Six polymorphic microsatellites in the flood-water mosquito Aedes sticticus

Authors


The flood-water mosquito Aedes sticticus (Diptera: Culicidae) occurs in North America, Europe, and Siberia (Knight and Stone 1977). Very large populations of the species can emerge repeatedly, during spring and summer, from the larval habitats of temporarily flooded meadows and swamps in the lower reaches of rivers, for example, the River Dalälven in Sweden (Schäfer et al. 2008), the River Rhein in Germany (Becker et al. 2003), and the River Drava in Croatia (Sudarić Bogojević et al. 2009). Ae. sticticus is considered to be an aggressive nuisance species and recent studies have shown that Ae. sticticus is one of the potential mosquito vectors of Francisella tularensis holarctica, the agent responsible for tularemia in humans and animals in northern Europe (Schäfer et al. 2008, Lundström et al. 2011, Ryden et al. 2011). In addition, the geographic distribution of Ae. sticticus in Sweden is expanding dramatically in response to a changing climate with longer and warmer summers and increasing inundation during the growing season in major parts of the country (Schäfer and Lundström 2009).

For studies of population structure in Ae. sticticus, microsatellites are very useful markers, but no microsatellite markers have been available. Such markers have been developed for several other mosquito species (Behbahant et al. 2004, Porretta et al. 2005, Porretta et al. 2006, Slotman et al. 2007, Smith et al. 2005, Widdel et al. 2005) but seem to be strongly species-specific, although some may amplify in related species. The aims of the present study were to evaluate cross species amplification of microsatellites reported for other mosquito species in the genus Aedes for Ae. sticticus and to develop microsatellites specifically for Ae. sticticus.

To test for cross-species amplification, we used DNA (extracted using E.Z.N.A.® Insect DNA Kit, Omega Bio-Tek, Norcross, GA, U.S.A.) from Ae. sticticus females collected during August, 2007 in northern and central Europe, one population from Kristianstad, Sweden (56.0329, 14.1472) and one from Hördt, Germany (49.1639, 8.3600). In total, we included 82 markers, available for other mosquito species within genus Aedes (synonym Ochlerotatus), in the evaluation for suitability as markers in Ae. sticticus. For the PCR we used QIAGEN Multiplex PCR Kit (Qiagen, Hilden, Germany), following the manufacturer's protocol with a gradient annealing temperature between 50° C and 60° C and we used the optimal temperature for subsequent analysis.

We used the enrichment protocol outlined in Glenn and Schable 2005 to develop new markers for Ae. sticticus, using the corresponding enzymes from Fermentas (St. Leon-Rot, Germany). We pooled four Ae. sticticus female individuals from Kristianstad and extracted DNA using E.Z.N.A.® Insect DNA Kit (Omega Bio-Tek). DNA was restricted using RSA I. The cut DNA was enriched using a mix of biotinylated probes (supporting information). After the enrichment process, the dried pellet was rehydrated and PCR was performed in 25 µl reactions using 2.5 µl 10× PCR buffer without MgCl2, 1.5µl 2.5 mM of each NTP, 1.3 µl 10 µM SuperSNX-24 primer, 2 µl 25 mM MgCl2, 1 unit Taq DNA Polymerase (Fermentas) and 2 µl enriched DNA. The PCR cycle consisted of an initial denaturation at 95° C for 2 min, 25 cycles at 94° C for 20 s, 60° C for 20 s, and 72° C for 90 s, followed by a final elongation at 72° C for 7 min. The PCR product was then cloned into Invitrogen™ pCR 2.1 TOPO chemically competent cells (Life Technologies, Grand Island, NY, U.S.A.) using GeneJET ™ 1.0 PCR Cloning Kit (Fermentas).

