• Open Access

Evaluation of Polymorphisms in the Sulfonamide Detoxification Genes CYB5A and CYB5R3 in Dogs with Sulfonamide Hypersensitivity

Authors


  • Preliminary data from this manuscript were presented in abstract form at the 17th biennial the American Academy of Veterinary Pharmacology and Therapeutics, 2011, in Madison, WI

Corresponding author: J. Sacco, B. Pharm, PhD, Department of Medical Sciences, School of Veterinary Medicine, University of Wisconsin-Madison, 2015 Linden Drive, Madison, WI 53706-1102; e-mail: saccoj@svm.vetmed.wisc.edu.

Abstract

Background

Delayed hypersensitivity (HS) reactions to potentiated sulfonamide antimicrobials occur in both dogs and humans, and involve an intermediate hydroxylamine metabolite that is detoxified by cytochrome b5 and NADH cytochrome b5 reductase.

Hypothesis/Objectives

We hypothesized that polymorphisms in the genes (CYB5A and CYB5R3) encoding these 2 enzymes would be associated with risk of sulfonamide HS in dogs.

Animals

A total of 18 dogs with delayed HS to potentiated sulfonamide antimicrobials and 16 dogs that tolerated (TOL) a therapeutic course of these drugs without adverse effect.

Methods

CYB5A and CYB5R3 were sequenced from canine liver, and the promoter, exons, and 3′ untranslated regions of both genes were resequenced from genomic DNA obtained from all dogs.

Results

Multiple polymorphisms were found in both genes. When controlled for multiple comparisons, the 729GG variant in CYB5R3 was significantly overrepresented in dogs with sulfonamide HS (78% of dogs), compared to TOL dogs (31%; P = .003).

Conclusions and Clinical Importance

The CYB5R3 729GG variant may contribute to the risk of sulfonamide HS in dogs. Functional characterization of this polymorphism, as well as genotyping in a larger number of HS and TOL dogs, is warranted.

Abbreviations
3′UTR

3′untranslated region

b5

cytochrome b5

b5R

cytochrome b5 reductase

DMSO

dimethylsulfoxide

HRP

horseradish peroxidase

HS

hypersensitive

PCR

polymerase chain reaction

SMX

sulfamethoxazole

TOL

tolerant

VNTR

variable number tandem repeat

Idiosyncratic toxicity from potentiated sulfonamide antimicrobials (sulfonamide hypersensitivity) occurs in both dogs and humans, with considerable clinical similarities. Sulfonamide hypersensitivity in dogs may include fever, skin eruptions, blood dyscrasias, hepatopathy, arthropathy, or protein-losing nephropathy.[1, 2] These reactions develop an average of 12 days after initiation of sulfonamide treatment, with an observed range of 5–36 days.[2] Some breeds of dogs, notably Doberman Pinschers, appear to be at higher risk for sulfonamide hypersensitivity,[3] although the overall incidence in this breed and in the general dog population is unclear.

In humans, sulfonamide hypersensitivity is mediated by reactive oxidative metabolites that haptenize proteins and elicit a T-cell-mediated immune response.[4-6] One major pathway for detoxification of sulfonamide antimicrobials in humans is N-acetylation (Fig 1),[7] and impaired N-acetylation activity appears to be a risk factor for sulfonamide hypersensitivity in human patients.[8, 9] Dogs lack N-acetyltransferase genes, and so cannot detoxify sulfonamides via N-acetylation.[10] Although defective N-acetylation may put dogs as a species at greater risk for sulfonamide hypersensitivity, this defect does not explain individual risk among dogs.

Figure 1.

Biotransformation of sulfamethoxazole (SMX) and other sulfonamide antimicrobials in humans. The N- and O-acetylation reactions, which represent detoxification pathways in humans, are absent in dogs due to a lack of NAT genes.[10] Reduction of sulfamethoxazole hydroxylamine (SMX-HA) by cytochrome b5 (CYB5A) and cytochrome b5 reductase (CYB5R3) is a detoxification pathway present in both humans and dogs, which opposes generation of the immunogenic sulfamethoxazole nitroso metabolite (SMX-NO).

