SEARCH

SEARCH BY CITATION

Keywords:

  • Body condition score;
  • Myocardium;
  • Real-time PCR;
  • Sex

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Background:

Leptin belongs to the group of adipokines and has recently attracted attention because of its effects on the cardiovascular system. Increased leptin concentrations are reported in obese dogs but its role in cardiac disease (CD) is not known. Therefore, we investigated leptin expression in blood samples from dogs with congestive heart failure (CHF), and from myocardial samples of dogs with CDs.

Methods:

Leptin mRNA was analyzed from blood samples of 8 dogs presented for cardiac screening in which no abnormalities were detected and 8 dogs in CHF. In addition, myocardial samples (interventricular septum, right and left atria, and ventricles) of 10 dogs with no cardiac abnormalities (controls), 7 dogs with acquired and 3 dogs with congenital CDs were investigated using real-time polymerase chain reaction (PCR).

Results:

Dogs with CHF had significantly higher blood concentrations of leptin mRNA than dogs without CD (P = .013). Myocardial leptin expression was significantly increased in acquired (P = .035) and decreased in congenital CD (P = .016) in comparison to controls. Dogs in heart failure stage D showed higher myocardial leptin concentrations than dogs in stage C3 and B (P = .031). Differences according to myocardial region (P < .05) were detected and higher leptin concentrations were present in the atria in comparison to the ventricles in dogs with CD (P = .005). Comparing male and female dogs with CD revealed higher leptin concentrations in female dogs (P = .001).

Conclusions:

These results indicate leptin mRNA concentrations vary with CD, severity of CD, myocardial region, and possibly sex. Therefore, leptin might play a role in canine CD.

Abbreviations
BCS

body condition score

CD

cardiac disease

CHF

congestive heart failure

CKCS

Cavalier King Charles Spaniel

DCM

dilated cardiomyopathy

DVD

degenerative valvular disease

GSD

German Shepherd Dog

RTA

Road traffic accident

Cardiac diseases (CD) frequently progress into heart failure. Progression of CD may result from multiple myocardial remodeling events, initially as beneficial adaptive changes, but eventually resulting in dysregulation of collagen synthesis and heart failure.[1-3] Chronic heart failure is associated with enhanced catabolic metabolism finally resulting in overall weight loss and cardiac cachexia.[4]

Leptin, an adipokine, influences body weight and regulates energy homoeostasis by decreasing appetite and increasing basal metabolic rate.[5] It is secreted by adipocytes and increased concentrations are found in obese people and women, who have a higher body fat content than men.[5-7] Leptin is also produced by inflammatory cells and is reported to modulate the immune system, has proinflammatory effects, and is increased with other inflammatory markers such as tumor necrosis factor alpha and interleukin 1.[8-15] Therefore, leptin is associated with activation of the inflammatory system in chronic diseases.[10, 11, 16] Increased circulating concentrations of leptin were found in unfavorable outcomes in hypertension, myocardial disease, and inflammation.[17]

In the heart, cardiomyocytes and endothelial cells produce leptin and its receptor. In addition to changes in blood concentrations, functional auto- and para-crine effects may occur.[17-21] Leptin regulates the baseline physiology of the heart including myocyte contractility, hypertrophy, apoptosis and metabolism.[20, 22, 23] Localized depots of epicardial or perivascular fat might also play physiological or pathological roles.[22, 24, 25]

In CD and cases of congestive heart failure (CHF),[26] leptin was reported to be increased, which is consistent with an increased metabolic rate associated with high concentrations of catecholamines and proinflammatory cytokines present in CHF.[4, 26, 27] The development of a progressive catabolic syndrome eventually leads to cardiac cachexia.[28] In cardiac cachexia with loss of body weight and body fat, leptin production is decreased, which results in positive energy balance to minimize further weight loss.[9, 29, 30]

