SEARCH

SEARCH BY CITATION

Keywords:

  • horse;
  • exercise;
  • sprint;
  • gene expression;
  • COX4;
  • PDK4

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

Reasons for performing study: The role of molecular signalling pathways in the phenotypic adaptation of skeletal muscle to different exercise stimuli in the Thoroughbred horse has not been reported previously.

Objective: To examine CKM, COX4I1, COX4I2 and PDK4 gene expression following high intensity sprint and moderate intensity treadmill exercise stimuli in skeletal muscle of Thoroughbred horses.

Materials and methods: Two groups of trained 3-year-old Thoroughbred horses participated. Group A (n = 6 females, n = 3 males) participated in an incremental step test (moderate intensity) to fatigue or HRmax on a Sato high speed treadmill (distance = 5418.67m ± 343.21). Group B (n = 8 females) participated in routine ‘work’ (sprint) on an all-weather gallop (distance = 812.83 m ± 12.53). Biopsy samples were obtained from the gluteus medius pre-exercise (T0), immediately post exercise (T1) and 4 h post exercise (T2). For physiological relevance venous blood samples were collected to measure plasma lactate and creatine kinase concentrations. Changes in mRNA expression were determined by quantitative real-time RT-PCR for creatine kinase muscle (CKM), cytochrome c oxidase subunit IV isoform 1 (COX4I1), cytochrome c oxidase subunit IV isoform 2 (COX4I2) and pyruvate dehydrogenase kinase, isozyme 4 (PDK4) genes. Statistical significance (α<0.05) was determined using Student's t tests.

Results:COX4I2 mRNA expression decreased significantly in Group A and remained unchanged in Group B between T0 vs. T2 (−1.7-fold, P = 0.017; −1.0-fold, P = 0.859). PDK4 mRNA expression increased significantly in Group B but not in Group A between T0 vs. T1 (3.8-fold, P = 0.039; 1.4-fold, P = 0.591). There were no significant changes in the expression in CKM or COX4I1 mRNA abundance in either group.

Conclusions: Different exercise protocols elicit variable transcriptional responses in key exercise relevant genes in equine skeletal muscle due to variation in metabolic demand.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

Mammalian skeletal muscle demonstrates a very high degree of plasticity and adapts readily to different modes of exercise. The main factor which influences the adaptive response of muscle to exercise is whether the training regime involves resistance or endurance type exercise. Other factors include the type of contractions, exercise intensity and oxygen levels, i.e. whether exercise is performed under normoxic or hypoxic conditions.

Endurance training results in a high VO2max and enhanced aerobic metabolism. In man, this is brought about partly through an increase in the volume density of mitochondria and muscular capillarisation by up to 40 and 30%, respectively (Hoppeler et al. 1985) along with a shift in muscle fibre type leading to an increased proportion of oxidative fibres. Numerous equine studies have also confirmed an increase in VO2max and an increase in oxidative enzymes (Roneus et al. 1992; Roneus 1993; Katz et al. 1999; Serrano et al. 2000; Hinchcliff et al. 2002; McGowan et al. 2002). An increase in type IIa muscle fibres and a concurrent decrease in type IIX fibres is also observed in Thoroughbreds following a period of training (Rivero et al. 2006). In man, the main metabolic adaptations are an upregulation of oxidative metabolism (Holloszy and Coyle 1984), a shift in substrate preference from carbohydrates to fatty acids and reduced lactate accumulation. Fatty acid oxidation plays an increasingly important role in sustained moderate exercise and greater levels of intramuscular lipids have been observed in athletic species (Vock et al. 1996). This has a carbohydrate sparing effect resulting in a slower rate of muscle glycogen depletion.

In man, resistance exercise brings about increases in strength through muscle hypertrophy. Exercise-induced mechanical stress damages muscle causing an alteration in protein turnover with a net increase in protein leading to muscle hypertrophy. In general, little or no change is observed in mitochondrial volume or oxidative capacity; however, a greater reliance on the creatine phosphate pathway and glycogenolysis (Tesch et al. 1986) has been reported following strength training.

