [20]. However, in rat ventricular myocytes, the NOS-produced NO has been found negatively affects contractility by reducing L-type Ca2+ current [22,23] and by phosphorylation troponin I [13,24]. Therefore, the current study focused on the isoforms of eNOS. Further study on the other two isoforms could provide a more detailed picture of their specified functions in the presence of VS-1. The present findings showed that the myocardial NO–NOS–cGMP–PKC system was actively involved in VS-1–mediated myocardial protection. Overexpression of VS-1 may stimulate the eNOS-dependent NO production. The affinity of troponin C for calcium and contractility were thus depressed. We propose that both L-type Ca2+ current and PKC-mediated myofilament desensitization to Ca2+ may account for VS-1–induced negative inotropy. However, further explorations are needed to verify this proposal.

This study also indicated that VS-1 could be involved in multiple molecular processes to rescue myocardial apoptosis. We found that inhibition of P38MAPK increased apoptosis in VS-1 overexpression group, suggestive of a correlation between P38MAPK and VS-1 in cardiomyocytes. Previous findings suggested that VS-1 may reduce myocardial injuries by modulating endothelial cells [12,25]. VS-1 was found to inhibit phosphorylation of p38MAPK in arterial endothelial cells via a pertussis toxin sensitive, presumably Gαi coupled mechanism [25,26]. Therefore, the protective effects of VS-1 in the isolated heart were suggested to occur in an endothelial-dependent manner. However, we found that VS-1 enhanced myocardial vitality even in the absence of endothelial cells. These effects may be achieved by VS-1 modulating a combination of intracellular oxidative stress and inflammatory reactions. Oxidative stress and inflammatory factors, such as ICAM-1, could be substantially elevated in endothelial cells during I/R exposure [27,28]. Similar results were also found in this study. Therefore, the role of VS-1 in cardiovascular diseases may further expanded by preserving cardiomyocytes independently, as indicated in this study. However, it is likely that the protective effects may accumulate by cellular interactions between the two types of cells. Further studies are warranted to clarify this issue. Of note, this study is limited in several aspects: (a) we only focused on protective effects of VS-1 in preventing acute myocardial H/R injuries. The long-term effects of VS-1 in preserving myocardial function after H/R insults should be further studied, and (b) we used the H/R model to simulate the ischemic/reperfusion process. Therefore, only oxidative stress was considered in the study.

Conclusion

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References

This study indicated that overexpression of VS-1 could protect the H/R injuries in cardiomyocytes by improving NOS pathway while attenuating intracellular oxidative stress and inflammatory reactions. These protective effects of VS-1 were exerted in the absence of endothelial cells.

Conflict of Interest

There are no conflicts of interest.