Furthermore, because of its central sympathoexcitatory effects, leptin participates in the neurohumoral activation in heart failure.[31] Increased leptin was associated with increased oxygen consumption and intracellular calcium release, and decreased cardiac efficiency in vivo.[17, 25, 32] In CD, leptin is reported to be involved in cardiac remodeling, characterized by cardiomyocyte hypertrophy and disruption of the extracellular matrix resulting in increased collagen deposition,[18, 24, 25, 33] which might contribute to cardiac dysfunction. Leptin may have predictive value for future cardiovascular morbidity and mortality.[17, 24] However, paradoxical observations exist and leptin is reported to protect cardiomyocytes from apoptosis, which plays an important role in the development of CHF.[34] Furthermore, in mice with deficient leptin receptor, leptin might decrease cardiac hypertrophy, apoptosis, and inflammation.[35]

Leptin involved in the metabolic state of heart failure patients can impact cardiovascular function by direct effects on the heart or secondary responses mediated by the central nervous system, and may play a role as predictor of future cardiovascular morbidity and mortality. The role of leptin in development and progression of canine CD and CHF is not known. Therefore, leptin expression was investigated in blood samples of dogs with CHF and in myocardial samples of dogs with CDs and compared with samples from dogs without CDs. We hypothesized that increased leptin concentrations in blood samples of dogs with CHF and in myocardial samples of dogs with CDs would be identified.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Cases

The 1st part of the study consisted of analysis of blood samples for leptin expression and the second part investigated gene expression in myocardial samples. Informed consent was obtained from the owners before inclusion into the study. Animals were assigned arbitrary numbers to maintain confidentiality.

All dogs were presented to the Small Animal Teaching Hospital, University of Liverpool and underwent physical examination, CBC and serum biochemistry. A body condition score (BCS) was recorded by 1 investigator (SF) using a 9-point system.[36] As only marked muscle loss was noted in records of the dogs, a muscle condition score was not determined. For dogs in CHF the ABCD classification scheme was used.[37]

Blood samples were taken from 8 healthy dogs presented as control dogs for cardiac screening (LUPA project, http://www.eurolupa.org) and 8 dogs presented with CHF. All dogs underwent electrocardiography (ECG) and echocardiography. CHF was confirmed on physical examination, echocardiography, and thoracic radiographs. In dogs presented in CHF, blood pressure was measured and thoracic radiographs were taken if the dogs were stable. Holter monitor (24 hour-ECG) was applied if indicated to confirm arrhythmias. Dogs in CHF were stabilized on heart failure medications including furosemide, nitroglycerine, pimobendan, benazepril, and spironolactone. All dogs were discharged after stabilization.

A quantity of 0.3 mL was separated from the EDTA blood taken for CBC and frozen within 10 minutes at −20°C and stored at −80°C until further processing.

Myocardial samples were collected post-mortem from 10 dogs without CDs and 10 dogs with CD. All dogs underwent physical examination, CBC, and serum biochemistry. Recording of the BCS was performed as reported above.

Dogs without CDs had further investigations according to their underlying condition, including some combination of urinalysis, ultrasonography, radiography, CT, MRI, fine needle aspirates and biopsies if indicated, which resulted in diagnoses of their diseases (Table 2). The dogs were euthanized on request of their owners because of poor prognosis, progressive disease, or both where improvement with treatment was not expected.

Eight dogs with CDs were patients of the cardiology department of the Small Animal Teaching Hospital, University of Liverpool and had a cardiac evaluation including blood pressure measurement, ECG, echocardiography, and thoracic radiographs. Two dogs were investigated and diagnosed by a diplomate in cardiology in another practice (Simon Swift) and referred for euthanasia and no further investigations were performed. The dogs were euthanized because of end-stage CD and refractory heart failure, or severity of disease. One dog with severe pulmonic stenosis and 1 dog with severe aortic stenosis were euthanized because of soft tissue sarcoma affecting liver, spleen, and mesentery and old age with loss of quality of life in the owner's perception, respectively. One dog with recurrent ventricular tachycardia developed ventricular fibrillation and died.

