SEARCH

SEARCH BY CITATION

Keywords:

  • TGF-β3;
  • epithelial barrier;
  • Src kinase inhibitor saracatinib (AZD0530);
  • tight junction protein;
  • periodontitis

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Background:  Previous studies have indicated that transforming growth factor beta 3 (TGF-β3) was strongly expressed both in the gingival epithelium and the poorly structured pocket epithelium.

Methods:  A comprehensive analysis of the profile of tight junction proteins was carried out by quantitative real-time RT-PCR, Western blot and paracellular permeability assays.

Results:  Active TGF-β3 protein added to monolayers of cultured oral epithelial cells initially reduced the permeability to dextran (10 kDa), followed by an increase in permeability. Three hours after the addition of TGF-β3, expression of genes encoding tight junction components was selectively up- or down-regulated. In addition, up- or down-regulation of expression of several tight junction associated proteins was observed, although the protein changes did not parallel changes in gene expression. To confirm that TGF-β3 plays a role in epithelial barrier function, a selective Src family kinase inhibitor saracatinib (AZD0530) was added to cells treated with active TGF-β3. Tight junction proteins claudins-2, -20 and ZO-2 were significantly decreased, but claudin-4 and -18 were significantly increased.

Conclusions:  These results suggest that TGF-β3 is involved in the modulation of epithelial barrier function by regulating assembly of tight junctions.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The lining epithelium of the lesion of periodontitis has a number of distinguishing features. These include reduced expression of the adherens junction protein E-cadherin and gap junction connexins, perturbation of F-actin filament structure1 and both cytokeratin2 and involucrin1 expression profiles not typical of terminally differentiated stratified squamous epithelium.

Previous studies indicated that transforming growth factor beta 3 (TGF-β3) showed strong reaction in both gingival epithelium and poorly structured pocket epithelium.3 Another characteristic feature of the epithelia is strong expression of the glycosylphosphatidylinositol (GPI) anchored CD24 protein (35–45  kDa).4 Patients with periodontal disease have autoreactive antibodies including CD24, that arise from the cross-reactivity with antigens of Gram positive bacteria located in the polymicrobial plaque associated with periodontal disease.4 Further studies demonstrated that stimulation by anti-CD24 antibodies in oral epithelial cells induced up-regulated expression of e-cadherin and down-regulation of tgf-β3 as assessed by real-time RT-PCR.5 This result indicated that ligation of CD24 potently suppresses expression of TGF-β3. Recent studies revealed that ligation of CD24 in cultured oral epithelial monolayers enhances epithelial barrier function by up-regulating the expression of genes encoding the tight junction proteins ZO-1, -2 and occludin.6

In the present study, the effect of TGF-β3 on epithelial barrier function was examined. A comprehensive expression profile for genes encoding tight junction components was investigated: 23 claudins, occludin, junctional adhesion molecules (JAM-A, -B, -C) and important scaffolding proteins ZO-1, -2, -3 in oral epithelial cells treated with active TGF-β3. Saracatinib (AZD0530), a selective Src family kinase inhibitor, was used to probe the role of Src kinase in mediating the effect of TGF-β3 on barrier function of epithelial monolayers.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Oral epithelial cell culture

The epithelial line (H413) derived from a human oral squamous cell carcinoma,7 displays stratified epithelial cell morphology in culture. H413 clonal lines were established using a limit dilution method in our laboratory as described previously.5 The cloned cells were cultured in Eagle’s Minimum Essential Medium, Joklik modification, (Sigma) and 5% foetal calf serum (FCS, CSL Limited, Victoria, Australia) defined as a low calcium medium (0.2 mM calcium contributed from FCS-8) at 37 °C in 5% CO2. Cultures were harvested with 0.05% trypsin/EDTA in PBS and subcultured every three days.