While the physical and metabolic adaptations to exercise training have been well described, the underlying genetic contributions to these adaptations are largely unknown in the horse. The central dogma of genetics is that the structural genomic component, DNA is transcribed to RNA which in turn is translated to protein. Therefore, changes in RNA expression are indicative of changes in protein content. However, there is also post transcriptional regulation of protein levels and mRNA abundance is therefore not an exact reflection of the level of protein. Exercise studies using human subjects have demonstrated that changes in the expression of a wide range of mRNA transcripts play a major role in the adaptive response of muscle to exercise (Booth and Baldwin 1996; Neufer et al. 1996; Hood 2001; Fluck and Hoppeler 2003). Furthermore, in the horse, an equine microarray study has shown that a large number of genes are differentially expressed in equine skeletal muscle following a standardised exercise test (McGivney et al. 2009).

In a parallel hypothesis-driven study in a cohort of untrained horses, significant differences in gene expression were detected for 6 genes (CKM, COX4I1, COX4I2, PDK4, PPARGC1A and SLC2A4) 4 h after a single-bout of treadmill exercise (Eivers et al. 2009a). These genes are involved in oxygen-dependent metabolism, glucose metabolism and fatty acid utilisation. The treadmill exercise was of moderate intensity; a standard exercise test protocol which requires both endurance and strength and is commonly employed in equine exercise physiology studies was used.

The aim of the present study was to investigate CKM, COX4I1, COX4I2, and PDK4 gene expression following sprint and moderate intensity exercise stimuli in skeletal muscle of trained Thoroughbred horses. These genes were selected as they had previously been shown to respond to a bout of treadmill exercise in untrained equine skeletal muscle and we hypothesised that resistance exercise such as sprinting may result in a different pattern of gene expression (Eivers et al. 2009a) in this set of genes.

Local hypoxia is an important stimulus for structural and functional changes in skeletal muscle (Ameln et al. 2005). The master regulator of the response to hypoxia, hypoxia inducible factor-1 alpha (HIF-1α) regulates the oxidative enzyme COX4 (cytochrome c oxidase, subunit 4) in an oxygen dependent manner by alternately recruiting the isoforms COX4-1 (COX4I1) and COX4-2 (COX4I2) (Fukuda et al. 2007). In normal oxygen concentrations gene expression of COX4I1 is increased and COX4I2 is repressed. Alternatively, under conditions of reduced oxygen, HIF-1α activity is increased along with a number of downstream genes including COX4I2 and a mitochondrial protease gene LONP1, required for COX4I1 protein degradation. It has been proposed that the COX4 subunit switching ensures maximum efficiency of respiration under different oxygen conditions (Fukuda et al. 2007).

Creatine kinase, muscle (CKM) was selected as a candidate gene for this study as creatine kinases play a crucial role as energy stores in tissues with fluctuating energy demands. Furthermore, CKM is utilised during anaerobic respiration and therefore variation in CKM mRNA abundance may result from variable metabolic requirements during sprint and moderate intensity exercise.

Regulation of glucose/carbohydrate metabolism is tightly controlled by pyruvate dehydrogenase kinase (PDK) via phosphorylation of pyruvate dehydrogenase complex (PDC). During and following exercise, increased energy demands result in a shift towards alternative energy producing pathways. The PDK isoforms alternatively regulate carbohydrate metabolism depending on the duration and intensity of exercise. In particular PDK4 has been shown to respond to a single-bout of treadmill exercise, and therefore mRNA transcripts for PDK4 were measured in this study.