Another pathway for sulfonamide detoxification is reduction of the reactive sulfonamide hydroxylamine metabolite (Fig 1) by cytochrome b5 and NADH cytochrome b5 reductase.[11] This activity is present in both humans and dogs, with activity in dogs being 3–5-fold higher than that seen in humans.[12] We hypothesized that genetic variants in this detoxification pathway might be overrepresented in dogs with sulfonamide hypersensitivity. The purpose of this study, therefore, was to sequence the canine orthologs of the genes encoding cytochrome b5 (CYB5A) and NADH cytochrome b5 reductase (CYB5R3); screen the predicted promoter, exonic, and 3′ untranslated regions (UTR) of both genes for polymorphisms in a group of dogs with sulfonamide hypersensitivity; and compare the prevalence of variants in these genes to a control group of dogs tolerant of a therapeutic course of sulfonamide antimicrobials.

Materials and Methods

cDNA Sequencing of the Canine Orthologs of CYB5A and CYB5R3

To verify hepatic expression of the canine orthologs of CYB5A and CYB5R3, mRNA was isolated from liver archived from 2 purpose-bred Hound dogs, using 75 mg of liver and a commercial kit,1 followed by DNase I treatment. Gel electrophoresis and UV spectrophotometry were performed to verify the quality and quantity of RNA. Total liver cDNA was generated from RNA using random decamer primers.2

cDNA for the canine ortholog of human CYB5A was amplified from total liver cDNA by polymerase chain reaction (PCR), using primers designed to the predicted RNA sequence of canine CYB5A (NCBI accession XM_533373), and spanning the predicted protein coding sequence (see Supplemental Table S1). PCR conditions were as follows: 94°C for 2 minutes, 35 cycles of (94°C for 20 seconds, 57°C for 30 seconds, and 72°C for 45 seconds), and a final extension at 72°C for 7 minutes. Amplicons were visualized on a 1% agarose gel, and were sequenced using the BigDye method,3 with the original forward and reverse PCR primers.

Canine CYB5R3 cDNA was amplified by PCR using 2 overlapping pairs of primers (Supplemental Table S1), designed to the published canine microsomal CYB5R3 mRNA sequence.[13] PCR was performed under the following conditions: 94°C for 2 minutes, 40 cycles of (94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 60 seconds), and a final extension at 72°C for 7 minutes. Verification of amplicon size and subsequent cDNA sequencing was performed as for CYB5A. Due to the short 5′ UTR of canine CYB5R3 (NCBI accession NM_001048084), amplification of the entire coding sequence was problematic. Therefore, to sequence the 5′UTR and the first 100 base pairs of the CYB5R3 coding sequence, 5′ RACE was performed4 from 10 μg of total RNA from canine liver. Reverse transcription then was performed, followed by cDNA amplification with nested, gene-specific primers for CYB5R3 (Supplemental Table S1) using a touchdown protocol, with an initial denaturing step of 94°C for 3 minutes and 2 cycles of (94°C for 30 seconds, 70°C 30 seconds, and 72°C for 30 seconds). This was followed by 2°C decrements in annealing temperature for 2 cycles each, until a final annealing temperature of 58°C was held for a total of 40 cycles, with a final extension time of 7 minutes. 12% dimethylsulfoxide (DMSO) was added to each amplification reaction to enhance product formation. The 2 PCR amplicons (700 bp) were visualized on a 1% agarose gel and gel-extracted for Big Dye sequencing, using a commercial clean-up kit.5 Sequences were analyzed by alignment with the canine genome (using the BLAT tool available at www.genome.ucsc.edu) and, in the case of CYB5R3, with the reference mRNA sequence (NM_001048084).

Cytochrome b5 and NADH Cytochrome b5 Reductase Protein Expression in Canine Liver