The impact of TGF-β3 treated epithelial barrier function

The active TGF-β3 used was a recombinant human protein (25 kDa) with each subunit containing 112 amino acid residues (cat: ab52313, Abcam, UK). The specific activity was >2 × 108 units/mg as described by the manufacturer. The TGF-β3 working solution was determined by permeability assays on H413-1 cells and the effective concentration was determined through serial dilutions to be 0.25 ng/ml (data not shown).

Barrier function mediated by tight junctions in oral epithelial cells was measured by plating H413 clone-1 cells in 24 mm Transwell filters on 0.4 μm polyester membranes (Corning Incorporated Life Science, USA) as described previously.6 Briefly, H413 clone-1 cells were cultured in a low Ca2+ containing medium and passaged onto 24 mm Transwell filters. Triplicate confluent monolayers (2 × 105/cm2) were exposed to 0.25 ng/ml active protein TGF-β3 (Abcam, Cambridge UK), or Src kinase inhibitor saracatinib (AZD0530, 1 μM, provided by Astra Zeneca Ltd), or active protein TGF-β3 (0.25 ng/ml) with saracatinib (AZD0530, 1 μM) respectively. Dextran Alexa Fluor 647 (10 kDa, Molecular Probes, Invitrogen) diluted from a stock solution of 1 mg/ml in medium was added to each well. At various time points (1–7 hours, 9 hours, 12 hours) after commencement of the experiments, 50 μl of media was taken from each lower compartment and the fluorescence analysed using a Perkin-Elmer LS50B luminescence spectrometer (Ex: 650 nm, Em: 668 nm) for Alexa Fluor 647. Diffusion of labelled dextran was determined as moles of the fluorophore transferred to the lower compartment calculated by reference to a standard curve. Data from three independent experiments were analysed by paired t-tests.

RNA extraction and reverse transcription

Comprehensive analysis of expression of genes encoding tight junction components was performed. Briefly, subconfluent H413 clone-1 cells (25 cm2 flask containing 5 × 106 cells) were incubated with active protein TGF-β3 (0.25 ng/ml) or treated with active protein TGF-β3 (0.25 ng/ml) plus Src-protein kinase inhibitor saracatinib (AZD0530, 1 μM). Cells were harvested by scraping in PBS and pelleted by centrifugation. Trizol (1 ml) was added to the cell pellet (5 × 106) for homogenization and extraction in chloroform and isopropanol. RNA pellets were washed in 75% (v/v) ethanol, centrifuged, air dried and resuspended in an appropriate volume of DEPC-treated MilliQ water. For reverse transcription, the First-Strand cDNAs were synthesized with oligo(dT)12-18 (Invitrogen), 10 mM dNTP (Promega), RNaseOUTTM Recombinant RNase Inhibitor (Invitrogen) and SuperScriptTM III Reverse Transcriptase (Invitrogen) according to the manufacturer’s (Invitrogen) protocol.

Quantitative real-time RT-PCR analysis of expression of genes encoding tight junction components

Primers for genes encoding claudins, occludin, JAMs and ZO-1, -2, -3 were designed using the Oligo Explorer software (1.1.0) and synthesized by Sigma (Table 1). Real-time RT-PCR analyses were performed by SYBR Green based assays using the Stratagene MxPro-Mx3005P System and software (MxPro 4.10). PCR reaction was conducted with 2 μl of diluted cDNA samples, 200 nM of each respective forward and reverse primer in a 25 μl final reaction mixture with Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). The cDNA samples isolated from non-manipulated H413 clone-1 cells were quantified by the PicoGreen kit (Invitrogen) and used for constructing the standard curves (2000-2 pg) by reference to the expression of the housekeeping gene encoding β-actin. The PCR reaction for each gene was carried out in triplicate in 96-well plates and initiated by activation at 95 °C for 2 minutes, followed by 40 PCR cycles of denaturation at 95 °C for 15 seconds, annealing and extension at 60 °C for 30 seconds.