In this study we have investigated whether the different exercise regimes, which require different metabolic regulation, induce variable transcriptional responses for CKM, COX4I1, COX4I2, and PDK4 in skeletal muscle. In particular, we hypothesised that sprint exercise would induce the metabolic switch from a preference for COX4I1 to COX4I2 in the respiratory chain, which would be reflected in an increase in COX4I2 gene expression and a parallel decrease in the expression of COX4I1.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

All animal procedures were approved by the University College Dublin, Animal Research Ethics Committee, a licence was granted from the Department of Health and Children, Ireland and owners' consent was obtained for all horses.

Subjects

Group A: Three-year-old Thoroughbred horses (mean age: 31.78 ± 1.48 months) trained for flat racing (n = 6 females, n = 3 entire males) were raised and trained on the same farm for the previous 12 months. The mean weights and heights of the subjects were 447.11 ± 28.96 kg and 162.44 ± 4.30 cm.

Group B: Three-year-old Thoroughbred horses (mean age: 32.57 ± 2.37 months) trained for flat racing (n = 8 females) were raised and trained on the same farm for the previous 12 months. The mean weights and heights of the subjects were 440.62 ± 24.35 kg and 160.88 ± 3.44 cm.

Exercise protocol

Moderate intensity treadmill exercise protocol:Group A participated in a standardised incremental-step exercise test (Rose et al. 1990) on a high-speed equine treadmill1. The treadmill was set to a 6° incline. The warm-up consisted of 2 min at 2 m/s, followed by 2 min at 4 m/s and 2 min at 6 m/s. Warm-up was followed by an increase in treadmill velocity in 2 m/s increments to 10 m/s and then a 1 m/s increase in treadmill velocity every 60 s until the animal was no longer able to maintain its position on the treadmill at that speed or until the heart rate reached a plateau (HRmax). Heart rate (HR) was measured continuously by telemetry (Polar Equine S810i heart rate monitor system)2.

Sprint exercise protocol:Group B (n = 8 females) participated in routine ‘work’ (sprint) on an all-weather gallop. The exercise protocol was as follows: Horses were warmed-up on a horse walker for 10 min (walk and trot) and were then walked in-hand under saddle for 5–10 min. On the gallop horses walked for 300 m, trotted for 700 m, walked for approximately 100 m and then galloped up to Vmax for 812 ± 12.53 m. Instrumentation was performed prior to warm-up. Each horse was fitted with a HR telemetry system (Polar Equine S810i heart rate monitor system)2 and riders carried a hand-sized GPS unit3. The GPS unit recorded variables including speed, duration, distance and altitude.

Blood samples for plasma lactate: Venous blood samples were collected before and 5 min after exercise and placed in fluoride oxalate tubes and kept at −80°C until determination of plasma lactate concentrations using the L-Lactate randox kit4 and RX imola4 (Randox).

Muscle biopsy sampling

Percutaneous needle muscle biopsies (Lindholm and Piehl 1974) were obtained from the dorsal compartment of the gluteus medius muscle (Dingboom et al. 1999) using a 6 mm diameter, modified Bergstrom biopsy needle5. Biopsy samples intended for mRNA gene expression analyses were preserved in RNAlater6. Muscle biopsy samples were collected at rest pre-exercise (T0), immediately post exercise (T1) and 4 h post exercise (T2). The time points were chosen in order to examine both the immediate and delayed response to exercise (Mahoney et al. 2005).

RNA isolation and purification

Total RNA was extracted from approximately 100 mg tissue, using a protocol combining TRIzol reagent7, DNase treatment (RNase free DNase)8, UK and RNeasy Mini-Kit8. RNA was quantified using a Nano Drop ND1000 spectrophotometer V 3.5.27 and RNA quality and purity were assessed using the 18S/28S ratio and RNA integrity number (RIN) on an Agilent Bioanalyser with the RNA 6000 Nano LabChip kit6. The RNA isolated from Group A had an average RNA integrity number (RIN) of 7.66 ± 0.15 (range 6.3–8.3) and Group B had an average RIN of 7.39 ± 0.24 (range 7.1–8.2).

cDNA synthesis and real time quantitative RT-PCR (qRT-PCR)

Two µg of total RNA from each sample was reverse transcribed to cDNA with 50 µmol/l oligo(dT) primers using a SuperScript III first strand synthesis SuperMix kit7. Real-time qRT-PCR reactions were carried out as described by O'Gorman and colleagues (O'Gorman et al. 2006) using the Applied Biosystems 7500 Fast qRT-PCR system11. Reactions were performed in duplicate and control samples (NTC- no template controls) were run for each primer set.