Immunoblotting of canine liver microsomes was performed to confirm hepatic expression of cytochrome b5 (b5) and NADH cytochrome b5 reductase (b5R) proteins in the dog. Microsomes were isolated from purpose-bred Hound canine livers using ultracentrifugation, and were electrophoresed in polyacrylamide and transferred to nitrocellulose membranes. Pooled human liver microsomes (40 μg)6 were loaded as a positive control. Membranes were blocked in 5% BSA7 for 1 hour, washed 3 times in 0.1% PBS-Tween, and then incubated with polyclonal rabbit anti-human b5 antibody (1 : 10,000 in 1% milk) overnight at 4°C,[11] followed by horseradish peroxidase (HRP)-conjugated rabbit anti-IgG8 (1 : 10,000 in 1% milk) for 1 hour at 4°C. Protein bands were detected by chemiluminescence.9 For detection of b5R, blots were probed with polyclonal rabbit-anti-human b5R antibody (1 : 35,000 in 1% milk)[11] under the same conditions as for b5 immunoblotting. β-actin was used as a loading control for both b5 and b5R; membranes were incubated with anti-mouse β-actin monoclonal antibody conjugated with HRP10 (1 : 5,000). Because of similar sizes for β-actin and b5R, membranes were probed in the following order: β-actin, b5 protein, and then membranes were stripped with the Restore Plus Western Blot Stripping Buffer, followed by b5R detection.

Sulfonamide-Treated Dogs Recruited for CYB5A and CYB5R3 Resequencing

Whole blood samples (3-6 mL in EDTA or heparin) or buccal mucosal swabs from pet dogs that were treated with potentiated sulfonamide antimicrobials were collected between 1995 and 2011. Most dogs were patients at the School of Veterinary Medicine, University of Wisconsin-Madison or the College of Veterinary Medicine, Cornell University. Additional blood samples were obtained from dogs treated at private veterinary practices across the United States by referral consultation with one of the authors (LT).

All pet dogs were treated with a therapeutic course (minimum of 7 days) of trimethoprim-sulfamethoxazole (SMX), trimethoprim-sulfadiazine or ormetoprim-sulfadimethoxine for documented or suspected infection. Dogs were assigned to the sulfonamide hypersensitive group (HS) if clinical signs of fever, polyarthopathy, skin eruptions, hepatotoxicity or blood dyscrasias developed 5 or more days after starting potentiated sulfonamide treatment, without other clinical explanation. Rechallenge with the drug was not performed, but medical records were reviewed, and eligible dogs required a score of ≥5 (probable reaction) on the Naranjo Adverse Drug Reaction Scale to be considered HS.[14] Dogs were assigned to the tolerant group (TOL) if they completed a therapeutic course of potentiated sulfonamides (typically 14-21 days) without any adverse clinical signs.

Amplification of Canine CYB5A and CYB5R3 from Individual Genomic DNA Samples

Genomic DNA was isolated from 200 μL of whole blood,11 or from buccal mucosal swabs,12 using commercial kits. DNA concentration and relative purity were determined by spectrophotometry. For canine CYB5A, PCR was used to amplify the predicted promoter region (to −673 bp from the ATG), 5 exons with splice junctions, and the 3′UTR region (334 bp), and for CYB5R3, the predicted promoter region (to −671 bp from the ATG), 9 exons with splice junctions, and the 3′UTR (1020 bp). Promoter regions were predicted using commercial software.13 Primers (Supplemental Table S1) were designed using the published canine genome sequence (CanFam2.0), except for the promoter and exon 1 region of CYB5R3, which are found in a 445 bp gap in the published dog sequence, located at chr10:25884013-25884562.

Cycling conditions for most amplicons were as follows: initial denaturation at 95°C for 2 minutes, followed by 40 cycles of 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 30 seconds with a final extension time of 5 minutes. Primer pairs for exons 3, 4, and exon 9 for CYB5R3 had a longer extension time for each cycle (72°C for 60 seconds) due to large amplicon length. Amplification of the CYB5A promoter, CYB5R3 promoter, and CYB5R3 exon 1 regions, which have high GC content, required the inclusion of a hot start DNA polymerase,14 and deaza-GTP15 in the reaction mix, as well as an initial denaturation step of 5 minutes at 95°C to ensure efficient amplification. Successful amplification was verified by visualization in a 1% agarose gel. PCR products then were sequenced by dye-terminator sequencing using the forward and reverse PCR primers, as for hepatic cDNA products. Sequence alignment and polymorphism screening were carried out using the Staden Package software (available at http://www.staden.sourceforge.net/). Electropherograms with novel polymorphisms were visually inspected for adequate resolution and minimal noise; these samples also were reamplified and re-sequenced for confirmation.