The heart was removed within 1 hour after euthanasia or death. Myocardial samples of approximately 3 mm thickness were taken from the interventricular septum, the right atrium, right ventricle, left atrium, and left ventricle and visible fat was removed using scissors or scalpel blade. Samples were immediately immersed in RNAlater1 at room temperature for 24 hours before being stored at −20°C until use, in accordance with the manufacturer's instructions. The remaining cardiac tissues were fixed in 10% formalin for 3–5 days for gross pathological and histopathologic examination.

Gross Pathology and Histopathology

The hearts were assessed for dilatation or hypertrophy of the chambers and walls and for congenital or acquired disease lesions. Tissue samples of approximately 1 cm2 were taken from the right and left atria, interatrial and interventricular septae, the left and right ventricular walls, the left and right atrioventricular valves, and the left- and right-sided ventricular outflow tracts including aortic and pulmonic valves for histopathology. The samples were embedded in paraffin and routinely sectioned (3.5 μm) and stained using hematoxylin-eosin. From each myocardial site, between 2 and 4 tissue sections were microscopically examined by 1 pathologist (UH).

RNA Extraction

Total RNA was isolated from blood samples using Ambion blood kit2 according to the manufacturer's protocol. DNase treatment2 was performed before cDNA production according to the manufacturer's protocol.

Tissue samples were removed from RNA later1 and total RNA was extracted using RNA minikit3 and a slightly modified manufacturer's protocol. The tissue was placed in liquid nitrogen; the frozen tissue was then transferred into 300 μL RLT lysis buffer and ground thoroughly with a tissue pestle grinder. Then 590 μL RNase-free water and 10 μL proteinase K4 was added, thoroughly mixed, and incubated for 10 minutes at 55°C. After centrifugation for 3 minutes at 10,000 × g at room temperature, the supernatant was transferred into a new eppendorf tube and 0.5 volumes of 96% ethanol was added and thoroughly mixed. The following steps were according to the manufacturer's protocol. An on-column DNA digestion5 step was included. Final elution of the total RNA was performed using 40 μL of RNase-free water and repeated to maximize the amount of RNA eluted. The concentration of total RNA of each sample was quantified by using a spectrophotometer.6

Synthesis of cDNA

cDNA was synthesized from 200 ng of total RNA using Moloney murine leukemia virus reverse transcriptase and primed with random hexamer oligonucleotides7 in a 25 μL reaction. cDNA was stored at −80°C until later use in quantitative PCR.

Primers for canine leptin were designed using Primer Express software8 and selected to span predicted exon boundaries where possible. Leptin forward sequence was ACCGTATGGGTGTCCTTTATCCT, reverse AGAGTGGCTCTGTGGTGTGAGA. The primer sequences for the housekeeping gene GAPDH have been reported previously (forward: CTGGGGCTCACTTGAAAGG, reverse: CAAACATGGGGGCATCAG).[38]

BLAST searches were performed for leptin to confirm gene specificity. Target and reference gene primers were synthesized by Eurogentec. Both primers were validated using a standard curve of 8 serial dilutions and primer efficiencies for GAPDH was 98% and for leptin 120%.

Aliquots (1 μL) were amplified in duplicates by PCR in 20 μL reaction volumes on an ABI 7700 Sequence Detector9 using SYBR Green PCR mastermix.10 Each assay well had a 20 μL reaction volume consisting of 10 μL 2X SYBR Green PCR mastermix,10 0.4 μL each of 10 μM forward and reverse primers and 1 μL of sample cDNA (templates) or water (negative controls). The amplification was performed according to standard protocol with 2 minutes at 50°C, 10 minutes at 90°C followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The PCR was followed by a dissociation program for 1 min at 95°C, succeeded by 41 cycles during which the temperature was enhanced at each cycle, starting at 55°C and ending at 95°C. All PCR reactions revealed 1 well-defined melting-curve peak. Real-time data were analyzed using the Sequence Detection Systems software, version 2.2.1.11 Relative expression levels were normalized to GAPDH and calculated using the 2−ΔCt method.[39]

