SEARCH

SEARCH BY CITATION

Keywords:

  • Acetylcholinesterase;
  • Musca domestica;
  • Insecticide resistance;
  • Allelic distribution

Abstract:

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED

Acetylcholinesterase (AChE), encoded by the Ace gene, is the primary target of organophosphates (OPs) and carbamates (CBs) in insects. Ace mutations have been identified in OP and CB resistant strains of Musca domestica. In this study, the Ace gene was partially amplified and sequenced at amino acid positions 260, 342, and 407 to determine the frequencies of these mutations in housefly samples collected from farms and garbage disposal sites of 16 provinces in the Aegean and Mediterranean regions of Turkey. In addition, the percent remaining AChE activities in these samples were assayed by using three OPs (malaoxon, paraoxon, and dichlorvos) and one CB (carbaryl) compound as inhibitors. In all the analyzed samples, 13 different combinations at the three amino acid positions were identified and the L/V260-A/G342-F/Y407 combination was found in the highest frequency. No susceptible individual was detected. The highest mean percent remaining AChE activities were detected in the individuals having the L260-A/G342-F/Y407 genotype when malaoxon and paraoxon were used as inhibitors and in the individuals with the L260-A342-F/Y407 combination when dichlorvos and carbaryl were used as inhibitors. The obtained data were heterogeneous and there was no exact correlation between the molecular genetic background and the resistance phenotypes of the flies. The findings of this study at the molecular and biochemical levels indicate the presence of significant control problems in the field.


INTRODUCTION

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED

Intensive use of insecticides for many years has led to the development of resistance in many agriculturally important target species as well as in human and animal disease vectors. Three main mechanisms are known to be responsible for insecticide resistance: decreased uptake of toxic agents by modifications in the exoskeleton (Kyu and Bishop 1967); increased detoxification of insecticides by esterases, mixed function oxidases, or glutathione-S-transferases (Mouches et al. 1986, Field et al. 1988, Fournier et al. 1992a, Matowo et al. 2010); and changes in the target site (Mutero et al. 1994). The γ-aminobutyric acid receptor, the voltage sodium channel protein, and acetylcholinesterase (AChE) are reportedly the three major target sites for cyclodiene insecticides, DDT and pyrethroids, and organophosphates (OPs) and carbamates (CBs), respectively (Fournier et al. 1992b, ffrench-Constant et al. 1993, Mutero et al. 1994, Williamson et al. 1996).

In insects, AChE (EC 3.1.1.7), encoded by the Ace gene, is the key enzyme of the cholinergic system because it regulates the level of acetylcholine and terminates nerve impulses by catalyzing the hydrolysis of the neurotransmitter. Its irreversible inhibition by OP and CB compounds, which phosphorylate or carbamylate the active-site serine of the enzyme, leads to the accumulation of acetylcholine in the synapses. This inhibition in turn leaves the acetylcholine receptors permanently open, resulting in the death of the insect (Aldridge 1950).

In various insect species, the molecular changes at the target site of AChE that are responsible for resistance, or insensitivity, to OP and CB insecticides have been identified. On the basis of the similarities and differences in resistance profiles of insects, as assessed by bioassay and biochemical data, Russell et al. (2004) suggested two very distinct types of target site resistance, conferring high CB and low OP resistance or high OP with either equivalent or low CB resistance. The AChE target is encoded by distinct genes. Although only one Ace gene, now called Ace2, exists and the molecular basis of insecticide resistance due to insensitive AChE has been described in some insect species such as Musca domestica (Walsh et al. 2001, Kozaki et al. 2001a, b), Lucilia cuprina (Chen et al. 2001), Bactrocera oleae (Vontas et al. 2002, Kakani et al. 2008), B. dorsalis (Hsu et al. 2006), and Drosophila melanogaster (Fournier et al. 1992b, Mutero et al. 1994), there are at least two genes, termed Ace1 and Ace2, in many other insects and ticks and the molecular basis of resistance has been explained in some of them, such as Anopheles gambiae, Culex pipiens pipiens, Cx. p. quinquefasciatus (Weill et al. 2002, 2003, 2004), Myzus persicae (Nabeshima and Kozaki 2003), Aphis gossypii (Toda et al. 2004), and Cx. tritaeniorhynchus (Nabeshima et al. 2004).