Intron spanning primers for real time qRT-PCR were designed using the Vector NTI Advance software package7 or Primer3-web 0.3.0 version (http://www.primer3.sourceforge.net) and were commercially synthesised7,12 as previously described (Eivers et al. 2009b). Details of primer sets, including the previously validated reference gene Titin (TTN) (Eivers et al. 2009a) are given in Table 1.

Table 1. Equine oligonucleotide primers for real-time qRT-PCR
Gene symbolGene nameForward primer sequence (5′–3′)Reverse primer sequence (5′–3′)Amplicon size (bp)
CKMCreatine kinase, muscleAACTACAAGCCCGAAGAGCATCATCCAGAGTGAAGC130
COX4I1Cytochrome c oxidase subunit IV isoform 1ACGAGAGCTTTGCTGAAATGTGCTTCTCCCAGATCAGAAG109
COX4I2Cytochrome c oxidase subunit IV isoform 2TACACCAACTACCACGCCCAGCAGCTGCCCTTCTCCTTCTCCTTC106
PDK4Pyruvate dehydrogenase kinase, isozyme 4GCTGGTTTTGGTTATGGCTTGCTCCACAGACTCAGAAGACAAAGCC137
TTNTitinGCATGACACAACTGGAAAGCAACTTTGCCCTCATCAATGC 
Table 2. Physiological and biochemical details for subjects before and after exercise
 Group AGroup B
Means.d. (±)Means.d. (±)
Resting heart rate (beats/min)49.33313.93739.257.09
Maximum heart rate (beats/min)226.566.6729224.0022.96
Maximum velocity (m/s)13.7220.32716.40.21
Distance (m)5418.7343.21812.8312.53
Exercise time11.3330.8661.100.07
Pre-exercise lactate T0 (mmol/l)0.640.15960.590.15
Post exercise lactate T1 (mmol/l)14.3683.007732.182.40

Data analysis

Gene expression values were calculated using the relative standard curve (Applied Biosystems User Bulletin 2) method and all values normalised to the previously validated reference gene TTN (Eivers et al. 2009a). Analysis was performed using the Student's t tests (paired, 2-tailed test) to identify differently expressed genes between samples at the time-points (T0 vs. T1; T0 vs. T2) and to evaluate significant differences in lactate concentrations between time-points and between Groups A and B.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

This study describes mRNA transcript profiles for CKM, COX4I1, COX4I2 and PDK4 genes in equine skeletal muscle following 1) moderate intensity exercise and 2) sprint exercise.

Exercise parameters

Group A: Following warm-up, the exercise test comprised an average of 9 (range 8–10) incremental steps achieving a mean maximum velocity of 13.72 ± 0.33 m/s and a mean distance of 5418.67 ± 343.21 m for an average duration of 11.33 ± 0.87 min. Mean peak post exercise lactate concentration ([La]T1) was 14.37 ± 3.01 mmol/l. This was significantly (P<0.0001) higher than pre-exercise values.

Group B: Following warm-up, the exercise test comprised a mean maximum velocity of 16.4 ± 0.21 m/s and a mean distance of 812.83 m ± 12.53 m for an average duration of 1.10 ± 0.07 min. Mean peak post exercise lactate concentration ([La]T1) was 32.18 ± 2.40 mmol/l. This was significantly (P<0.0001) higher than pre-exercise values and significantly (P<0.0001) higher than the post exercise lactate levels in Group A. An overview of the exercise parameters for both groups is given in Table 2.