Statistical Analysis

Data were entered into Excel spreadsheets12 and statistical analysis was performed using Minitab 15.13 Basic descriptive statistics (mean, median, variance, standard deviation, interquartile range, confidence interval) were obtained. The age and BCS of the dogs were not normally distributed and a Mann-Whitney U test was used to compare dogs with and without CD or CHF. All other variables were normally distributed. Variables for leptin were log transformed to confer normality and parametric model assumptions. For normally distributed variables, a 1-way analysis of variance (ANOVA) test was used for analysis. Weight between groups and differences in leptin concentrations between sex, dogs with and without CD or CHF, heart failure stage, different regions of the heart and different CD groups were compared using a one-way ANOVA test. Results are displayed as range and median or mean and standard deviation as appropriate. The relationship between leptin and body weight and BCS was examined with scatter plots and then tested with the Pearson correlation test. Statistical significance was defined as P < .05.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

Cases

Blood samples of dogs without CD were taken from 7 Great Danes and 1 Boxer, which were presented for cardiac evaluation for the LUPA screening. Details of the dogs are presented in Table 1. The dogs were unremarkable on blood investigation and no abnormalities were detected on ECG and echocardiography.

Table 1. Age, sex, breed, disease, heart failure classification, body weight, and body condition score of control dogs (controls) and dogs with congestive heart failure (Congestive heart failure), from which blood samples were taken.
 ControlsCongestive Heart Failure
  1. ABCD, ABCD heart failure classification scheme; ARVC, arrhythmogenic right ventricular cardiomyopathy; AS, aortic stenosis; BCS, body condition score; BW, body weight; CKCS, Cavalier King Charles Spaniel; DCM, dilated cardiomyopathy; DVD, degenerative valvular disease; F, female; GSD, German Shepherd dog; M, male; MD, mitral dysplasia; y, years. Results are displayed in median and range or mean and standard deviation as appropriate.

Age (y)7 (7–9)8.5 (0.5–10)
Sex4 F 4 M2 F (1 spayed) 6 M (4 neutered)
BreedGreat Dane (n = 7), Boxer (n = 1)Boxer (n = 4), Bulldog, CKCS, Doberman, GSD (n = 1 each)
DiseaseDVD (n = 3), ARVC (n = 2), MD, AS/MD, DCM (n = 1 each)
Severity (ABCD)C3 (n = 8)
BW (kg)61 (±19.5)29 (±11.8)
BCS (/9)5 (3–6)4 (4–6)
Table 2. Age, sex, breed, disease, heart failure classification, body weight, and body condition score of control dogs (controls) and dogs with cardiac diseases (cardiac diseases), from which myocardial samples were taken.
 ControlsCardiac Diseases
  1. ABCD, ABCD heart failure classification scheme; Arrh C, arrhythmogenic cardiomyopathy; AS, aortic stenosis; BCS, body condition score; BW, body weight; DCM, dilated cardiomyopathy; DVD, degenerative valvular disease; F, female; GSD, German Shepherd dog; HSA, haemangiosarcoma; Hyperparath, secondary hyperparathyroidism; M, male; MD, mitral dysplasia; Panc carc, pancreatic carcinoma; PS, pulmonic stenosis; RTA, Road traffic accident; TD, tricuspid dysplasia; y, years. Results are displayed in median and range or mean and standard deviation as appropriate.