OP and CB resistance-associated mutations have been well described in the target site of AChE in M. domestica. Comparison of OP / CB resistant and susceptible strains has indicated five mutations (V260L, G342A, G342V, F407Y, and G445A) singly or in combination in the Ace gene of house fly strains; the numbering of amino acids is based on the sequence of aabys Ace (GenBank Accession No. AF281161) (Kozaki et al. 2001a, b, Walsh et al. 2001). For cross reference, the equivalent residues in the AChEs of M. domestica (Walsh et al. 2001), Torpedo californica (Sussman et al. 1991), and D. melanogaster (Mutero et al. 1994) are shown in Table 1. The proposed reaction mechanisms caused by these mutations in houseflies have already been discussed in detail (Kozaki et al. 2001a, 2001b, Walsh et al. 2001). Combination of these mutations reportedly results in increased resistance (Mutero et al. 1994, Walsh et al. 2001, Menozzi et al. 2004). Kristensen et al. (2006) and Liming et al. (2006) reported six additional mutations at different points of the Ace gene in different OP and CB resistant house fly strains.

Table 1.  The equivalent residues in AChEs of M. domestica (Kozaki et al. 2001a, b; Walsh et al. 2001), T. californica (Sussman et al. 1991), and D. melanogaster (Mutero et al. 1994) associated with resistance.
Species  Amino acid substitutions Residue numbers  
M. domesticaV260LG342AG342VF407YG445A
T. californica150227227290328
D. melanogaster220303303368406

AChE, an appropriate biomarker, is used for evaluating the response of organisms to OP and CB stresses and for ecological risk-assessment studies. Biomarkers are crucial because of their potential as early warning systems of potentially damaging effects at higher levels (Crane et al. 2002). For the correct use of biomarkers, it is necessary to know the natural variability ranges of the studied species inhabiting a geographical area under investigation for pollution effects (Leiniö and Lehtonen 2005).

According to Delen et al. (2005) and the Ministry of Agriculture and Rural Affairs General Directorate of Protection and Control (personal communication), OP insecticides are used more often than the other group of insecticides in Turkey. Unfortunately, there is also serious failure in controlling insecticide usage for pest species. The Aegean and Mediterranean regions of Turkey involve intense agricultural activities under the continual influx of insecticides, mainly OPs. Although biochemical methods are useful for detecting resistance at the molecular level, they do not enable us to identify resistance mutations. However, it is essential to investigate the distribution of AChE mutations in natural populations to suggest appropriate solutions for control problems in the field. In this study, we partially amplified and sequenced the house fly Ace gene at the amino acid positions of 260, 342, and 407, which are diagnostic points for OP and CB resistance (Kozaki et al. 2001a, b, Walsh et al. 2001), and detected the percent remaining AChE activities by using three common OPs and one CB insecticides on field-collected populations of M. domestica from 48 different locations in the Aegean and Mediterranean regions of Turkey.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED

House fly samples

The house fly samples were collected from farms and garbage disposal sites of 16 different provinces in the Aegean and Mediterranean regions of Turkey in the summer of 2006–2007. Three locations were selected as sampling sites in each province (Figure 1). The Aegean provinces were Muğla, Aydın, İzmir, Manisa, Kütahya, Uşak, Afyon, and Denizli, and those in the Mediterranean region were Isparta, Burdur, Antalya, Mersin, Adana, Osmaniye, Kahramanmaraş, and Hatay. The samples were reared as described previously (Taskin and Kence 2004) and the F1 generation was frozen and stored at –80° C until use. Their biochemical characterizations have been described previously (Gacar and Taskin 2009, Taskin et al. 2009). The World Health Organization (WHO) standardized insecticide-susceptible reference strain (Akiner and Caglar 2006, Gacar and Taskin 2009) was obtained from the Department of Biology, Hacettepe University, Ankara, Turkey.

image

Figure 1. Map of the collection sites of the M. domestica populations.

Download figure to PowerPoint

Genomic DNA extraction

From each province, four individual decapitated house flies (resistance status unknown) and a reference susceptible strain were used for genetic analysis. Their heads were kept for biochemical assay. Genomic DNA was isolated from five to six-day-old flies by using the Lifton method (Bender et al. 1983). In brief, each individual decapitated house fly was homogenized in 500 μl Lifton solution (0.1 M Tris-HCI, 0.05 M EDTA, pH = 9.1) with 0.5% sodium dodecyl sulfate and incubated at 65° C for 30 min. Then, 250 μl of 0.6 M potassium acetate was added to the samples, which were inverted to mix and cooled on ice for 60 min. The homogenate was centrifuged at 14,000 rpm for 10 min at room temperature and the supernatant was treated with phenol, phenol:chloroform (1:1) and chloroform:isoamylalcohol (24:1), respectively. The supernatant was collected in a new tube, 1 μl RNase (10 mg/ml) was added, and incubated at 37° C for 30 min. Then, 500 μl of 70% ethanol was added and centrifuged for 15 min at 14,000 rpm. The resultant pellet was washed with 80% ethanol, and after brief drying, the DNA was resuspended in 30 μl of dH2O, stored at 4° C overnight, and visualized on 1% agarose gel.

