• Open Access

Chromosomal assignment of the two candidate genes (EGFR, CLCA1) for equine recurrent airway obstruction (RAO) by FISH and RH mapping

Authors


The epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine kinase activity. Activation of the EGFR can elicit a range of phenotypic responses in the target cell including growth promotion, growth inhibition, protection against apoptosis, induction of differentiation, reorganisation of the cytoskeleton and cell migration (Arjona et al. 2005). The human EGFR gene maps to HSA 7p12.3–p12.1 and contains 28 exons spanning 188 kb in the region from 54.86 Mb to 55.05 Mb on HSA 7 (NCBI map viewer, human genome build 35.1).

The calcium-dependant chloride channel 1 (CLCA1) belongs to the CLCA family (CLCA1, 2, 3, 4) of transmembrane proteins (Fuller et al. 2001). The human CLCA1 gene maps to HSA 1p22–p31 and contains 15 exons spanning 31.89 kb in the region form from 86.65 Mb to 86.68 Mb on HSA 1 (NCBI map viewer, human genome build 35.1).

CLCA1 has been identified as an important down-stream effector element of IL-13. The expression of human an CLCA1 is strongly induced in the airway epithelium, especially in goblet cells and mediates hyperreactivity and overproduction of mucus in animal models. (Nakanishi et al. 2001; Toda et al. 2002; Anton et al. 2005). In the bronchial epithelium, both the CLCA1 and EGFR pathways converge in the up-regulation of MUC5AC, the dominant mucin gene expressed in goblet cells, leading to increased gel-formation and subsequent mucous remodelling and hypersecretion (Kamada et al. 2004).

Recurrent airway obstruction (RAO) of the horse is likely a polygenetic disorder (Marti and Harwood 2000) and shares many characteristic features with human asthma (Robinson et al. 2001) and chronic obstructive pulmonary disease (COPD). RAO and asthma are characterized by airway bronchospasm, coughing, airway hyperreactivity, inflammation and mucus accumulation. Both selected genes are of high interest for respiratory disorders with chronic mucus overproduction, including asthma, cystic fibrosis and COPD. (Malerba and Pignatti 2005) Therefore mapping of the equine EGFR and CLCA1 gene in the horse represents a first step for further studies of inherited RAO, an important health problem of the horse.

The INRA equine BAC library (Milenkovic et al. 2002) was screened by polymerase chain reaction (PCR) using primers designed to amplify parts of the CLCA1 (F: 5′-TAGAGAAGCCCCAAACATGC; R: 5′-CGCCATGCTTCCAGATTTAT) gene.

The currently available horse BAC end sequences were subjected to BLAST analysis against the human genome (Leeb et al., unpubl.). The SP6 end sequence of the equine BAC clone CH241-112H8 (CR955466) revealed a significant match (BLAST E-value 8e–35, 86% identity over 166 bp) in reverse complementary orientation on human chromosome 7 ending at 54 903 718 bp in intron 1 of the EGFR gene. Thus the clone CH241-112H8 was assumed to contain the 5′-end including exon 1 of the equine EGFR gene.

Several PCR products generated from both positive BAC clones were sequenced using the Big Dye Terminator v.3.1 Cycle Sequencing KIT (Applied Biosystems, Rotkreuz, Switzerland) and 3730 DNA automated sequencer (Applied Biosystems, Rotkreuz, Switzerland) and their homology to the corresponding human or equine sequences evaluated using BLAST and FASTA The eight PCR products were identical with the corresponding equine or human sequences in the range of 80% to 100% (Table 1).

Table 1.  Comparison of the equine PCR product with the corresponding equine or human sequences.
GenePCR product (bp)Primer sequencesIdentity (%)
EGFR901F: ATCGTTAAATGAACACGGCTCT87% to human EGFR (AF288738), intron 4
  R: GCTACACGGGATAACCTTTCTG 
EGFR201F: TCTTGGTTCCAAAAATCCACA85% to human EGFR (AF288738), intron 1
  R: TTATGGCAGCTCTTGCACTG 
EGFR322F: AAAGCCAAAGTCACATCCCATAA92% to human EGFR (AF288738), intron 4
  R: AGGAATCAAAATGAACCCAAACT 
EGFR150F: GCTATGTCTCATTGCCCTCA100% to equine EGFR (AJ938083)
  R: CATAGGAAGCTCCCTCAGTCC86% to human EGFR (AF288738), exon 3
    
EGFR280F: GCTCTGTGCAGAATCCTGTCT100% to equine EGFR (AJ938084)
  R: TGCTCCAATAAATTCACTGCT92% to human EGFR(NM_005228), exon 28
CLCA11063F: TCTCCCTCCCTCTTAGATTTCC100% to equine CLCA1 (AY524856)
  R: ACATGGCTTTCAGACCTCATTT86% to human CLCA1 (AF039401), exon 12, intron 12
CLCA11054F: ATGGAAAAATCCCCAATAATCC80% to human CLCA1 (AF039401), intron 1
  R: AAGTTGGTTTCCACACTTGCTT 
CLCA1240F: CGAATTGAGGAGACCCCAGACTA86% to human CLCA1 (AF039401), intron 2
  R: ATACTTCCTTCGGCAGCACAATC 

DNA of both positive clones (EGFR: CH241-112H8; CLCA1: INRA- 0733H4) was prepared from 500 ml overnight cultures of the positive BAC clone using the Qiagen Midi plasmid kit (Qiagen AG, Basel, Switzerland) according to the alkaline lysis protocol for BACs.