Age (y)7.75 (0.5–13)8.5 (0.2–14)
Sex5 F (4 spayed) 5 M (1 neutered)5 F (4 spayed) 5 M (1 neutered)
BreedCrossbreed (n = 2), GSD (n = 2), Border Collie, Boxer, Cocker, Dogues de Bordeaux, Labrador, Rottweiler (n = 1 each)Labrador (n = 3), Doberman (n = 2) Boxer, Bullmastiff, French Bulldog, Great Dane, GSD (n = 1 each)
DiseaseLymphoma (n = 4), brain tumor (n = 2), HSA, Panc carc, Hyperparath, RTA (n = 1 each)DCM (n = 4), AS, Arrh C, DVD, myocarditis, PS, TD (n = 1 each)
Severity (ABCD)B (n = 2), C3 (n = 3), D (n = 5)
BW (kg)27.4 (±11.6)33.4 (±18.5)
BCS (/9)4 (3–6)5 (2–7)

Details of dogs with CDs are presented in Table 1. Their median age was 8.5 years, which was similar to the dogs without CD (P = 0.34). The mean body weight was 29 kg, which was significantly less than the dogs without CD (P = 0.002). The median BCS was 4/9, which was not different from dogs without CD (P = 0.31). For 1 Boxer with severe aortic stenosis and mitral dysplasia, moderate muscle wasting was noted in clinical records.

Details of the dogs from which myocardial samples were collected are presented in Table 2. One Labrador had a spinal fracture after a road traffic accident (RTA). The diagnosis of suspected hemangiosarcoma in the German Shepherd dog (GSD) was not confirmed because aspirates or biopsies were not taken and no cardiac involvement was present on gross or histopathologic investigation. Unfortunately, the rest of the body was not available for post-mortem examination.

Dogs with CD had a median age of 8.5 years, which was similar to the dogs without CD (P = .47). The mean weight was 33.4 kg and the median BCS was 5/9. No significant difference was present in comparison to dogs without CDs (P = .39 and P = .15, respectively). For 1 Doberman with dilated cardiomyopathy (DCM) and 1 GSD with degenerative valvular disease (DVD), moderate and severe muscle loss was recorded, respectively.

Histopathology

No macroscopic or histopathologic evidence of CD was present in the dogs without clinical evidence of CD. However, 3 dogs with lymphoma (Border Collie, Dogues de Bordeaux, GSD) had intramyocardial lymphosarcoma. These dogs were not excluded from leptin analysis because there were no significant differences in leptin concentrations comparing dogs without CD with and without neoplastic myocardial infiltration (P = .64). The Labrador with spinal fracture after RTA showed lymphocytic myocarditis of unclear etiology.

The diagnosis of the dogs with DVD, DCM, pulmonic stenosis, and tricuspid dysplasia was confirmed on histopathology. The dog with arrhythmogenic cardiomyopathy had mild lymphocytic myocarditis of unclear underlying etiopathogenesis. The Boxer with aortic stenosis also had a chemodectoma and the French Bulldog showed marked pyogranulomatous subepicarditis and myocarditis of unclear etiology.

Leptin Results

Blood Samples.

Comparing leptin in blood samples of dogs with CHF and dogs without CD revealed significantly higher leptin concentrations in dogs with CHF (P = .013; Fig 1). No correlation was present between leptin concentrations and body weight (P = .23) or BCS (P = .56) for the control dogs. No statistically significant difference was present in leptin blood concentrations between female and male dogs without CD (P = .16).

image

Figure 1. Relative leptin expression in blood samples of dogs with congestive heart failure (CHF, n = 8) and without cardiac disease (C, n = 8). Significant higher concentrations of leptin were present in dogs with congestive heart failure (P = 0.013). Boxplot, the interquartile ranges are shown as boxes with the medians as lines. The range of values is represented by whiskers, outliers are displayed as stars.

Download figure to PowerPoint

Myocardial Samples.

Comparing leptin concentrations in control dogs, acquired, and congenital CDs, revealed significantly higher leptin concentrations in dogs with acquired CDs (P = .035) and lower concentrations in dogs with congenital CDs (P = .016) in comparison to control dogs. Comparing acquired and congenital CDs revealed significantly higher concentrations in dogs with acquired CDs (P < .001). Leptin concentrations were significantly higher in dogs with heart failure stage D in comparison to dogs in heart failure stage B and C3 (P = .031).