PCR conditions and sequencing of Ace

The procedure described by Kozaki et al. (2009) was followed for the PCRs. The Ace fragment was amplified by using primer pairs S90MdAce (CATCTAAAACCGATCAGGACCATTTAATAC) and AS89MdAce (TCATCTTTAACATTTCCAATCAGAATATCG). The 25 μl PCR mix contained 100 ng genomic DNA, 50 pmoles of each primer, 1.5 mM MgCl2, 0.25 mM of each dNTP, 1U of Taq polymerase (Fermentas Life Sciences, Vilnius-Lithuania), and 2.5 μl 10× PCR buffer. The reactions were carried out at 94°C for 3 min, followed by 40 cycles of 95° C for 30 s, 55° C for 30 s, and 72° C for 1 min 30 s, and final extension at 72°C for 10 min. The PCR products were visualized and isolated from the 1% agarose gel by using a Qiagen QIAquick PCR purification kit according to the manufacturer's instructions and sequenced directly (in both directions) with the AS87MdAce (GCTAAGATCTGCTGTTTTCAAAAGTGTCAT; obtained from Kozaki et al. 2009) and MdAce5 (GGCGGTGGCTTTATGACTGGCTCAG) primers. Sequencing was performed by an Applied Biosystems A3100 automated DNA sequencer. Homozygous and heterozygous individuals were identified by manual inspection of the sequence electropherograms.

Determination of AChE activity

AChE activities of the samples were measured according to the method of Ellman et al. (1961). Individual house fly heads were homogenized in 110 μl phosphate buffer (0.1 M phosphate buffer, pH = 7.5, containing 1% Triton X-100) with a homogenizer and diluted by adding 40 μl buffer. Then, the homogenate was centrifuged at 14,000 rpm for 15 min at 4° C and the supernatant was used for the assay. Diluted homogenate (5 μl), 25 μl of 5,5á-dithio-bis-(2-nitrobenzoic acid) (DTNB), and phosphate buffer were mixed in 96-well microtiter plates at room temperature. Assays were started by adding acetylthiocholine iodide in buffer (25 μl) with or without inhibitors to obtain substrate and DTNB concentrations of 1 mM in the final volume. All the assays were performed with a Thermo Multiscan spectrophotometer and the readings were recorded at 412 nm every minute for 10 min. For inhibition assays, four commonly used insecticides, three OP compounds (malaoxon, paraoxon, and dichlorvos) and one CB compound (carbaryl), were used. In the preliminary experiments, the diagnostic concentrations of malaoxon, carbaryl, paraoxon, and dichlorvos were determined as 100, 10, 1, and 1 μM, respectively. From each sample, three different measurements (with and without an inhibitor) were carried out and the percent remaining AChE activities were calculated as follows: mean inhibited activity × 100/uninhibited activity. The total protein concentration was determined using the Bradford method (1976).

Data analysis

Base sequence alignments and analyses were conducted by using the MEGA version 3.1 (Kumar et al. 2004) software program. Various genetic statistics were calculated using DNAsp version 4.50 (Rozas et al. 2003). For the evaluation of biochemical data, SPSS 14.0 (Windows Evaluation Version, Rel. 14.0; SPSS, Inc.) was used. Parametric (F-test) and non-parametric (Kruskal-Wallis test) one-way analysis of variance tests were performed to compare the enzyme activities with different insecticides and genotypes. In addition to this, multiple comparisons were made by using the Tukey HSD method for parametric case and Mann-Whitney test for non-parametric case. All the comparisons were made at the level of α= 0.05.

RESULTS

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED

Ace polymorphisms in field-collected populations

A total of 583 nucleotides, including the 85 bp intron region of the house fly Ace gene, was amplified by PCRs of genomic DNA from individual houseflies. Alignment of the sequences from all the 64 samples revealed many single nucleotide polymorphisms (SNPs); that is, some sites had a mixture of two bases because the individuals were heterozygous at those sites. Seven samples were polymorphic at only one site and six different alleles were identified from their sequences. Alleles 3 and 5 had L260-A342-Y407 and V260-A342-Y407 combinations, respectively, and corresponded to the alleles of v15 (GenBank Accession No. FJ174267) and v10 (GenBank Accession No. FJ174262), respectively (Kozaki et al. 2009). The other four alleles (allele 1, V260-V342-Y407; allele 2, L260-A342-Y407; allele 4, L260-A342-F407; allele 6, V260-G342-Y407) were specific to the Turkish house fly populations.