Skeletal muscle mRNA expression following exercise

To investigate the effect of different exercise stimuli (moderate intensity and sprint) on skeletal muscle mRNA expression we analysed by real-time qRT-PCR the gene expression responses of 4 genes. Real-time qRT-PCR was performed for skeletal muscle samples collected before exercise (T0), immediately post exercise (T1) and 4 h post exercise (T2). Table 3 shows the relative mean fold differences between pre- and post exercise time-points (T0 vs. T1; T0 vs. T2) for both exercise stimuli.

Table 3. Relative gene expression fold changes between time-points following treadmill (moderate intensity) exercise in Group A and gallop (sprint/high intensity) exercise in Group B
Gene symbolT0 vs. T1T0 vs. T2
EnduranceSprintEnduranceSprint
Fold changeP valueFold changeP valueFold changeP valueFold changeP value
CKM1.110.091.520.071.060.501.200.17
COX4I11.080.201.430.101.020.771.230.25
COX4I21.280.091.250.15-1.730.02-1.010.86
PDK41.370.593.760.042.320.211.770.27

Immediately post exercise (T0 vs. T1) there were no significant transcriptomic differences following moderate intensity exercise. However, following sprint exercise the PDK4 gene had significantly increased expression relative to pre-exercise levels at T1: PDK4 (+3.8-fold, P = 0.034). Analyses of mRNA profiles 4 h post exercise (T0 vs. T2) revealed a significant decrease in COX4I2 (-1.7-fold, P = 0.017) transcripts following moderate intensity exercise, but not following sprint exercise. No transcript changes were observed for CKM or COX4I1 at either time point following either exercise stimuli. Graphical representations of mean fold-changes following exercise are shown relative to pre-exercise values in Figure 1.

image

Figure 1. Relative gene expression fold changes between time-points following treadmill (moderate intensity) exercise in Group A and gallop (sprint/high intensity) exercise in Group B. Black bars represent Group A (moderate intensity) and grey bars represent Group B (sprint/high intensity). An asterisk denotes P values <0.05 determined by paired Student's t tests.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

The evaluation of skeletal muscle gene expression responses to exercise in man is a rapidly growing area of research (Mahoney et al. 2005; Klossner et al. 2007; Louis et al. 2007). In the horse, while the physiological and metabolic adaptations to exercise are well described, the transcriptional alterations leading to these adaptations are largely unknown. We report here for the first time, the comparison of equine skeletal muscle gene expression responses to 2 different exercise regimes in trained Thoroughbred horses for 4 genes that have previously been shown to have significant relationships with exercise responses in untrained Thoroughbred horses (Eivers et al. 2009a).

In this study we investigated whether different exercise protocols would illicit variable COX4 isoform transcriptional responses due to variation in oxygen availability. Previously we have reported a significant decrease in COX4I2 mRNA 4 h post exercise in untrained (-2.0-fold; P<0.001) Thoroughbreds with a concomitant increase in COX4I1 expression at the same time point (+1.4-fold; P = 0.003) (Eivers et al. 2009b). This pattern is consistent with sufficient oxygen availability during moderate intensity exercise. Also, while COX4I1 transcripts were found to increase significantly in untrained samples, significant increases in COX4I1 expression were not observed in trained samples post exercise. However, basal COX4I1 transcript levels were increased following training, which may reflect a long-term adaptive response resulting in increased mitochondrial capacity (Eivers et al. 2009a).

We report here for the first time that the significant reduction in COX4I2 transcription observed following moderate intensity exercise, was not detected following sprint exercise. This is a tentative indication that shorter duration (i.e. <75 s), higher intensity exercise in trained individuals may illicit a HIF-mediated COX4 subunit switching response. The alternative recruitment of the COX4 isoforms may be required for optimal efficiency of mitochondrial respiration in different oxygen environments. These data suggest a cellular requirement for the genetic control of different metabolic activity during different exercise stimuli. However, as post exercise COX4I1 transcription has been previously reported to be blunted in trained individuals, likely as a result of higher basal COX4I1 levels (Eivers et al. 2009a), the optimal experiment in which to further evaluate this hypothesis would be to investigate gene expression responses following sprint exercise in a cohort of untrained individuals. The training regimes imposed on young, untrained Thoroughbred horses and the gradual build up to sprint exercise (‘work’ days) means that this may be difficult to test in practice.