Comparing different regions of the heart there was a significant difference both in dogs with CD (P = .002) and without CD (P = .001). Higher leptin concentrations were present in the atria in comparison to the ventricles in dogs with CD (P = .005; Fig 2). Leptin concentrations in the atria (combining results of the left and right atria) were significantly higher in dogs with acquired CD in comparison to atrial samples of dogs without CD (P = .006). Differentiating results for the right and left atria, this difference was significant for right (P = .002) but not for left atrial samples (P = .2). Ventricular samples of dogs with congenital CDs (P = .006) and of male dogs with CDs (P = .041) revealed significantly lower leptin concentrations than did ventricular samples of control dogs and male controls, respectively. No correlation of leptin concentrations to BCS (P = .78) was present, but there was a trend for a positive correlation between leptin concentrations and body weight in control dogs (P = .06).

image

Figure 2. Relative leptin expression in different regions of the heart (interventricular septum: IVS, left atrium: LA, left ventricle: LV, right atrium: RA, right ventricle: RV) comparing acquired (Acq, n = 7), congenital cardiac diseases (Cong, n = 3) and controls (C, n = 10). Leptin concentrations were significantly higher in myocardial samples of dogs with acquired cardiac diseases (P = 0.035) and lower in dogs with congenital cardiac diseases (P = 0.016) in comparison to control dogs. Boxplot, the interquartile ranges are shown as boxes with the medians as lines. The range of values is represented by whiskers, outliers are displayed as stars.

Download figure to PowerPoint

Comparing female and male dogs with CDs, female dogs had significantly higher leptin concentrations (P = .001), whereas in the dogs without CD this difference was not present (P = .47).

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The results of this study showed significant increases of leptin mRNA expression in blood samples of dogs with CHF, differences in expression depending on CDs, and severity of disease, region of the heart, and possibly sex of the dog. There was no significant association with BCS, but a trend suggesting higher leptin concentrations with increased weight was present.

Increased concentrations of leptin in blood samples of dogs with decompensated CHF and myocardial samples of dogs with acquired CD and refractory heart failure were not surprising. Increased leptin concentrations were reported in human patients with heart failure and in animal models.[17, 19, 27] Because only single dogs in the present study showed evidence of cardiac cachexia, a reduction of leptin concentrations, which occurs in cardiac cachexia,[9, 29, 30] was not detected.

An increase of leptin blood concentrations is reported to correlate with heart failure class, exercise intolerance and is of prognostic value in people.[17, 24, 26] An association of blood leptin concentrations with heart failure stage was not possible in this study because the majority of dogs currently were in refractory CHF and no dogs with early disease were included. However, myocardial leptin expression showed a correlation to heart failure classification with significantly higher leptin concentrations in dogs in heart failure stage D, which is similar to results reported in human medicine.[17, 26, 27] Unfortunately, no blood samples were taken from the dogs with myocardial samples that were euthanized or died because of their disease. Therefore, the role of leptin as a prognostic marker is not known and needs further investigation.

The heart, as well as adipocytes, have been discovered to produce leptin,[19] and leptin mRNA expression was present in myocardial samples of all dogs in this study. Interestingly, we identified differences in leptin expression between congenital and acquired CD. Dogs with congenital CD showed significantly lower leptin expression whereas dogs with acquired CD had significantly higher leptin concentrations than dogs without CDs. Because the control dogs had severe neoplastic or systemic diseases, activation of the inflammatory system in these dogs is likely, which might have caused an increase of leptin concentrations.[10, 11, 13, 15, 16] Even if myocardial leptin expression was detected and in most cases no neoplastic myocardial infiltration was present, an increase of myocardial leptin expression in cancer patients without myocardial infiltration is possible. The lower concentrations in the dogs with congenital CDs therefore might suggest a baseline expression in dogs without decompensated CD, and 2 of these dogs were in heart failure stage B, with minor or no activation of the inflammatory system and normal energy homeostasis.[4, 26, 27]

The significant increase of leptin in dogs with acquired CDs is consistent with high leptin concentrations in CHF with most of these dogs being in heart failure stage D.[26, 27] This finding indicates activation of the inflammatory system and increased metabolic rate. Because there was no difference in BCS and age between dogs, end-stage, decompensated CD was the most likely cause of the increased leptin concentrations in these dogs.