By examining the MdAce polymorphism, 13 different combinations at positions 260, 342, and 407 were detected in the studied populations. The L/V260-A/G342-F/Y407 combination had the highest frequency (21%). The second common phenotype was V260-A/G342-Y407 (19%). L/V260-A/V342-Y407 (12%), L/V260-A/G342-Y407 (12%), V260-A/V342-Y407 (9%), and L260-A342-Y407 (8%) were the other common phenotypes in the populations. The seven remaining combinations had a total frequency of 19% (Figure 2A).

image

Figure 2. Pie charts illustrating the frequencies of polymorphisms at the key 260, 342, and 407 residues in the Ace gene of the field-collected house fly samples. A: Genotypic combination patterns of the three resistance-associated mutations at positions 260, 342, and 407. B: Frequencies of mutations at position 260. C: Frequencies of mutations at position 342. D: Frequencies of mutations at position 407.

Download figure to PowerPoint

The proportions of the three resistance-associated mutations in all the individuals are summarized in Figures 2B–D. At position 260, 20% and 32% of the individuals were homozygous for Leu and Val, respectively, whereas the remaining (48%) were heterozygous for these amino acids (Figure 2B). At position 342, five combinations were detected, suggesting the importance of this position for the enzyme. Walsh et al. (2001) reported that G342 is located close to the active-site triad at the base of the gorge, likely affecting the orientation of the catalytic serine, which is predicted to cause resistance by restricting the access and/or binding of bulky insecticide inhibitors within the active site; they identified G342A and G342V substitutions in OP and CB resistant house fly strains, respectively. Only 2% and 14% of the individuals were homozygous for Gly and Ala at this position, respectively; the remaining individuals (84%) were heterozygous at this position. Among them, 56% were heterozygous for Gly and Ala, 22% were heterozygous for Ala and Val, and 6% were heterozygous for Val and Gly (Figure 2C). V/V342 was not detected among the screened houseflies. At position 407, most of the individuals (67%) were homozygous for Tyr and the rest (33%) were heterozygous for Phe and Tyr (Figure 2D). The standard susceptible strain contained an allele coding a characteristic susceptible form of AChE (V260-A316-G342-F407). In addition, two samples from Aydın were found to be heterozygous for the amino acid position of 316; one allele contained Ala and the other contained Ser. This A316S change was recently reported as a new mutation appearing to be associated with resistance (Kozaki et al. 2009).

Region specific assessment of the data, given in Table 2, did not yield distinct differences between the Aegean and Mediterranean populations in terms of their compositions at the three resistance-associated amino acid positions. However, 11 samples of the Mediterranean populations were homozygous for Leu at position 260 compared with only two samples of the Aegean populations showing homozygosity at this position. Val residue in the homozygous condition was detected in higher frequency (75%) in the Izmir population of the Aegean region than in the other populations screened in this study. Among the Aegean populations, all the individuals from Denizli, 75% of the individuals from Kütahya, Uşak, and Afyon each, and 50% of the individuals from Manisa were heterozygous at position 260. On the other hand, among the Mediterranean populations, all the samples from Osmaniye and 50% of the samples from Kahramanmaraş, Burdur, and Isparta each were heterozygous at the same position. All of the three combinations at this position were detected in the Aydın and Muğla populations of the Aegean region and in the Antalya, Mersin, and Hatay populations of the Mediterranean region.

Table 2.  The amino acid residues at positions 260, 342, and 407 inferred from the Ace sequence, alleles detected in the samples, and the percent remaining AChE activities of the field-collected house fly populations from the Aegean and Mediterranean regions. Thumbnail image of

Considering position 342, all the individuals from the Denizli and Osmaniye populations were heterozygous for Gly and Ala. The Kütahya, Aydın, and Afyon populations of the Aegean region and the Kahramanmaraş and Burdur populations of the Mediterranean region were also heterozygous for the same residues in high frequency (75% in each). The Uşak, Manisa, and Muğla populations of the Aegean region and the Antalya, Hatay, and Isparta populations of the Mediterranean region showed three different compositions at this position.