References

  1. Top of page
  2. SUMMARY
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. References
  • 1
    Forman MB, Puett DW, Virmani R. Endothelial and myocardial injury during ischemia and reperfusion: Pathogenesis and therapeutic implications. J Am Coll Cardiol 1989;13:450459.
  • 2
    Tsao PS, Aoki N, Lefer DJ, et al. Time course of endothelial dysfunction and myocardial injury during myocardial ischemia and reperfusion in the cat. Circulation 1990;82:14021412.
  • 3
    Werns SW, Lucchesi BR. Myocardial ischemia and reperfusion: The role of oxygen radicals in tissue injury. Cardiovasc Drugs Ther 1989;2:761769.
  • 4
    Entman ML, Michael L, Rossen RD, et al. Inflammation in the course of early myocardial ischemia. Faseb J 1991;5:25292537.
  • 5
    Whelan RS, Kaplinskiy V, Kitsis RN. Cell death in the pathogenesis of heart disease: Mechanisms and significance. Annu Rev Physiol 2010;72:1944.
  • 6
    Kumar D, Lou H, Singal PK, et al. Oxidative stress and apoptosis in heart dysfunction. Herz 2002;27:662668.
  • 7
    Tota B, Quintieri AM, Di Felicec V, Cerra MC. New biological aspects of Chromogranin A-derived peptides: Focus on vasostatins. Comp Biochem Physiol A Mol Integr Physiol 2007;147:1118.
  • 8
    Cappello S, Angelone T, Tota B, et al. Human recombinant chromogranin A-derived vasostatin-1 mimics preconditioning via an adenosine/nitric oxide signaling mechanism. Am J Physiol Heart Circ Physiol 2007;293:H719727.
  • 9
    Pagliarob P, Cappello. S, Rastaldo R, et al. Protection against ischemia/reperfusion injuries by vasostatin-1 in the isolated rat heart. Comp Biochem Physiol A Mol Integr Physiol 2007;147:2324.
  • 10
    Angelone T, Corti A, Pagliaro P, et al. Vasostatins as modulators of cardiac performance in the isolated perfused rat Langendorff heart. Comp. Biochem Physiol A Mol Integr Physiol 2007;147:22.
  • 11
    Gallo MP, Levi R, Ramella R, et al. Endothelium-derived nitric oxide mediates the antiadrenergic effect of human vasostatin-1 in rat ventricular myocardium. Am J Physiol Heart Circ Physiol 2007;292:29062912.
  • 12
    Blois A, Serck-Hanssen G. Effects of vasostatin-1 on arterial endothelial cells stimulated by inflammatory agents. Comp Biochem Physiol A Mol Integr Physiol 2007;147:24.
  • 13
    Alloatti G, Gallo MP, Levia R, et al. Effects of vasostatin-1 on calcium current and contractility in rat ventricular myocardium. Comp Biochem Physiol A Mol Integr Physiol 2007;147:2223.
  • 14
    Mosmann T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:5563.
  • 15
    Brind AM, Hurlstone A, Edrisinghe D, et al. The role of polymorphisms of glutathione S-transferases GSTM1, M3, P1, T1 and A1 in susceptibility to alcoholic liver disease. Alcohol Alcohol 2004;39:478483.
  • 16
    Marklund S, Marklund G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 1974;47:469474.
  • 17
    Song W, Lu X., Feng Q. Tumor necrosis factor-alpha induces apoptosis via inducible nitric oxide synthase in neonatal mouse cardiomyocytes. Cardiovasc Res 2000;45:595602.
  • 18
    Brunner F, Maier R, Andrew P, et al. Attenuation of myocardial ischemia/reperfusion injury in mice with myocyte-specific over expression of endothelial nitric oxide synthase. Cardiovasc Res 2003;57:5562.
  • 19
    Nathan C, Xie QW. Regulation of biosynthesis of nitric oxide. J Biol Chem 1994;269:1372513728.
  • 20
    Okhotin VE, Shuklin AV. Significance of neuronal, endothelial and inducible NO-synthase isoforms in the cardiac muscle histophysiology. Morfologiia 2006;129:717.
  • 21
    Barouch LA, Harrison RW, Shaf MW, et al. Nitric oxide regulates the heart by spatial confinement of nitric oxide synthase isoforms. Nature 2002;416:337339
  • 22
    Abi-Gerges N, Fischmeister R, Méry PF. G protein-mediated inhibitory effect of a nitric oxide donor on the L-type Ca2+ current in rat ventricular myocytes. J Physiol 2001;15:117130.
  • 23
    Méry PF, Lohmann SM, Walter U, et al. Ca2+ current is regulated by cyclic GMP-dependent protein kinase in mammalian cardiac myocytes. Proc Natl Acad Sci USA 1991;88:11971201.
  • 24
    Tota B, Mazza R, Angelone T, et al. Peptides from the N-terminal domain of chromogranin A (vasostatins) exert negative inotropic effects in the isolated frog heart. Regul Pept 2003;114:123130.
  • 25
    Ferreo E, Scabini S, Magni E, et al. Chromogranin A protects vessels against tumor necrosis factor a-induced vascular leakage. Faseb J 2004;18:554556.
  • 26
    Blois A, Srebro B, Mandalà M, et al. The chromogranin A peptide vasostatin-I inhibits gap formation and signal transduction mediated by inflammatory agents in cultured bovine pulmonary and coronary arterial endothelial cells. Regul Pept 2006;135:7884.
  • 27
    Ziegelstein RC, He C, Hu Q. Hypoxia/ reoxygenation stimulates Ca2+-dependent ICAM-1 mRNA expression in human aortic endothelial cells. Biochem Biophys Res Commun 2004;322:6873.
  • 28
    Valen G, Paulsson G, Vaage J. Induction of inflammatory mediators during reperfusion of the human heart. Ann Thorac Surg 2001;71:226232.