Table 1.   Primers for genes encoding tight junction components
TubeGene NameExpected size (bp)Gene SymbolUniGene NosGenBank Accession NosOligos (sequence 5′[RIGHTWARDS ARROW]3′)
1claudin-1135CLDN1Hs.439060NM_021101Forward CAATGCCAGGTACGAATTTGG Reverse TGGATAGGGCCTTGGTGTTG
2claudin-281CLDN2Hs.522746NM_020384Forward CTGCTTTTCCTGCTCATCCC Reverse AGAGCTCCTTGTGGCAAGAGG
3claudin-384CLDN3Hs.647023NM_001306Forward ATCGTGTGCTGCGCGTT Reverse GGCCCTCCCAGATGTTCTG
4claudin-4116CLDN4Hs.647036NM_001305Forward TCATCGGCAGCAACATTGTC Reverse GCAGTGCCAGCAGCGAGT
5claudin-586CLDN5Hs.505337NM_003277Forward GTGCTCTACCTGTTTTGCG Reverse GACGGGTCGTAAAACTCG
6claudin-698CLDN6Hs.533779NM_021195Forward CCTCTGGGATTGTCTTTGTC Reverse CACCAGGGGGTTATAGAAGTC
7claudin-7167CLDN7Hs.513915NM_001307Forward CTCGAGCCCTAATGGTGGTC Reverse CTACCAAGGTGGCAAGACCTG
8claudin-8228CLDN8Hs.162209NM_199328Forward CTTGGTGGTGTTGGAATG Reverse GGAAGCAGCACACATCAG
9claudin-9213CLDN9Hs.296949NM_020982Forward GTGCCCTCTGTGTCATTG Reverse CCAGGGGGTTGTAGAAGTC
10claudin-10 (2-isoform)84 230CLDN10Hs.534377NM_182848 NM_006984Forward CTGCTACCACGTCCAATG Reverse TCCACAGACCCTGGTAAAC Forward CTTCATGGTCTCCATCTCAG Reverse CAGCAGCGATCATAAGTCC
11claudin-11220CLDN11Hs.31595NM_005602Forward GGTGTTTTGCTCATTCTGC Reverse TAGAGCCCGCAGTGTAGTAG
12claudin-12174CLDN12Hs.258576NM_012129Forward GCCACAGTCCTTTCCTTC Reverse GTCACTGCTCCCGTCATAC
13claudin-14271CLDN14Hs.660278NM_144492 NM_012130Forward TCTACCAGTGCCAGATCTACC Reverse AGCGGGTTGTAGAAGTTCTG
14claudin-15127CLDN15Hs.38738NM_014343 NM_138429Forward CCTTTGGCTTCTTCATGG Reverse CAGAGGTTCTCGAAGATGG
15claudin-16209CLDN16Hs.251391NM_006580Forward GTTGGATGGTGAATGCTG Reverse GAGCAGGGTGAGAAATCC
16claudin-17134CLDN17Hs.258589NM_012131Forward ACCCAGCCATCCACATAG Reverse CCCTTGCTTCTTTCTGTTG
17claudin-18 (2-isoform)181 98CLDN18Hs.655324NM_016369 NM_001002026Forward TCCGTGTTCCAGTACGAAG Reverse TCAGGGCAAAGATGGATAC Forward GGGTTCGTGGTTTCACTG Reverse GCTGTTACGGGGTTGTTG
18claudin-19196CLDN19Hs.496270NM_148960Forward GACGGTCACATCCAATCAG Reverse ACGAGACAGCAGTCAAAGTG
19claudin-20198CLDN20Hs.567491NM_001001346Forward AACTGGAAGGTGAATGTGG Reverse CCCCAAAGCAGACAGAAC
20claudin-22229CLDN22Str.12856XM_926796Forward GCTTTGCCTGCTGAACTC Reverse ACTCCTGAACCGTCTTGTG
21claudin-23284CLDN23Hs.183617NM_194284Forward CCTGGTACAACCACTTCTTG Reverse GCCGTCGCTGTAGTACTTG
22occludin98OCLNHs.592605NM_002538Forward GTCCAATATTTTGTGGGACAAGG Reverse GGCACGTCCTGTGTGCCT
23junctional adhesion molecule A102JAM1Hs.517293NM_016946Forward CAAGTCGAGAGGAAACTGTTG Reverse TCTGACTTCAGGTTCAGAAGAG
24junctional adhesion molecule B157JAM2Hs.517227NM_021219Forward AAGTTAGTGCCCCATCTGAG Reverse GGATTCCCTTCTTTGTCTTG
25junctional adhesion molecule C238JAM3Hs.150718NM_032801Forward GGGCTGTAAATCTCAAATCC Reverse TCTCTCCGTGTCACATTCC
26tight junction protein 1 (zona occludens 1)163ZO-1Hs.510833NM_003257Forward AGAAGGATGTTTATCGTCGCATT Reverse CCAAGAGCCCAGTTTTCCAT
27tight junction protein 2 (zona occludens 2)130ZO-2Hs.50382NM_004817Forward GGAAGGTCGCTGCTATTGTG Reverse CGGAAACTTCTGCCATCAAAC
28tight junction protein 3 (zona occludens 3)132ZO-3Hs.25527NM_014428Forward GAGACAGCGAAGAGTTTGG Reverse TAGACACCCCGTTGATCTG