However, in further support of the importance of this gene in the exercise response, we have reported a single nucleotide polymorphism (SNP) variant in COX4I2 genomic sequence significantly associated with elite racing performance in Thoroughbred horses (Gu et al. 2010). In particular, the SNP is strongly associated with elite sprint racing performance, further supporting the hypothesis that this gene is a key regulator of the metabolic response to high intensity short duration exercise.

The importance of creatine kinase muscle (CKM) to the skeletal muscle phenotype has been shown in recent studies of functional and structural genomic variation in Thoroughbreds. In a digital gene expression (DGE) study evaluating mRNA transcripts in the equine skeletal muscle transcriptome, CKM was found to be the most abundantly expressed gene representing 6.9% of the annotated transcriptome (McGivney et al. 2010). Furthermore, there is preliminary evidence to suggest that a SNP in the CKM gene is associated with racing performance in Thoroughbreds (Gu et al. 2010). Variation in mRNA abundance was not observed for CKM transcripts in this study. However, regulation of CKM protein may due to post translational mechanisms or it may be that the transcriptional adaptation to exercise is elicited in a different time frame to the sampling timepoints in this study.

We also observed in this study a significant increase in PDK4 mRNA transcripts immediately following sprint exercise, that has not been observed previously. This is in contrast to the situation following moderate intensity exercise in which PDK4 transcripts are not detected until the recovery phase (i.e. 4 h post exercise). The utilisation of glucose is tightly regulated by the assembly of the pyruvate dehydrogenase complex (PDC) which is controlled by pyruvate dehydrogenase kinase. PDK blocks the formation of the PDC resulting in the beta-oxidation of fatty acids to acetyl-CoA as the substrate for oxidative phosphorylation. The observed increase in PDK4 mRNA expression immediately following sprint exercise suggests a role for PDK4 protein in the exercise response. The pyruvate dehydrogenase complex is negatively regulated by PDK4, resulting in decreased glucose oxidation (sparing glucose) concomitant with increased fatty acid oxidation. Remarkably, following high-intensity exercise, that resulted in very high post exercise lactate accumulation, this response was immediate and large (+3.8-fold). We have also identified a SNP in PDK4 genomic sequence that is significantly associated with favourable racetrack performance (Hill et al. 2010), suggesting a key role for PDK4 regulation following exercise.

An understanding of the genes responsible for the structural adaptations and the control of metabolic responses to exercise lend a novel perspective to the increasing wealth of research underpinning the study of exercise physiology in the horse.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

The authors thank trainer J.S. Bolger for access to horses. We thank B. O'Connor, P. O'Donovan, A Martin and J.S. Bolger yard staff for assistance with exercise experiments.