In Silico Predictions of Function

The potential effects of promoter polymorphisms on function were predicted by 2 software tools, MatInspector,16 which locates transcription factor binding sites, and ModelInspector,16 which scans for promoter modules that have been experimentally shown to exhibit cooperative or synergistic function.[15] The potential effect of coding polymorphisms on mRNA stability was investigated using M-Fold software, a tool for predicting the secondary structure of RNA using thermodynamic methods.[16] Analysis of the potential relevance of polymorphic repeats was carried out using a Tandem Repeats Finder Program.[17]

Follow-Up Liver Phenotyping for Polymorphisms of Interest

Investigation of possible phenotypic effects of 1 polymorphism of interest was carried out using a group of livers from 23 healthy mixed breed dogs. Dog CYB5R3 cDNA, obtained via reverse transcription of total liver RNA,17 was resequenced for each liver to determine genotype at the position of interest. The expression of CYB5R3 was then determined for each individual at the mRNA and protein levels. Immunoblotting for b5R expression in individual canine livers was performed as described above, and was quantitated using densitometry. qPCR for CYB5R3 was performed for each canine liver cDNA,18 with reaction conditions as follows: 1 ng cDNA, 12.5 μL Power SYBR Green PCR master mix,19 0.25 μL Uracil N-glycosylase,19 and 300 nM of both primers in a total volume of 25 μL (forward primer: GAACATTCTGCTCGCTTCAAG, reverse primer: ACACATCAGTATCAGCGGC). The reactions were amplified with an initial 2-minute run at 50°C, followed by 95°C for 10 minutes and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Melting curve analysis was performed to detect any nonspecific products. Data were analyzed using the comparative CT (ΔCT) method, with canine β-actin (ACTB) as the reference gene.

Statistical Analyses

Because of the small control population, the reference allele for each polymorphism was designated as the nucleotide that was conserved across multiple mammalian species. ClustalW analysis[18] was used for multiple sequence alignment to compare canine CYB5A and CYB5R3 mRNA from this study with the published dog genome, as well as with homologous nucleotide sequences from 24 mammals, including all those in the superorder Laurasiatheria (which includes the order Carnivora) for which genomic sequencing data were available. The required phylogenetic analyses were performed using multiple vertebrate genome alignment software (PHAST package, available at www.genomeucsc.edu). For polymorphisms located in noncoding regions that were highly variable among mammalian species, the reference allele was designated arbitrarily as that most prevalent in the control (sulfonamide-tolerant) dogs used in this study.

Two-sided Fisher's exact tests were used to test for associations between genotype and hypersensitivity outcome. Polymorphisms found in fewer than 3 dogs were excluded from analyses. To control for multiple comparisons, permutation testing was performed to find a P-value cutoff that corresponded to a family wise error rate of .05. 10,000 randomized datasets were generated (randomizing hypersensitivity status), and the analysis was repeated for each variant to generate a distribution of P-values expected by chance alone. From this empirical distribution, a cut-off for significance of .0049 was calculated, which corresponds to an overall (family wise) false positive rate of .05. Association analyses were performed in Statav11 (www.stata.com). Median age and dosage of potentiated sulfonamides were compared between HS and TOL dogs using a Mann–Whitney test.

Results

Full-length cDNAs for canine CYB5A and CYB5R3 were successfully amplified from canine liver, with nucleotide homologies to the human orthologs of 87% for CYB5A (Fig 2) and 90% for CYB5R3, and predicted amino acid homologies of 90 and 92%, respectively. The canine CYB5R3 nucleotide coding sequence was identical to that reported previously (data not shown).[13] Both b5 and b5R proteins were readily detected in canine liver microsomes by immunoblotting (Fig 3).

Figure 2.

Sequence alignment of the coding regions for hepatic canine and human microsomal CYB5A, using ClustalW.[18]

Figure 3.

Immunoreactive b5 and b5R protein expression in canine liver microsomes. Lanes 1-4: Four individual healthy mixed breed hound dogs; Lane 6: human liver microsomes. 40 μg of protein loaded in each lane.

Genomic DNA of adequate quality and complete clinical histories were available from 18 HS dogs and 16 TOL dogs. The 2 groups of dogs consisted of various breeds and did not differ significantly with regard to dosage of potentiated sulfonamides or age at the time of treatment (Table 1). Although 78% of HS dogs were female, compared to 50% of TOL dogs, a test comparing sex frequencies in each group did not reach statistical significance (P = .15).