Western blot analysis for tight junction proteins

Proteins extracted in SDS sample buffer from control H413 clone-1 cells or cells treated with active protein TGF-β3 (0.25 ng/ml) or treated with active protein TGF-β3 (0.25 ng/ml) plus Src-protein kinase inhibitor saracatinib (AZD0530, 1 μM) for 3 hours, were separated by PAGE using 12% mini-gels, transferred to nitrocellulose membranes (Bio-Rad) and blocked overnight with 3% bovine serum albumin (Sigma) in 0.1 M Tris buffered salts solution pH 7.4 (TBS). Blotted antigens were incubated with rabbit polyclonal antibodies (1 μg/ml) specific for particular claudins, occludin and JAM-A. A rabbit polyclonal anti-β-actin (0.1 μg/ml) was used as a loading control (Abcam Ltd., Cambridge, UK) in 0.05% Tween20/TBS. Incubations were for 2 hours. The samples were then washed and incubated with alkaline phosphatase (AP) conjugated secondary antibody (goat-anti rabbit IgG, DAKO, Denmark) diluted 1:1500 in Tween20/TBS for 2 hours. Bound antibody was visualized with AP substrate (Bio-Rad) after development of reactivity for proteins from control cells, TGF-β3 (0.25 ng/ml) and TGF-β3 (0.25 ng/ml) with protein Src inhibitor saracatinib (AZD0530) treated cultures under standardized conditions.

Immunostaining and confocal laser scanning microscopy for tight junction proteins

Confluent H413 clone-1 cells (2 × 105/cm2) grown on Transwell filters (Corning) were treated with TGF-β3 (0.25 ng/ml) or co-incubated with active protein TGF-β3 (0.25 ng/ml) and Src protein kinase inhibitor saracatinib (AZD0530, 1 μM, Astra Zeneca Ltd) for 3 hours, washed in PBS then fixed with 4% paraformaldehyde/PBS for 1 hour, permeabilized with 0.1% Triton-X100/PBS for 15 minutes, and blocked with 10% horse serum/PBS for 1 hour. The filters were then cut into pieces and placed in micro tubes (1.5 ml), incubated overnight at 4 °C with primary antibodies: rabbit polyclonal anti-claudins -4, -8, -10, -12, -14, -17, -20, and JAM-A (5 μg/ml), mouse polyclonal to claudin-15 (5 μg/ml, purchased from Abcam, UK); or rabbit polyclonal anti-claudins -1, -2, -3, -5, -18 and occludin (5 μg/ml, purchased from ZYMED Laboratories) in 10% FCS/PBS at 30 °C overnight in a humid chamber. After washing with PBS, fluorochrome conjugated secondary antibody goat anti-rabbit IgG Alexa fluor 488 (Invitrogen), or goat-anti-mouse FITC was added for overnight incubation at 4 °C. For negative control, the primary antibody was replaced with isotype control mouse antibody or control rabbit Ig (DAKO, Australia). Membranes were washed with PBS and mounted onto glass slides using the ProLong Gold antifade reagent with DAPI (Molecular Probes, Invitrogen).