Blood samples were collected from healthy horses. Chromosome preparations were obtained after lymphocyte culture and stained applying G-banding technique prior to FISH (Wang and Fedoroff 1974). Chromosome pairs were determined by comparison of the G-bands picture with the international domestic horse chromosome banding standard (Bowling et al. 1997). One hundred ng of DNA sheared BAC DNA containing the EGFR gene were labelled with biotin-16-dUTP by nick translation and hybridized to G-banded horse metaphase chromosome preparations. After denaturation, hybridization at 37°C was carried out over night. Signals were amplified and detected using avidin-FITC and anti-avidin. Chromosome staining was performed with propidium iodide. Slides were analyzed using a Zeiss Axiophot fluorescence microscope (Zeiss, Jena, Germany) equipped with a digital CCD camera, driven by the computer aided software Lucia (Laboratory Imaging LTD, Prague, Czech Republic). For the chromosomal assignment at least 20 metaphase spreads were analyzed. The FISH experiments led to the assignment of the EGFR and CLCA1 genes to ECA 4p12 and ECA5q15 (Fig. 1A, 1B).

Figure 1.

A–B. Chromosomal assignment of the equine BACs containig EGFR (A) and CLCA1 (B) by fluorescent in situ hybridization analysis. GTG-banded metaphase spread after (left) and before (right) hybridization. Double signals indicated by arrows are visible on both equine chromosomes. Downstairs comparison of standard G-banded chromosomes with experimentally G-banded as well FISH hybridized chromosomes.

To confirm the cytogenetic mapping of the EGFR and CLCA1 genes STS markers derived from these genes were typed on the TAMU equine radiation hybrid panel (Chowdhary et al. 2002). A pair of equine primers (CH241-112H8-F 5′-TCT TGG TTC CAA AAA TCC ACA-3′, CH241-112H8-F 5′-TTA TGG CAG CTC TTG CAC TG-3′) for PCR amplification was designed based on the SP6 end sequence (accession CR955466) of BAC clone CH241-112H8 containing EGFR gene to give a 201 bp fragment. A 240-bp fragment of the equine CLCA1 gene was also amplified using the INRA- 0733H4-F (5′-CGA ATT GAG GAG ACC CCA GAC TA-3′) and INRA- 0733H4-R (5′- ATA CTT CCT TCG GCA GCA CAA TC-3′) primers. PCR reactions were performed in a total volume of 20 μl containing 10 μM of each primer and 0.5 U Taq polymerase (Qbiogene, Basel, Switzerland). The reaction started with a denaturing step at 95°C for 7 min followed by 35 cycles using the following protocol: denaturation for 30 s at 95°C, annealing for 30 s at 63°C for EGFR and 64°C for CLCA1 and extension for 1 min at 72°C. PCR products were separated on 2% agarose gels. PCR reactions were carried out in duplicate and scoring for the presence or absence of products was carried out independently by two investigators. After scoring the signals, a two-point analysis was performed using RHMAPPER-1.22 (http://equine.cvm.tamu.edu/cgi-bin/ecarhmapper.cgi) against 861 equine markers mapped previously on the first generation RH-map (Chowdhary et al. 2003).

Two-point linkage analysis revealed that the EGFR was in close linkage to the previously mapped marker ASB03 and the CLCA1 gene to the marker ASB10, respectively (Table 2). The RH results and sequencing of several PCR products generated from analysed BACs confirmed the results obtained by FISH. The chromosomal assignment of EGFR to ECA 4p12 and CLCA1 to ECA5q15 is in good agreement with known conservation of synteny between HSA 7p and ECA 4 also HSA1 to ECA5 (Milenkovic et al. 2002). With the isolation and mapping of the equine BAC clones containig the EGFR and CLCA1 genes we provide the basis for future association studies. To clarify the role of these genes in equine RAO in horses, high prevalence families can now by genotyped with known closely linked microsatellite markers and SNPs.

Table 2.  Equine genome location by FISH and RH mapping and conserved synteny to the human genome.
GeneBAC cloneECAConserved synteny to HSAClosest markerDistance to closet markerLOD
EGFRCH241-112H8ECA4p127p12ASB039.21 cR12
CLCA1INRA- 0733H4ECA5q151p31–p22ASB106.08 cR12

UNLINKED REFERENCES

Wang and Fedoroff, 1972

Acknowledgements

This project was supported by grants from the Vetsuisse and Dept of Veterinary Clinical Studies, Vetsuisse Berne and USDA Animal Health and Well-Being no. #99-35204-8366.

Ancillary