All the house flies screened from the Aydın, Uşak, Izmir, Manisa, and Burdur populations were homozygous for Tyr at position 407. On the other hand, only the Kahramanmaraş population was heterozygous for Tyr and Phe at this position, and 75% of the individuals from the Afyon and Osmaniye populations were heterozygous at the same position. No homozygous individuals for Phe were detected.

Evaluation of the populations in terms of the combinations at the three amino acid positions revealed a conspicuous situation in the Osmaniye population only, in which 75% of the individuals had the phenotype of L/V260-A/G342-F/Y407. The 12 remaining phenotypes were represented by only one or two samples in the other populations.

Percent remaining AChE activities in field-collected individual house flies

The activity results of the individuals in relation to their compositions at the three resistance-associated amino acid positions are given in Table 2. The highest mean percent remaining AChE activities were detected in the individuals having the L260-A/G342-F/Y407 phenotype when malaoxon and paraoxon were used as inhibitors and in those with the L260-A342-F/Y407 combination when dichlorvos and carbaryl were used as inhibitors. No distinct relation was determined between the molecular genetic background and the resistance phenotypes of the houseflies despite the extensive data.

DISCUSSION

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED

Intensive use of insecticides is considered the main reason for resistance of various insects to insecticides. Genotyping of individual insects is a powerful tool for detecting resistance-associated mutations and understanding the population genetics as well as the evolution of insecticide resistance. However, such genotyping studies have been carried out mainly on laboratory strains, and none or few have included field-collected flies. Because of short generation times, large population sizes, and strong selection pressure, the evolution of insecticide resistance in insects is rapid. This increasing resistance problem makes it necessary to investigate the molecular basis of AChE mutation distribution in natural populations. Here, we have reported the changes at amino acid positions 260, 342, and 407 of the house fly Ace gene and the percent remaining AChE activities in 16 field-collected populations from the Aegean and Mediterranean regions of Turkey. Although Kozaki et al. (2001a) and Walsh et al. (2001) reported that V260L mutation in house fly AChE confers relatively limited levels of insecticide insensitivity, this mutation was found in OP resistant YPRN and YBOL strains by Kozaki et al. (2001b), the 571ab strain by Kristensen et al. (2006), and CB resistant SH-CBR strains by Liming et al. (2006). Therefore, we included position 260, in addition to positions 342 and 407, in this study. This is the first study in the specialized literature showing the AChE mutation distribution in natural populations in a wide geographical area.

Six different alleles were identified among the seven samples detected as polymorphic at only one site. One of them was the v10 allele, which was first reported in the Cornell-R strain and probably selected for during the period of approximately 1955–1970, when OPs and CBs were routinely used for house fly control in New York. It was reported that this allele remained in field populations in the United States as it was detected in collections from 1999 (INDR) and 2002 (NYSPINR). Further, the v10 allele, as well as the v11 allele, is reportedly specific to flies in the United States and is not detected in laboratory or field-collected flies from Europe (Kozaki et al. 2009). Among the six identified alleles, v15 was first detected in the YPER strain (originally from Japan) and was also reported from a strain from Japan (Kristensen et al. 2006; mentioned in Kozaki et al. 2009) and the United Kingdom (Walsh et al. 2001; mentioned in Kozaki et al. 2009). Kozaki et al. (2009) reported that v15 confers protection against certain OPs such as pyraclophos, propahophos, dichlorvos, and malaoxon. As reported by Gacar and Taskin (2009), malathion is one of the dominating insecticides used in the Aegean and Mediterranean regions of Turkey. Therefore, this report is the first record of the v10 and v15 alleles in this part of the world in addition to the four alleles specific to Turkey. Similar to two OP-resistance alleles, B1 and A2-B2, in Cx. pipiens (Raymond et al. 1991, Qiao and Raymond 1995), the v10 and v15 alleles in M. domestica appear to be successful in intercontinental spread. This phenomenon strongly indicates that resistance alleles may be universal rather than varying globally by region, although we detected four new alleles specific to Turkey. With greater attention to genotyping studies of field-collected flies, it is possible to detect these alleles in other parts of the world. Therefore, our notion does not entirely support the hypothesis of Kozaki et al. (2009) that “the detection of known or putative insecticide resistant Ace alleles varies globally by region, although there are some overlaps.” The universal presence of resistance alleles indicates the possibility of effective control of house fly populations globally. Sequencing of natural populations seems to be the key factor for elucidating the ongoing situation of resistance worldwide, and the ability to track individual resistance alleles in natural populations will improve our understanding of the evolutionary process of resistance.