Confocal images were captured with an Olympus Fluoview (FV) 1000, equipped with Olympus FV 10-MCPSU (405 nm, 473 nm, 633 nm) and NTT Electronic Optiλ (559 nm) lasers. Fields were selected at random [objective: Olympus 60 × /1.20/0.28 (WD) Water UPLSAPO] and the cells were brought into focus under bright-field conditions. All fluorescence images prepared with the confocal acquisition software (FV10-ASW 1.7) were stored and exported as TIF files.

Statistical analysis

All data were analysed by paired t-test (mean ± s.d., two-tailed, 95% CI range) from at least three consecutive experiments for real-time RT-PCR, Western blots, and permeability assays where necessary. A level of p < 0.05 was accepted as statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The effect of TGF-β3 on barrier function of epithelial monolayers

It was found that addition of TGF-β3 to cultured H413 clone-1 cells reduced the permeability at 3 hours compared to control cells, but increased permeability of the epithelial monolayers was evident from the fourth hour of incubation (Fig. 1). The role of Src kinase inhibitor saracatinib was demonstrated by saracatinib blocking of the initial increase in barrier function mediated by TGF-β3 (Fig. 1).

image

Figure 1.  Active TGF-β3 ligand induces a transient decrease in paracellular permeability that is inhibited by Src kinase inhibitor saracatinib. Figure shows passage of fluorochrome-labelled dextran across H413 clone-1 epithelial cell monolayers. Curves show active protein TGF-β3 and co-cultured TGF-β3 with Src protein kinase inhibitor saracatinib (AZD0530) on permeability of monolayers. Passage of dextran into lower compartment reached equilibrium after the 7th hour. Data show mean values ± s.d. for three representative experiments in triplicate (*p < 0.05, paired t-test).

Download figure to PowerPoint

Up- or down-regulation of expression of genes encoding multiple tight junction components by TGF-β3

Quantitative real-time RT-PCR findings shown in Fig. 2 indicated that incubation with active TGF-β3 protein induced significant up- or down-regulation of genes encoding tight junction components corresponding with reduction of monolayer permeability at 3 hours. This effect included: marked up-regulation of expression of the gene encoding claudin-4 and down-regulation of the gene encoding claudin-1; moderate up-regulation of expression of genes encoding claudins-20, -18A2.1 (isoform-2), -14, -15, -10a (isoform-1), ZO-2; and down-regulation of the gene encoding claudin-2. Also observed was low level up-regulation of the genes encoding JAM-B and claudin-11, and down-regulation of the genes encoding claudins-12, -8, -6, and JAM-C. No significant changes were shown for genes encoding JAM-A, ZO-1, -3, occludin, claudins-7, -9, -16, -17 and -22. No expression was detected for claudins-10b (isoform-2), -18A1.1 (isoform-1), -19 and -23 in this cell model. In addition, TGF-β3 did not impact on CD24 expression levels (data not shown).

image

Figure 2.  Complex response to active TGF-β3 protein in tight junction gene expression in cultured oral epithelial cells. Quantitative real-time RT-PCR findings indicate significant up- or down-regulation (p < 0.05) and strong expression (>103 pg), moderate expression (102–103 pg) and weak expression (10–102 pg) of genes encoding tight junction. No changes in gene expression for claudins -7, -9, -16, -17, JAM-A occludin, ZO-1 and ZO-3 were observed. No expression was detected for claudins -3, -5, -10b (isoform-2), -18A1.1 (isoform-1), -19 and -23 in this cell model.