Manufacturers' addresses

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References

1 Sato, Sato AB, Knivsta, Sweden.

2 Polar 145 Electro Ltd, Warwick , UK.

3 GPSports Systems SPI10, Canberra, Australia/

4 Randox, Antrim, UK.

5 Jørgen Kruuse, Vet Supplies and Ambion UK.

6 Invitrogen, Paisley, UK

7 Qiagen Ltd, Crawley, UK.

8 NanoDrop Technologies, Wilmington, Delaware.

9 Agilent Technologies Ireland Ltd, Dublin, Ireland

10 Apperla (ABI), Dublin, Ireland

11 MWG Biotech, Germany

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. Manufacturers' addresses
  10. References
  • Ameln, H., Gustafsson, T., Sundberg, C.J., Okamoto, K., Jansson, E., Poellinger, L. and Makino, Y. (2005) Physiological activation of hypoxia inducible factor-1 in human skeletal muscle. FASEB J. 19, 1009-11.
  • Booth, F.W. and Baldwin, K.M. (1996) Muscle plasticity: energy demanding and supply processes. In: Handbook of Physiology, Eds: L.BRowell and J.T.Shepherd, Oxford University Press, New York. pp 1075-1123.
  • Dingboom, E.G., Dijkstra, G., Enzerink, E., Van Oudheusden, H.C. and Weijs, W.A. (1999) Postnatal muscle fibre composition of the gluteus medius muscle of Dutch Warmblood foals; maturation and the influence of exercise. Equine vet. J. Suppl. 31, 95-100.
  • Eivers, S.S., McGivney, B.A., Fonseca, R.G., Machugh, D.E., Menson, K., Park, S.D., Rivero, J.L., Taylor, C.T., Katz, L.M. and Hill, E.W. (2009a) Alterations in oxidative gene expression in equine skeletal muscle following exercise and training. Physiol. Genomics. 2010 Jan 8; 40(2):83-93.
  • Eivers, S.S., McGivney, B.A., Fonseca, R.G., MacHugh, D.E., Menson, K., Park, S.D., Rivero, J.L., Taylor, C.T., Katz, L.M. and Hill, E.W. (2009b) Exercise-Induced Skeletal Muscle Gene Expression in Unconditioned and Conditioned Thoroughbred Horses and Associations with Physiological Variables, University College Dublin, Dublin.
  • Fluck, M. and Hoppeler, H. (2003) Molecular basis of skeletal muscle plasticity – from gene to form and function. Rev. Physiol. Biochem. Pharmacol. 146, 159-216.
  • Fukuda, R., Zhang, H., Kim, J.W., Shimoda, L., Dang, C.V. and Semenza, G.L. (2007) HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells. Cell 129, 111-122.
  • Gu, J., MacHugh, D.E., McGivney, B.A., Park, S.D., Katz, L.M. and Hill, E.W. (2010) Association of sequence variants in CKM (creatine kinase, muscle) and COX4I2 (cytochrome c oxidase, subunit 4, isoform 2) genes with racing performance in Thoroughbred horses. Equine vet. J., Suppl. 42, 569-575.
  • Hill, E.W., Gu, J., McGivney, B.A. and MacHugh, D.E. (2010) Targets of selection in the Thoroughbred genome contain exercise-relevant gene SNPs associated with elite racecourse performance. Anim. Genet. (in press).
  • Hinchcliff, K.W., Lauderdale, M.A., Dutson, J., Geor, R.J., Lacombe, V.A. and Taylor, L.E. (2002) High intensity exercise conditioning increases accumulated oxygen deficit of horses. Equine vet. J. 34, 9-16.
  • Holloszy, J.O. and Coyle, E.F. (1984) Adaptations of skeletal muscle to endurance exercise and their metabolic consequences. J. appl. Physiol. 56, 831-838.
  • Hood, D.A. (2001) Invited Review: contractile activity-induced mitochondrial biogenesis in skeletal muscle. J. appl. Physiol. 90, 1137-1157.
  • Hoppeler, H., Howald, H., Conley, K., Lindstedt, S.L., Claassen, H., Vock, P. and Weibel, E.R. (1985) Endurance training in humans: aerobic capacity and structure of skeletal muscle. J. appl. Physiol. 59, 320-327.
  • Katz, L.M., Bayly, W.M., Hines, M.T. and Sides, R.H. (1999) Differences in the ventilatory responses of horses and ponies to exercise of varying intensities. Equine vet. J., Suppl. 30, 49-51.