Mutation and migration are the two evolutionary forces involved in the occurrence of a novel resistance allele in a given population. Migration is a major driving force in shaping the evolution of OP resistance in Cx. pipiens, spreading resistance alleles widely by both active and passive dispersal (Chevillon et al. 1999). Similarly, M. domestica has opportunities for long distance gene flow by active and passive transport. It can disperse as larvae or adults during intense anthropogenic activities such as agriculture, trade, and tourism. Therefore, migration can also be considered as the main force in the evolution of resistance in this organism.

The natural populations screened in this study were found to be heterogeneous, composed of a mixture of different alleles. This might be the result of the two evolutionary forces mentioned earlier. According to Menozzi et al. (2004), because each allele provides specific resistance to certain insecticides, allelic diversities in natural populations might enable their survival against different insecticide treatments. Correspondingly, application of a multiplicity of treatments on field populations might result in the emergence of multiple coexisting resistance alleles. Treatment with one insecticide could eliminate one allele while selecting another one in natural populations composed of a mixture of different alleles having different sensitivities to each insecticide. Therefore, it is difficult to develop an effective strategy for managing house fly populations as well as the other pest populations in the study areas.

We did not detect any homozygous susceptible individuals in this study, possibly because of high insecticide pressure for several beneficial mutations (selective sweep) that reduce the variation in the locus causing loss of susceptible alleles in the environment with time. To determine whether susceptible alleles were present at higher frequencies in the populations before the selective sweep, and to identify the allelic background of Ace in natural populations in this part of the world, individuals obtained from the national insect collections should be analyzed.

Evaluation of the percent remaining AChE activities of the individuals in relation to their compositions at the three resistance-associated amino acid positions resulted in a considerable degree of heterogeneity. The probable reason for this finding is that the studied house fly samples are heterogenous, especially at positions 260, 342, and 407, suggesting that they have both sensitive and insensitive alleles and express the two types of AChEs. In addition, there might be other mutations beyond the sequenced region that affect the protein folding and enzymatic activity, such as the amino acid position of 445 (Walsh et al. 2001).

Since the beginning of the 1960s, OP and CB insecticides have been the main tools for controlling house fly populations worldwide. Many ecosystems are under continual exposure to these compounds besides the other organic and inorganic xenobiotics derived from intense human activities. To obtain information about the biological impacts of these contaminants at the organismal, population, and ecosystem levels, effective identification and measurement methods are needed. In this study, the data on the percent remaining AChE activities and sequencing information from the field-collected house fly populations from two different regions of Turkey strongly indicate significant insect control problems in the field. Although insecticide resistance is an important problem, this phenomenon also provides a good model for studying adaptation of eukaryotes to a toxic environment.

Acknowledgments

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED

We thank Dr. Mehmet Karahasan, Department of Statistics, Muğla University, for his help with the statistical analyses. This work was funded by the Muğla University Scientific Research Projects Fund (MĞÜ-BAP-09/32).