Table 1. Characteristics of 18 dogs with a clinical diagnosis of sulfonamide hypersensitivity and 16 dogs tolerant of a therapeutic course of potentiated sulfonamides
Hypersensitive (n = 18)Tolerant (n = 16)
  1. a

    Dosage is given as the total dose in combination with ormetoprim or trimethoprim.

  2. b

    Many dogs had more than 1 clinical sign.

  3. c

    Three dogs, including the dog initially treated for 7 days, we re-treated with potentiated sulfonamides for 10-30 days on at least 1 additional occasion, without adverse effect.

Median age

at dosing

(range)

5.0 years

(0.5–14 years)

3.0 years

(0.3-12 years)

Sex13 FS6 FS
1 FI2 FI
2 MN6 MN
2 MI2 MI
Dosagea

44.2 mg/kg/day

(25.4–68.4)

39.5 mg/kg/day

(29.8-57.1)

Breed numbers

Labrador

Retriever/cross (6)

Golden

Retriever (4)

Samoyed (2)

German

Shepherd/cross (2)

Doberman,

Dalmatian,

Malamute,

Springer

Spaniel (1 each)

Labrador

Retriever/cross (4)

Boxer (2)

Australian Shepherd,

Bernese

Mountain Dog,

Brittany Spaniel,

Cocker Spaniel,

Doberman,

Golden Retriever,

mixed breed,

Poodle, Shih Tzu,

Shar Pei (1 each)

Duration

of treatment

5–36 days7–30 daysc

Adverse

eventb

Thrombocytopenia

n = 10 (53%)

NA

Hepatotoxicity

n = 9 (47%)

Neutropenia

n = 4 (21%)

Hemolytic

anemia

n = 3 (16%)

Arthropathy

n = 2 (11%)

Erythema

multiforme

n = 1 (5%)

For CYB5A, 10 single nucleotide polymorphisms (SNPs) were identified in the promoter region (Fig 4). Of these, 3 promoter SNPs were present in predicted transcription factor binding sites. We also identified a variable number tandem repeat (VNTR) polymorphism (GCCCCGCCCCC) in the canine CYB5A promoter (Fig 4), which was present in 16 dogs. Eight dogs had 2 adjacent VNTR repeats (23 bp), whereas 8 dogs had 3 adjacent repeats (34 bp). Insertion of these multiple VNTRs was predicted, using MatInspector and ModelInspector, to result in the incremental increase of available binding sites for Krueppel-like transcription factors (KLF), specific protein (GC-box factor) Sp1, and early growth response factors (EGR), as well as the introduction of a novel binding site for myogenic regulatory factor (MYOD). No SNPs were found in the coding region of CYB5A in the genotyped dogs. One SNP was found in the 3′ UTR, and 4 intronic SNPs were located near splice junctions. None of these variants differed in allele frequency between HS and TOL groups (Supplemental Table S2).

Figure 4.

Gene structure of canine CYB5A and CYB5R3, and genetic polymorphisms found in the promoter, exonic, flanking intronic, and 3′ untranslated (UTR) regions of both genes in 34 dogs. Genes are shown 5′ to 3′. Solid black boxes represent coding exons, and grey boxes represent noncoding portions of exons, either proximal to the start codon or in the 3′ UTR.

For CYB5R3 genotyping, we first had to fill the current 445 bp gap at the CYB5R3 exon 1 locus in the current version of the dog genome (http://genome.ucsc.edu). The start codon in exon 1 was found to be 250 bp downstream of the 5′ end of the gap, whereas the end of exon 1 was located 174 bp upstream of the 3' end of the gap. The proximal promoter region of canine CYB5R3 (to 300 bp upstream of exon 1) was 64% identical to the comparable human sequence, with only 4 SNPs identified among dogs (Fig 4); 3 of these were predicted by MatInspector and ModelInspector to be in transcription factor binding sites. In addition, 6 synonymous coding and 19 intronic SNPs were found in the amplified exons and flanking regions of CYB5R3, along with a 10 base pair deletion 196 bp downstream of exon 1. An additional 8 SNPs were found in the canine CYB5R3 3'UTR (Fig 4). Of these variants, the synonymous coding SNP, 729A>G, located in exon 8 of CYB5R3, was overrepresented in HS dogs (P = .008; Supplemental Table S3). Fourteen of the 18 HS dogs (78%) were homozygous for the G allele at this position, whereas only 5 of the 16 TOL dogs (31%) had the 729 GG genotype (P = .003; Fig 5). Comparative genomic analysis of the CYB5R3 gene in other mammalian species indicated that a G in this position is not found in other species (data not shown). Although this synonymous SNP should not affect amino acid sequence, calculations of mRNA secondary structure, using M-fold, predicted that 729A>G would result in a conformational change in canine CYB5R3 mRNA and the formation of a more stable stacked loop (data not shown).