  • Klossner, S., Dapp, C., Schmutz, S., Vogt, M., Hoppeler, H. and Fluck, M. (2007) Muscle transcriptome adaptations with mild eccentric ergometer exercise. Pflugers Arch. 455, 555-562.
  • Lindholm, A. and Piehl, K. (1974) Fibre composition, enzyme activity and concentrations of metabolites and electrolytes in muscles of standardbred horses. Acta vet. Scand. 15, 287-309.
  • Louis, E., Raue, U., Yang, Y., Jemiolo, B. and Trappe, S. (2007) Time course of proteolytic, cytokine, and myostatin gene expression after acute exercise in human skeletal muscle. J. appl. Physiol. 103, 1744-1751.
  • Mahoney, D.J., Parise, G., Melov, S., Safdar, A. and Tarnopolsky, M.A. (2005) Analysis of global mRNA expression in human skeletal muscle during recovery from endurance exercise. FASEB J. 19, 1498-1500.
  • McGivney, B.A., Eivers, S.S., Machugh, D.E., Macleod, J.N., O'Gorman, G.M., Park, S.D., Katz, L.M. and Hill, E.W. (2009) Transcriptional modifications following exercise in Thoroughbred horse skeletal muscle highlight molecular mechanisms that lead to muscle hypertrophy. BMC Genomics 10, 638.
  • McGivney, B.A., McGettigan, P.A., Browne, J.A., Evans, A.C., Fonseca, R.G., Lohan, A.J., Loftus, B.J., MacHugh, D.E., Murphy, B.A., Katz, L.M. and Hill, E.W. (2010) Characterization of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training. BMC Genomics 11, 398.
  • McGowan, C.M., Golland, L.C., Evans, D.L., Hodgson, D.R. and Rose, R.J. (2002) Effects of prolonged training, overtraining and detraining on skeletal muscle metabolites and enzymes. Equine vet. J., Suppl. 34, 257-263.
  • Neufer, P.D., Ordway, G.A., Hand, G.A., Shelton, J.M., Richardson, J.A., Benjamin, I.J. and Williams, R.S. (1996) Continuous contractile activity induces fiber type specific expression of HSP70 in skeletal muscle. Am. J. Physiol. 271, C1828-C1837.
  • O'Gorman, G.M., Park, S.D., Hill, E.W., Meade, K.G., Mitchell, L.C., Agaba, M., Gibson, J.P., Hanotte, O., Naessens, J., Kemp, S.J. and MacHugh, D.E. (2006) Cytokine mRNA profiling of peripheral blood mononuclear cells from trypanotolerant and trypanosusceptible cattle infected with Trypanosoma congolense. Physiol. Genomics 28, 53-61.
  • Rivero, J.L., Ruz, A., Marti-Korfft, S. and Lindner, A. (2006) Contribution of exercise intensity and duration to training-linked myosin transitions in thoroughbreds. Equine vet. J., Suppl. 36, 311-315.
  • Roneus, M. (1993) Muscle characteristics in standardbreds of different ages and sexes. Equine vet. J. 25, 143-146.
  • Roneus, M., Essen-Gustavsson, B., Lindholm, A. and Persson, S.G. (1992) Skeletal muscle characteristics in young trained and untrained standardbred trotters. Equine vet. J. 24, 292-294.
  • Rose, R.J., Hendrickson, D.K. and Knight, P.K. (1990) Clinical exercise testing in the normal thoroughbred racehorse. Aust. vet. J. 67, 345-348.
  • Serrano, A.L., Quiroz-Rothe, E. and Rivero, J.L. (2000) Early and long-term changes of equine skeletal muscle in response to endurance training and detraining. Pflugers Arch. 441, 263-274.
  • Tesch, P.A., Colliander, E.B. and Kaiser, P. (1986) Muscle metabolism during intense, heavy-resistance exercise. Eur. J. appl. Physiol. Occup. Physiol. 55, 362-366.
  • Vock, R., Hoppeler, H., Claassen, H., Wu, D.X., Billeter, R., Weber, J.M., Taylor, C.R. and Weibel, E.R. (1996) Design of the oxygen and substrate pathways. VI. structural basis of intracellular substrate supply to mitochondria in muscle cells. J. expt. Biol. 199, 1689-1697.