The resulting colonies were picked and grown overnight in deep well plates containing LB-medium and 50 µg/ml ampicillin. One µl cell culture was lysed in 50 µl H2O at 99° C for 5 min. One µl of the lysate was used to perform a 15 µl PCR reaction using 1.5 µl 10× PCR buffer without MgCl2, 0.5 µl 2.5 mM of each NTP, 0.4 µl 10 µM of each vector primer, 0.95 µl 25 mM MgCl2, and 1 unit Taq DNA Polymerase (Fermentas). The PCR cycle consisted of an initial denaturation at 95° C for 3 min, 30 cycles at 94° C for 30 s, 58° C for 30 s and 72° C for 3 min, followed by a final elongation at 72° C for 7 min. The PCR product was visualized on a 1.5% agarose gel, and if the PCR product was between 200 and 1,200 base pairs, it was sequenced on a Megabace 1000 sequencer using ET-terminator mix (GE healthcare, Pittsburgh, PA, U.S.A.) following the manufacturer's protocol for 20 µl reactions and subsequent ethanol precipitation. We sequenced 331 clones, from the microsatellite enriched library, in both directions. The resulting sequences were examined manually in Codoncode aligner (Codoncode Corporation, Dedham, MA, U.S.A.). Twenty-eight sequences contained repetitive segments and sufficient flanking regions were chosen for primer design using Primer 3 (http://frodo.wi.mit.edu/) (Rozen and Skaletsky 2000). One of three PCR tags were added to the forward primer (M13r = GGAAACAGCTATGACCAT, CAG = CAGTCGGGCGTCATCA, T3 = AATTAACCCTCACTAA

AGGG) (Table 1). These tags were used as primer binding sites for an end-tagged fluorescent tagged universal primer (M13r = FAM, T3 = HEX, CAG = NED). PCR was performed on an Eppendorf Master Cycler Gradient machine using Qiagen Multiplex mix (Qiagen), following the manufacturer's recommendations. To investigate optimal annealing temperature, we used a gradient between 50° C and 60° C. A 1.5% agarose gel was used to screen for successful amplification.

Table 1. Microsatellite characteristics for six polymorphic markers for two populations of Ae. sticticus from Kristianstad, Sweden and Hördt, Germany, respectively. Tag name is indicated with [intrinsic] in primer sequence. T = annealing temperature in degrees Celsius, N = sample size. Alleles = Number of alleles in each of the two populations. Size in base pairs of the microsatellites including TAG sequences. Hobs and Hexp = Observed and expected heterozygozities. NA= Presence of Null Alleles, N= no, Y=yes. HWE = Stars indicate deviation from Hardy-Weinberg and significance level: ** = 0.01, *** = 0.001, NS = not significant.
LocusDirectionPrimer Sequence 5′ → 3′TPopulationNAllelesSize RangeHobsHexpNAHWE
OchcB5FTag name: T356Hördt7121900N
 RReference: Porretta et al. 2006 Kristianstad13121900N
OJ70BFTag name: CAG56Hördt246212–2320.6250.668NNS
 RReference: Widdel et al. 2005 Kristianstad245212–2320.4170.395NNS
S2D12_AF[CAG]AGGCTCTCACGCTCAACATT56Hördt245115–1230.3330.304NNS
 RCTGGATTGGTCTCCGATCAC Kristianstad245115–1230.2500.234NNS
S2D12_BF[CAG]TCGCTACGTGAGATTCGTTAGA56Hördt24116000N
 RCCAACAGCAAGCAACAAGAA Kristianstad192160–1620.0530.309N**
S2H1F[M13r]GTCCCGGGATGATTGAGAC56Hördt246142–1600.5000.656NNS
 RCGCACATATGATGGAGTCGT Kristianstad195142–1600.6320.572NNS
S1G11F[T3]ACCGCGCTGCTCTAAAATAA56Hördt248154–1880.5000.785Y**
 RATGCACACCACTTCCATGTC Kristianstad247154–1870.4580.784Y***
S2G4F[T3]CGGTAGATTCGCCCTTATCA53Hördt244113–1300.4170.423NNS
 RTCGAAATCGGTTTTGGAATC Kristianstad243113–1300.4580.536NNS