Central leptin effects cause increased sympathetic activity, which contributes to the neurohumoral activation in heart failure.[31] Metabolic effects include increased energy expenditure, impaired fatty acid oxidation, and decreased energy storage and, together with the proinflammatory activity, involvement in cardiac remodeling and prohypertrophic effect, leptin attenuates cardiac contractility and might contribute to progression of CD and CHF.[8, 12, 13, 17, 18, 24, 25, 32, 33, 40] Enhanced leptin may, therefore, indicate progressive or decompensated CD with sympathomimetic activation and inflammatory reaction.[17, 24, 25]

Differences in leptin concentrations among cardiac regions were present in female dogs with and without CD, and for male dogs with CD. Both sexes showed an increase of leptin mRNA in the right atria of dogs with CD, and in male dogs a reduction of ventricular leptin mRNA occurred. Sex-dependent regional cardiac leptin expression was also detected in female and male mice with an increase of leptin mRNA in the right atrium of female mice and a reduction of leptin in the ventricular myocardium induced by ischemia with a more prominent down-regulation in male animals.[19] The increase in right atrial samples might be consistent with increased collagen and matrix metalloproteinase expression suggesting atrial remodeling in advanced CD, which has been reported previously.[33, 41] The reduction in ventricular samples of male dogs may suggest differences in atrial and ventricular cardiac remodeling.[41] However, the relevance of the down-regulation is uncertain. Leptin might contribute to myocardial hypertrophy and dysfunction[20, 33, 42] and reduced myocardial leptin expression might indicate an adaptive and protective mechanism under myocardial ischemic conditions,[19] which was very likely present in dogs with end-stage CD. Furthermore, reduced leptin concentrations indicate that immunosuppression[12] and control of the inflammatory reaction associated with CHF might be present in male dogs. However, the role of leptin in cardiac remodeling, its association with the immune system and progression of canine CD requires further investigations.

Purdham et al. reported higher leptin gene abundance in myocardial tissue of female rats,[19] which is similar to results detected in this study, where female dogs with CD had increased myocardial leptin expression in comparison to male dogs. The increased leptin expression in female dogs might be associated with an increased fat content of these dogs, because most of the female dogs were neutered whereas the male dogs were intact.[43] In people, higher leptin concentrations are reported in women,[7] attributed to a higher body fat content.[7, 25, 44] Because leptin is derived primarily from adipocytes,[5, 6] a correlation between body weight and leptin plasma concentrations was suspected for dogs and cats.[44-47]

The reduction of leptin in ventricular samples of male dogs might be associated with lower body fat content.[43] However, there was no difference in BCS between male and female dogs, and increased leptin concentrations were not present in female dogs without CD. There was also no higher incidence of cardiac cachexia in male dogs, which might be associated with decreased leptin concentrations.[29, 30] Furthermore, if body fat content would have had an influence on myocardial leptin expression in male dogs, an effect on atrial and not just ventricular leptin expression would have been expected. Unfortunately, the effect of muscle loss on leptin expression could not be investigated in the present study. Only single dogs with marked muscle wasting had documentation of muscle loss in their clinical records. Minor muscle loss in other dogs might have been present, but muscle condition score was not routinely obtained so that a correlation to leptin concentrations was not possible. In dogs, no effect of sex and breed on leptin concentrations was detected.[48] However, the increase with increased body weight is of interest, and larger numbers of dogs are needed to assess the effect of sex and neutering on leptin concentrations.