Download figure to PowerPoint

Immunoblot and localization analysis of tight junction proteins by TGF-β3

Semi-quantitative analysis of tight junction proteins was performed by densitometry scans of Western blots developed under standardized conditions. Cell lysates were probed with antibodies to tight junction proteins in Western blot analysis to indicate a significant decrease in levels of claudin-2, -4, and -10 (Fig. 3a); and a significant increase in levels of claudin-20, occludin (Fig. 3a), and claudin-8 (Fig. 3b) in cultures exposed to TGF-β3.

image

Figure 3.  Western blot analysis for alteration of tight junction proteins treated with active protein TGF-β3 or with both active protein TGF-β3 and Src inhibitor saracatinib (AZD0530). Western blots and bar graphs show increased/decreased tight junction proteins: claudins -20, occludin/claudins -2, -4, -10a in (a); claudins -8, -18/ZO-2 in (b); (*p < 0.05, **p < 0.01, paired t-test). Claudins -3, -5, -12, -14 and -17 were not detected.

Download figure to PowerPoint

After challenge with TGF-β3 and the Src kinase inhibitor saracatinib, levels of claudins-2, -20, occludin (Fig. 3a) and ZO-2 (Fig. 3b) were down-regulated, except for up-regulation of claudin-4 (Fig. 3a), and -18 (Fig. 3b) compared to those of TGF-β3 treated cultures.

Confocal microscopy was employed to localize tight junction protein expression at cell contacts or in cytoplasm of cultured cells following challenge with TGF-β3 or with both active protein TGF-β3 and c-Src kinase inhibitor saracatinib. Among the significantly altered proteins, only claudin-4 (Fig. 4) showed a protein localization profile compatible with tight junction function at cell contacts. In addition, claudin-4 shows relocation away from cell contacts in response to the Src kinase inhibitor saracatinib.

image

Figure 4.  Confocal microscopy analysis shows claudin-4 protein localization profile compatible with tight junction function at cell contacts after treatment with active protein TGF-β3. (a) Control cells, (b) cells treated with active protein TGF-β3, (c) cells treated with both active protein TGF-β3 and Src inhibitor saracatinib (bars, 30 μm).

Download figure to PowerPoint

Change in tight junction protein level not parallel with mRNA level

The mRNA level does not always result in a corresponding change in protein level.9 Data in Figs. 2 and 3 show that the protein level and mRNA level do not always correlate. Up-regulated mRNA for claudin-4 and -10 corresponded with down-regulated proteins, while down-regulated mRNA of claudin-8 and occludin corresponded with up-regulated proteins. However, despite up-regulated mRNA levels for claudins-14, -15, -18, ZO-2 and down-regulated mRNA levels of claudin-12, ZO-1, protein levels remained constant.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The data show that TGF-β3 up- or down-regulates expression of a number of genes encoding tight junction components resulting in enhanced or reduced barrier function in H413 epithelial monolayers over a time course. Conversely, ligation of CD24 on H413 epithelial cells induced down-regulation of tgf-β3 expression.5 Expression of TGF-β3 is significantly increased in the pocket epithelium compared with the epithelium of the healthy gingival attachment.3 Accordingly, up-regulation of TGF-β3 expression in pocket epithelium could be causally linked to the observed down-regulation of tight junction components. Suppression of cd24 expression in H413 cells by RNA silencing resulted in down-regulation of e-cadherin associated with enhanced expression of snail, twist and tgf-β3.5 Anti-CD24 peptide antibody enhanced mRNA for E-cadherin and down-regulated expression of tgf-β3 but did not influence the expression of snail or twist.5 This down-regulation of tgf-β3 expression mediated by ligation of CD24 has unknown consequences for tight junction assembly and function. Regulation is likely to be complex as the TGF-β1 isoform has been demonstrated to induce down-regulation of Src-family kinases.10

Activation of c-Src kinase has been reported to induce resistance to the effects of TGF-β1,11 possibly by modulating phosphorylation of Erk kinase.12 On the basis of the response profile for the kinase inhibitor saracatinib employed in the present study, it was considered probable that c-Src activation is important in mediating the TGF-β signal in cultured oral epithelial cells. This was confirmed by demonstrating loss of barrier function following incubation with the selective c-Src kinase inhibitor saracatinib.13