REFERENCES CITED

  1. Top of page
  2. Abstract:
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgments
  8. REFERENCES CITED
  • Akiner, M.M. and S.S. Caglar. 2006. The status and seasonal changes of organophosphate and pyrethroid resistance in Turkish populations of the house fly, Musca domestica L. (Diptera: Muscidae). J. Vector Ecol. 31: 5864.
  • Aldridge, W.N. 1950. Some properties of specific cholinesterase with particular reference to the mechanism of inhibition by diethyl p-nitrophenyl thiophosphate (E605) and analogues. Biochem J. 46: 451460.
  • Bender, W., P. Spierer, and D.S. Hogness. 1983. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and bithorax complex in D. melanogaster. J. Mol. Biol. 168: 1733.
  • Bradford, M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72: 248254.
  • Chen, Z., R. Newcomb, E. Forbes, J. McKenzie, and P. Batterham. 2001. The acetylcholinesterase gene and organophosphorus resistance in the Australian sheep blowfly, Lucilia cuprina. Insect Biochem. Mol. Biol. 31: 805816.
  • Chevillon, C., M. Raymond, T. Guillemaud, T. Lenormand, and N. Pasteur. 1999. Population genetics of insecticide resistance in the mosquito Culex pipiens. Biol. J. Linn. Soc. 68: 147157.
  • Crane, M., W. Sildanchandra, R. Kheir, and A. Callaghan. 2002. Relationship between biomarker activity and developmental endpoints in Chironomus riparius Meigen exposed to an organophosphate insecticide. Ecotox. Environ. Safe. 53: 361369.
  • Delen, N., E. Durmusoglu, A. Guncan, N. Gungor, C. Turgut, and A. Burcak. 2005. Problems of the pesticide application, residue, and decrease of susceptibility in organisms in Turkey. Turkey Agricultural Engineeringship VI. Technical Congress, Ankara - Turkey , pp. 629648.
  • Ellman G.L, D.K. Courtney, V. Andres, and R.M. Featherstone. 1961. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7: 8895.
  • ffrench-Constant, R.H., T.A. Rocheleau, J.C. Steichen, and A.E. Chalmers. 1993. A Point mutation in a Drosophila GABA receptor confers insecticide resistance. Nature 363: 449451.
  • Field, L.M., A.L. Devonshire, and B.G. Forde. 1988. Molecular evidence that insecticide resistance in peach-potato aphid (Myzus persicae Sulz.) results from amplification of an esterase gene. Biochem. J. 251: 309312.
  • Fournier, D., J.M. Bride, M. Poirie, J.B. Berge, and F.W. Plapp. 1992a. Insect glutathione transferase. Biochemical characteristics of the major forms from houseflies susceptible and resistant to insecticides. J. Biol. Chem. 267: 18401845.
  • Fournier, D., J.M. Bride, F. Hoffman, and F. Karch. 1992b. Acetylcholinesterase: two types of modifications confer resistance to insecticides. J. Biol. Chem. 267: 1427014274.
  • Gacar, F., and V. Taşkın. 2009. Partial base sequence analysis of MdαE7 gene and ali-esterase enzyme activities in field collected populations of house fly (Musca domestica L.) from Mediterranean and Aegean Regions of Turkey. Pestic. Biochem. Physiol. 94: 8892.
  • Hsu, J.C, D.S. Haymer, W.J. Wu, and T.H. Feng. 2006. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides. Insect Biochem. Mol. Biol. 36: 396402.
  • Kakani, E. G., I.M. Ioannides, J.T. Margaritopoulos, N.A. Seraphides, J.A. Skouras, and K.D. Mathiopoulus. 2008. A small deletion in the olive fly acetylcholinesterase gene associated with high levels of organophosphate resistance. Insect Biochem. Mol. Biol. 38: 781787.
  • Kozaki, T., S.G. Brady, and J.G. Scott. 2009. Frequencies and evolution of organophosphate insensitive acetylcholinesterase alleles in laboratory and field populations of the house fly, Musca domestica L. Pestic. Biochem. Physiol. 95: 611.
  • Kozaki, T., T. Shono, T. Tomita, and Y. Kono. 2001a. Fenitroxon insensitive acetylcholinesterases of the house fly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31: 991997.
  • Kozaki, T., T. Shono, T. Tomita, and Y. Kono. 2001b. Polymorphism in the acetylcholinesterase gene of the house fly, Musca domestica L. (Diptera: Muscidae). Appl. Entomol. Zool. 36: 377380.
  • Kristensen, M., J. Huang, C. L. Qiao, and J. B. Jespersen. 2006. Variation of Musca domestica L. acetylcholinesterase in Danish house fly populations. Pest. Manag. Sci. 62: 738745.
  • Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5: 150163.
  • Kyu, T. Y. and J.L. Bishop. 1967. Penetration, excretion and metabolism of carbaryl in susceptible and resistant German cockroaches, J. Econ. Entomol 60: 13281332.
  • Leiniö, S. and K.K. Lehtonen. 2005. Seasonal variability in biomarkers in the bivalves Mytilus edulis and Macoma balthica from the northern Baltic Sea. Comp. Biochem. Physiol. C 140: 408421.