Figure 5.

Genotype frequencies for the CYB5R3 729G>A coding single nucleotide polymorphism in sulfonamide hypersensitive (HS) and tolerant (TOL) dogs. *P = .003.

To further investigate the possible phenotypic effects of the 729G allele, we resequenced the CYB5R3 729 locus in an additional group of 23 healthy Hound dogs for which liver tissue was available. Two dogs were 729GG homozygotes, 13 had an AG genotype, and 8 were homozygous AA. When we evaluated hepatic expression of CYB5R3 mRNA and b5 protein, a higher message level was found, but lower protein expression, in the GG livers (Fig 6A,B), but numbers were small, and this finding requires additional evaluation.

Figure 6.

Expression of CYB5R3 message and cytochrome b 5 reductase (b5R) protein in livers from 23 healthy mixed breed dogs with different CYB5R3 genotypes at the 729 locus (GG: n = 2; GA: n = 13; AA: n = 8). (A) CYB5R3 mRNA expression by qPCR, expressed as ΔCT relative to β-actin. (B) b5R protein expression, normalized to β-actin.

Discussion

Sulfamethoxazole is oxidized in the liver to its hydroxylamine metabolite in both humans and dogs.[12] The hydroxylamine metabolite can be found in plasma and urine, but spontaneously oxidizes over time to sulfamethoxazole nitroso, an unstable reactive metabolite that forms adducts within keratinocytes and other target cells. This leads to hapten formation, T-cell recognition of the drug, and a cell-mediated immune response that result in the clinical syndrome of drug hypersensitivity.[19] Sulfamethoxazole-hydroxylamine can be reduced back to the parent SMX, which is not immunogenic, by b5 and b5R.[11] We have found substantial pharmacogenetic variability in this pathway in humans, including several polymorphisms in CYB5A and CYB5R3 associated with low sulfamethoxazole reduction activity.[20, 21] We therefore hypothesized that polymorphisms in these 2 genes might also be present in dogs, and that low functioning alleles of these detoxification genes might be overrepresented in dogs with sulfonamide hypersensitivity, compared to dogs tolerant of a therapeutic course of potentiated sulfonamides.

We first amplified the cDNAs for the canine microsomal forms of both CYB5A and CYB5R3 in normal canine liver, and confirmed their hepatic expression by immunoblotting. Although the full-length mRNA for canine CYB5R3 had already been cloned,[13] the canine CYB5A transcript had only been predicted based on the canine genome (NCBI accession XM_533373), and expression in liver had not been evaluated. The predicted amino acid sequences of the canine genes were highly homologous to the human CYB5A (90%) and CYB5R3 (92%) proteins, which is similar to that shown for canine CYB5R3 by a previous group (92.7% homology to human).[13]

Both genes displayed considerable genetic variability even in this small population of dogs. Of note, 23 bp- and 34 bp-VNTR insertion polymorphisms in the CYB5A promoter were found in a number of dogs. These multiple VNTRs were predicted to result in a novel binding site for the transcription factor MYOD, and an incremental increase of available binding sites for KLF, EGR, and Sp1 transcription factors. Sp transcription factors are known inducers of human CYB5A expression,[22] so it is possible that this VNTR has functional relevance. Promoter VNTRs have been shown to affect the expression of several human genes,[23, 24] and VNTRs in the canine DRD4 gene have been associated with behavioral phenotypes in German Shepherds.[25] Although we found no association between these VNTRs and sulfonamide hypersensitivity in the dogs in this study, the functional consequences of these VNTRs merit additional study.