TGF-β3 has been implicated in numerous biological pathways, including cell proliferation, differentiation, and signal transduction.14,15 In the present study, the findings provide the novel insight of TGF-β3 as a regulator that mediates cell function via junction assembly.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was supported by awards from the Australian Dental Research Foundation and the Dental Board of New South Wales. We thank Astra Zeneca Ltd for providing the kinase inhibitor saracatinib (AZD0530), and Mary Simonian and Dr Hong Yu for their assistance with immunostaining and confocal microscopy work.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • 1
    Ye P, Chapple CC, Kumar RK, Hunter N. Expression patterns of E-cadherin, involucrin, and connexin gap junction proteins in the lining epithelia of inflamed gingiva. J Pathol 2000;192:5866.
  • 2
    Hunter N, Nicholls B, Srivastava M, Chapple CC, Zoellner HF, Gibbins JR. Reactive pocket epithelium in untreated chronic periodontal disease: possible derivation from developmental remnants of the enamel organ and root sheath. J Oral Pathol Med 2001;30:178186.
  • 3
    Ye P, Simonian M, Chapple CC, Gibbins JR, Kumar RK, Hunter N. Differential expression of transforming growth factors-beta 1, -beta 2, -beta 3 and the type I, II, III receptors in the lining epithelia of inflamed gingiva. Pathology 2003;35:384392.
  • 4
    Ye P, Simonian M, Nadkarni MA, Decarlo AA, Chapple CC, Hunter N. Identification of epithelial auto-antigens associated with periodontal disease. Clin Exp Immunol 2005;139:328337.
  • 5
    Ye P, Nadkarni MA, Hunter N. Regulation of E-cadherin and TGF-beta3 expression by CD24 in cultured oral epithelial cells. Biochem Biophys Res Commun 2006;349:229235.
  • 6
    Ye P, Nadkarni MA, Simonian M, Hunter N. CD24 regulated gene expression and distribution of tight junction proteins is associated with altered barrier function in oral epithelial monolayers. BMC Cell Biol 2009;10:2.
  • 7
    Prime SS, Nixon SV, Crane IJ, et al. The behaviour of human oral squamous cell carcinoma in cell culture. J Pathol 1990;160:259269.
  • 8
    Swierenga SH, MacManus JP. Preparation of low calcium growth medium suitable for determination of tumorigenicity of cultured cells. J Tissue Culture Methods 1982;7:13.
  • 9
    Wang H, Wang Q, Pape UJ, Shen B, Huang J, Wu B, Li X. Systematic investigation of global coordination among mRNA and protein in cellular society. BMC Genomics 2010;11:364.
  • 10
    Atfi A, Drobetsky E, Boissonneault M, Chapdelaine A, Chevalier S. Transforming growth factor beta down-regulates Src family protein tyrosine kinase signaling pathways. J Biol Chem 1994;269:3068830693.
  • 11
    Park SS, Eom YW, Kim EH, et al. Involvement of c-Src kinase in the regulation of TGF-beta1-induced apoptosis. Oncogene 2004;23:62726281.
  • 12
    Miyazono K. Positive and negative regulation of TGF-beta signaling. J Cell Sci 2000;113:11011109.
  • 13
    Hannon RA, Clack G, Rimmer M, et al. Effects of the Src kinase inhibitor saracatinib (AZD0530) on bone turnover in healthy men: a randomized, double-blind, placebo-controlled, multiple-ascending-dose phase I trial. J Bone Miner Res 2010;25:463471.
  • 14
    Huh MI, Chang Y, Jung JC. Temporal and spatial distribution of TGF-beta isoforms and signaling intermediates in corneal regenerative wound repair. Histol Histopathol 2009;24:14051416.
  • 15
    Ahmed S, Liu CC, Nawshad A. Mechanisms of palatal epithelial seam disintegration by transforming growth factor (TGF) beta3. Dev Biol 2007;309:193207.