There are several limitations of this study. The small number of dogs investigated limited the power of statistical analysis and precluded multivariable analysis. The absence of a routinely documented muscle condition score in the dogs of this study is a major limitation. Only marked muscle loss was noted and mild muscle wasting might have been missed. Therefore, a correlation of muscle loss and leptin expression, which might be important in development of cardiac cachexia,[28-30] could not be investigated.

The control dogs from which blood samples were taken were significantly larger than the dogs with CD and leptin concentrations might be different depending on sizes of dogs. However, no breed differences have been reported.[48] A cardiac evaluation, including echocardiography, was performed in these dogs; however, a 24 hour-ECG and abdominal ultrasound investigation was not performed, and intermittent arrhythmias or systemic diseases not resulting in clinical signs or hematologic abnormalities might have been missed. Only mRNA expression in blood samples was investigated in this part of the study, which might be different from myocardial mRNA and protein expression, and necropsies were not performed.

The control group of dogs, from which myocardial samples were taken, was mainly of oncology cases and an association between leptin concentrations and systemic inflammatory diseases and cancer progression is suspected in human medicine and increased leptin concentrations in neoplastic tissue have been reported.[11, 16, 49] A group of dogs without disease would have been preferable, but was unfortunately not available. No cardiac evaluation was obtained in these control dogs, so minor CDs and arrhythmias cannot be excluded completely. However, gross pathology and histopathology did not reveal evidence of CD.

The group of dogs with CD included CDs of wide heterogeneity. The numbers were too small to separate different diseases or investigate the effect of sex on leptin in acquired and congenital CDs. The difference in leptin expression in acquired and congenital CD is of interest and demonstrates the need for further investigations of leptin expression in CDs. Unfortunately, blood samples from dogs in which myocardial samples were taken were not available, so that a correlation of blood and myocardial leptin concentrations was not possible.

Despite careful selection and preparation of myocardial samples, contamination of the sample with minor amounts of epicardial fat cannot be excluded completely. However, because fat contamination was more likely with atrial samples and there was no increased atrial leptin expression in the controls, it seems unlikely that the results are caused by fat contamination of the samples.

Further investigations are needed to assess the effect of weight, and especially cachexia, on leptin concentrations in CD and the relevance of sex and regional dependent expression. Furthermore, long-term studies are needed to investigate the use of leptin as prognostic indicator.

To the authors’ knowledge, myocardial leptin expression in dogs has not been previously reported. The preliminary results of this study showed increased leptin blood concentrations in dogs with CHF, increased myocardial expression in dogs with decompensated acquired CDs, differences depending on the type and severity of CD, and possibly sex-dependent myocardial leptin expression. These results indicate that leptin might play a role in canine CD.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References

The authors thank Simon Swift for referring 2 of the dogs with dilated cardiomyopathy. We also thank all owners participating in this study, all clinicians involved in investigation and treatment of these animals, the referring veterinarians, and all staff and students in the Small Animal Teaching Hospital, University of Liverpool.

  1. 1

    RNAlater™, Ambion Ltd, Huntingdon, Cambridgeshire, UK

  2. 2

    Ambion blood kit, Ambion Ltd

  3. 3

    RNA minikit, Qiagen Ltd, Crawley, UK

  4. 4

    Proteinase K, Qiagen Ltd

  5. 5

    RNase-Free DNase Set, Qiagen Ltd

  6. 6

    Spectrophotometer, GeneQuant II NanoDrop Technologies, Wilmington, DE

  7. 7

    Hexamer oligonucleotides, Promega, Southampton, UK

  8. 8

    Primer Express, Applied Biosystems, Warrington, UK

  9. 9

    ABI 7700 Sequence Detector, Applied Biosystems

  10. 10

    SYBR Green PCR mastermix, Applied Biosystems

  11. 11

    Sequence Detection Systems software, version 2.2.1, Applied Biosystems

  12. 12

    Excel spreadsheets, Microsoft Corporation, Reading, Berkshire, UK

  13. 13

    Minitab 15, Minitab Inc, State College, PA

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. References