The CYB5R3 729GG genotype was significantly overrepresented in 78% of sulfonamide HS dogs, compared to 31% of TOL dogs. This G variant was not conserved in other mammalian species, and calculations of mRNA folding predicted that this SNP would result in a conformational change in CYB5R3 mRNA. Because liver tissue was not available from the HS and TOL dogs, we resequenced CYB5R3 in a group of healthy canine livers (all mixed breed dogs) to identify 729GG livers for expression analyses. Although we had too few samples to perform statistical analyses, CYB5R3 message level was higher in the 729GG livers. This finding would be consistent with M-fold predictions for higher message stability with the 729GG variant. However, protein expression trended lower in GG versus AA livers in these preliminary experiments. Nonsynonymous SNPs in other genes have been reported to enhance mRNA stability and decrease protein translation, protein expression, and enzyme activity.[26] Therefore, the effects of 729GG on b5R expression merit further evaluation both in vitro and in a larger number of canine livers.

Limitations to this study include the small number of dogs genotyped, and our inability to evaluate expression in the actual livers of the patients given potentiated sulfonamides. We plan to continue genotyping dogs with sulfonamide hypersensitivity for CYB5R3 729GG, to determine whether the significant association found in this study is confirmed in a larger population, followed by functional characterization of the effects of 729GG on b5R expression in vitro.

Although we focused on the b5/b5R detoxification pathway in this study, other genetic factors are likely to contribute to sulfonamide HS in dogs. In humans, CYP2C9 generates the reactive hydroxylamine metabolite.[27] This pathway also is present in dogs,[12] but the specific CYP involved has not been characterized. A high activity variant of this CYP could contribute to the risk of sulfonamide HS, although this has not been the case for CYP2C9 in humans.[28, 29] Other possible pathways include glutathione-S-transferases, which could play a minor role in SMX metabolite detoxification[30] or variability in myeloperoxidases (which also can generate SMX-hydroxylamine in both humans and dogs).[31] A specific HLA haplotype has been associated with sulfamethoxazole fixed drug eruptions in Turkish patients,[32] therefore, polymorphisms in the DLA gene complex[33] also could contribute to sulfonamide HS in dogs, and this requires additional evaluation.

The CYB5R3 729GG genotype was significantly overrepresented in dogs with sulfonamide HS, and may contribute to the risk of potentiated sulfonamide hypersensitivity. Additional work is needed to confirm this finding and characterize the functional relevance of this variant, as well as to explore potential interactions with other candidate genes, such as DLA alleles.

Acknowledgments

The authors thank Nicole van Abel, DVM for assistance with resequencing experiments.

This work was supported in part by R01GM61753 from the National Institute of General Medical Sciences, National Institutes of Health.

Footnotes

  1. 1

    RNAqueous-4PCR kit, Ambion, Austin, TX

  2. 2

    Retroscript kit, Ambion

  3. 3

    BigDye Terminator v3.1 reagents, Applied Biosystems, Foster City, CA

  4. 4

    FirstChoice RNA-Ligase Mediated-RACE kit, Ambion

  5. 5

    Wizard SV Gel and PCR Clean-Up System, Promega, Madison, WI

  6. 6

    BD Biosciences, Franklin Lakes, NJ

  7. 7

    Sigma-Aldrich, St. Louis, MO

  8. 8

    Jackson Immunoresearch Laboratories, West Grove, PA

  9. 9

    Pierce ECL Western Blotting Substrate, Thermo Fisher Scientific Inc, Rockford, IL

  10. 10

    Abcam, Cambridge, MA

  11. 11

    DNeasy Blood and Tissue kit, QIAGEN, Valencia, CA

  12. 12

    Oragene® ANIMAL kits, DNA Genotek, Ontario, Canada

  13. 13

    PromoterInspector, Genomatix Software GmbH, Munich, Germany

  14. 14

    Promega

  15. 15

    Roche NimbleGen, Inc, Madison, WI

  16. 16

    MatInspector and ModelInspector, Genomatix Software GmbH

  17. 17

    High capacity cDNA kit, Applied Biosystems

  18. 18

    StepOne Plus real-time PCR system, Applied Biosystems

  19. 19

    Applied Biosystems

Ancillary