  • Liming T., S. Mingan, Y. Jiangzhong, Z. Peijun, Z. Chuanxi, and T. Zhenhua. 2006. Resistance pattern and point mutations of insensitive acetylcholinesterase in a carbamate-resistant strain of house fly (Musca domestica). Pest. Biochem. Physiol. 86: 16.
  • Matowo, M. J., M. A Kulkarni, F.W. Mosha, R.M. Oxborough, J.A. Kitau, F. Tenu, and M. Rowland. 2010. Biochemical basis of permethrin resistance in Anopheles arabiensis from Lower Moshi, north-eastern Tanzania. Malaria J. 9: 193.
  • Menozzi, P., M.A. Shi, A. Lougarre, Z.H. Tang, and D. Fournier. 2004. Mutations of acetylcholinesterase which confer insecticide resistance in Drosophila melanogaster populations. BMC Evol. Biol. 4: 4.
  • Mouches, C., N. Pasteur, J.B. Berge, O. Hyrien, M. Raymond, B.R. Saint Vincent, M. Silvestri, and G.P. Georghiou. 1986. Amplification of an esterase gene is responsible for insecticide resistance in a California Culex mosquito. Science 233: 778780.
  • Mutero, A., M. Pralavorio, J.M. Bride, and D. Fournier. 1994. Resistance-associated point mutation in insecticide insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. U.S.A. 91: 59225926.
  • Nabeshima, T. and T. Kozaki. 2003. An amino acid substitution on the second acetylcholinesterae in the pirimicarb-resistant strains of the pearch potao aphid, Myzus persicae. Biochem. Biophys. Res. Commun. 307: 1522.
  • Nabeshima, T., A. Mori, T. Kozaki, Y. Iwata, O. Hidoh, S. Harada, S. Kasai, D.W. Severson, Y. Kono, and T. Tomita. 2004. An amino acid substitu substitution attributable to insecticide-insensitivity of acetylcholinesterase in a Japanese encephalitis vector mosquito, Culex tritaeniorhynchus. Biochem. Biophys. Res. Commun. 313: 794801.
  • Qiao, Q.L. and M. Raymond. 1995. The same esterase B1 is amplified in insecticide resistant mosquitoes of the Culex pipiens complex from the Americas and China. Heredity. 74: 339345.
  • Raymond M, Callaghan A, Fort P, Pasteur N. 1991. Worldwide migration of amplified insecticide resistance genes in mosquitoes. Nature. 350: 151153.
  • Rozas, J., J. C. Sánchez-DelBarrio, X. Messeguer, and R. Rozas. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 24962497.
  • Russell, R., C. Claudianos, P.M. Campbell, I. Horne, T.D. Sutherland, and J.G. Oakeshott. 2004. Two major classes of target site insensitivity mutations confer resistance to organophosphate and carbamate insecticides. Pestic. Biochem. Physiol. 79: 8493.
  • Sussman, J. L., M. Harel, F. Frolow, C. Oefner, A. Goldman, L. Toker, and I. Silman. 1991. Atomic structure of acetylcholinesterase from Torpedo californica- a prototypic acetylcholine-binding protein. Science 253: 872879.
  • Taskin, V. and M. Kence. 2004. The genetic basis of malathion resistance in house fly (Musca domestica L.) strains from Turkey. Russian J. Genet. 40: 14751482.
  • Taskin V., B.G. Taskin, K. Kucukakyuz, and M. Kence. 2009. Potential use of variation in esterase, glutathione-S-transferase, and acetylcholinesterase activities in Musca domestica L. in biomonitoring. Fres. Environ. Bull. 18: 20792085.
  • Toda, S., S. Komazaki, R. Tomita, and Y. Kono. 2004. Two amino acid substitutions in acetylcholinesterase associated with pirimicarb and organophosphorous insecticide resistance in the cotton aphid, Aphis gossypii Glover (Homoptera: Aphididae). Insect Mol. Biol. 13: 549553.
  • Vontas, J.G., Hejazi, N.J. Hawkes, N. Cosmidis, M. Loukas, and J. Hemingway. 2002. Resistance associated point mutations of organophosphate insensitive acethylcholinesterase in the olive fruit fly Bactrocera oleae. Insect Mol. Biol. 11: 329336.
  • Walsh, S. B., T.A. Dolden, G.D. Moores, M. Kristensen, T. Lewis, A.L. Devonshire, and M.S. Williamson. 2001. Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. Biochem. J. 359: 175181.
  • Weill, M., P. Fort, A. Berthomieu, M.P. Dubois, N. Pasteur, and M. Raymond. 2002. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila. Proc. R. Soc. Lond. B Biol. Sci. 269: 20072016.
  • Weill, M., G. Lutfalla, K. Mogensen, F. Chandre, A. Berthomieu, C. Berticat, N. Pasteur, A. Philips, P. Fort, and M. Raymond. 2003. Insecticide resistance in mosquito vectors. Nature 423: 136137.
  • Weill, M., C. Malcolm, F. Chandre, K. Mogensen, A. Berthomien, M. Marquine, and M. Raymond. 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detected in mosquito vectors. Insect Mol. Biol. 13: 17.
  • Williamson, M.S., D. Martinez-Torres, C. A. Hick, and A. L. Devonshire. 1996. Identification of mutations in the housefly para-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides. Mol. Gen. Genet. 252: 5160.