The isolated markers were analyzed in 24 individuals from each of the two Ae. sticticus populations from Sweden and Germany, respectively. DNA was extracted using E-Z 96® Tissue DNA Kit (Omega Bio-Tek). Reliability and polymorphism were also analyzed for the two cross species microsatellite primers showing successful amplification. PCR conditions followed the Qiagen Multiplex kit (Qiagen) protocol using at least one locus in each dye color. The optimal annealing temperature was used for each primer pair and the ratio of the fluorescent- and sequence tagged forward primer was 80/20. PCR products were diluted 1:100 and electrophoresed on a Megabace 1000 (GE healthcare) with ET-Rox 400 base pair size standard. Genotypes were scored using Fragment profiler v1.2 software (GE healthcare).

Excel add-in Microsatellite toolkit was used to calculate basic indexes and Genepop on the web (http://genepop.curtin.edu.au/) was used to calculate Hardy Weinberg Expectations (HWE) and linkage disequilibrium (LD) (Raymond and Rousset 1995, Rousset 2008). Micro-Checker v2.2.3 was used to investigate presence of null alleles (van Oosterhout et al. 2004).

Here we report six polymorphic microsatellite markers for the flood-water mosquito Ae. sticticus. Initially, we tested 82 markers developed for other mosquito species for cross-species amplification. Only two amplified in Ae. sticticus and one of these was polymorphic (Table 1). This polymorphic microsatellite marker was originally isolated in Aedes japonicus (Widdel et al. 2005). The low success rate when testing cross-species microsatellites shows the need to isolate specific markers specifically for the species of interest. Twenty-eight sequences containing microsatellite motifs from the 331 clones were selected for primer design, PCR optimization, and testing. After discarding failed amplifications, smears, and primer pairs amplifying multiple bands, five loci were identified as highly interesting and used for subsequent analysis.

The characteristics of the isolated and tested Ae. sticticus primer pairs are summarized in Table 1. The developed polymorphic markers for Ae. sticticus yielded between two and eight alleles and the observed heterozygosities range varied between 0.05 and 0.63. Of the developed markers, two did not conform to HWE (Table 1). Since S2D12_A and S2D12_B were developed from the same sequence, they are strongly linked and the need to use both markers for population genetic studies is small, as many methods assume no LD. However, for other uses they can have value. The marker S1G11 showed presence of null alleles. Clearing for the markers not in HWE, no locus pair showed evidence for LD (supporting information). Sequences used for primer design for the five loci can be found in the supporting information.

These five microsatellites isolated from Ae. sticticus, and the single cross-species reactive microsatellite from Aedes japonicas, will prove useful to characterize the population genetic structure of Ae. sticticus. However, additional microsatellites are probably needed to give a good resolution on the population genetic structure. Very little is known about the genome and genome size of Ae. sticticus; only a few sequences are available on Genebank but in other mosquito species there have been reports of a high percentage of microsatellite repeats within repetitive elements (Chambers et al. 2007, Widdel et al. 2005). We found many of the specifically developed markers yielded multiple fragment peaks when analyzing them. Based on the multiple peaks, we can assume that at least some of the loci are located in repetitive elements and thus unsuitable for genetic analysis. We also found very low levels of cross species amplification (2.4%). Although cross species amplification success decreases with phylogenetic distance and redesigned primers can increase the success ratio, the markers are subjected to decreased allelic richness and a most often lowered annealing temperature (Primmer et al. 2005, Smith et al. 2005). Thus, to achieve a good set of microsatellites for mosquitoes, isolation seems to be needed for each species.

Acknowledgments

We thank Achim Kaiser for collecting and morphologically identifying German mosquitoes, Arne Halling for collecting Swedish mosquitoes, Thomas Persson Vinnersten and Anna Hagelin for the morphological identification, and Gunilla Engström for help in the lab. Finally we thank the three anonymous reviewers for their comments on the manuscript.

Ancillary