SEARCH

SEARCH BY CITATION

Keywords:

  • horse;
  • laminitis;
  • matrix metalloprotease;
  • ADAMTS;
  • TIMP

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

Reason for performing study: The role of matrix metalloproteases (MMPs) and the timeline of proteolysis during laminitis development are incompletely understood.

Objectives: To determine the temporal progression of selected MMPs and protease regulators during laminitis development.

Methods: Five clinically normal Standardbred horses received, via nasogastric intubation, an oligofructose (OF) bolus (10 g/kg bwt). Laminitis induction proceeded for 48 h followed by euthanasia. Lamellar biopsies were obtained prior to dosing and at intervals during the treatment period for analysis (12, 18, 24, 30 and 36 h and at 48 h following euthanasia). Tissue samples were analysed by real-time PCR, zymography and western blotting.

Results: Activation of proMMP-2 occurs either simultaneously or at least 12 h following lamellar basement membrane (BM) damage, while no activation of proMMP-9 is seen during OF laminitis induction. Aggrecanase gene expression increased initially at 12–18 h post OF dosing, similar to BM changes. Gene expression of TIMP-2, a MMP regulator, decreases during laminitis development.

Conclusions: The MMP-2/MT1-MMP complex may not play a major role in initiating lamellar BM damage. Aggrecanase and TIMP-2 gene expression appear related to BM lamellar changes.

Potential relevance: MMPs, historically thought to cause laminitis, do not appear to play an initiating role in the lamellar lesion. Other host derived proteases and degradation of alternative lamellar matrix components need to be considered.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

Laminitis compromises the lamellar suspensory apparatus of the distal phalanx (Pollitt 2010). There is evidence that the lamellar basement membrane (BM) is the histological site of the primary laminitis lesion (Pollitt 1996; Pollitt and Daradka 1998), but the molecular mechanism and progression of events is not completely elucidated.

A major question of laminitis pathogenesis is the role of proteases in lamellar BM degradation and dysadhesion. The matrix metalloprotease (MMP) family is comprised of at least 24 members, which degrade a variety of extracellular matrix (ECM) components including BM laminins (Ln) and collagens as well non-ECM molecules (Chakraborti et al. 2003). The gelatinases, MMP-2 and MMP-9 as well as the membrane bound MT1-MMP are increased during the acute phase of carbohydrate laminitis (Johnson et al. 1998; Pollitt et al. 1998; Kyaw-Tanner and Pollitt 2004; Kyaw-Tanner et al. 2008). However, the factor(s) responsible for activation of these and possibly other MMPs during laminitis development is yet to be determined. A second metalloprotease family is the A disintegrin-like and metalloprotease with thrombospondin motifs (ADAMTS) family. These secreted proteases consist of at least 20 members, of which ADAMTS-4 (aggrecanase) degrades the proteoglycan of cartilage matrix (Tortorella et al. 1999; Jones and Riley 2005). Equine ADAMTS-4 has recently been cloned and found to be upregulated in both natural cases and laminitis induction models (Budak et al. 2009; Coyne et al. 2009). Proteases produced by inflammatory cells also play roles in ECM degradation. MMP-9 is produced in tertiary granules of neutrophils (Cowland and Borregaard 1999), while the serine proteases neutrophil elastase and cathepsin are present in primary granules (Owen 2008). While MMP-9 has long been associated with laminitis (Johnson et al. 1998; Pollitt et al. 1998), neutrophil elastase has also been shown recently to increase (de la Rebiere de Pouyade et al. 2009).

Control of protease expression and activation is normally tightly regulated, being expressed only as required in processes such as tissue development and remodelling. However, many pathological conditions in both human and veterinary medicine such as cancer, arthritis and fibrosis, result from an imbalance between MMP activation and inhibition (Clutterbuck et al. 2008). MMPs are regulated by transcriptional activation or repression, proenzyme activation by removal of the propeptide and inhibition by tissue inhibitors of MMPs (TIMPs) (Sternlicht and Werb 2001; Visse and Nagase 2003; Clark et al. 2008; Kessenbrock et al. 2010).

Our group has established that loss of the BM components, Ln-332 and collagen type IV, as well as changes specific to the Ln-332 γ2 subunit, occur early in the lamellar BM during carbohydrate laminitis induction and prior to clinical signs of lameness (Visser and Pollitt 2011). The aim of this study was to correlate the progression of protease activation and proteaseregulator expression with previously observed BM degradation events in the same tissue samples during carbohydrate-induced laminitis (Visser and Pollitt 2011).

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

Experimental model and tissue collection

Laminitis was experimentally induced in normal Standardbred horses (age range 5–9 years) by alimentary carbohydrate overload using oligofructose (OF) (10 g/kg bwt) (van Eps and Pollitt 2006). Hoof lamellar biopsies (approximately 10 × 10 mm square) were collected prior to OF dosing and at 12, 18, 24, 30 and 36 h post OF dosing (POD), with the horse standing, sedated with the appropriate digital nerve blocked with local anaesthetic (Croser and Pollitt 2006). At 48 h POD, following euthanasia by overdose of barbiturate, lamellar samples were also obtained below the lateral and central biopsy sites. Experiments were conducted according to the animal ethics guidelines set by The University of Queensland Animal Ethics Committee. All animals were continuously monitored and inspected by the Consultant Veterinary Officer to the Animal Welfare Unit at the University of Queensland. If pain could not be alleviated promptly, early euthanasia, even if this was prior to the planned conclusion of the experiment, was a proviso of the protocol. For protein extraction and RNA isolation, tissue samples were flash frozen in liquid nitrogen and stored at -80°C.

Real time PCR

Total RNA was isolated from frozen hoof tissue using Trizol1. Tissue samples were homogenised in Trizol reagent1 (1 ml/100 mg tissue) using a power homogeniser2. RNA samples were treated with RNAse free DNAse3 to remove genomic DNA prior to cDNA synthesis. cDNA was synthesised from 1 µg of total RNA using the reverse transcription system3 with random hexamer primers3.

Gene expression in tissue samples was measured using real-time PCR analysis. Primer sequences were designed to equine-specific sequences using Primer Express software4. Oligonucleotides were synthesised by Sigma Genosys5. Primer sequences, concentrations and amplicon sizes are listed in Table 1. PCR reactions were performed in 10 µl reaction volumes in 384 well plates prepared using an epMotion 5075 robot6. PCR reactions consisted of 5 µl SYBR Green Master Mix4, 2 µl cDNA (1:5), 2 µl primer mix and 1 µl H2O. Reactions were carried out in triplicate using as AB7900 thermocycler4. Reaction conditions consisted of a initial denaturation step of 95°C for 10 min, followed by 50 cycles of denaturation 95°C for 15 s and elongation of 60°C for 1 min. Following amplification, melting curve analysis was subsequently performed by one cycle of 95°C, 2 min, 60°C, 15 s and 95°C, 15 s. Relative gene expression levels, normalised to β-2 microglobulin, were determined using the comparative Ct method (2−ΔΔCt) (Livak and Schmittgen 2001). PCR products were analysed by standard agarose gel electrophoresis (Sambrook et al. 1989) to confirm the expected size of PCR product. Samples were electrophoresed on 2% agarose gels embedded with 0.5 µg/ml ethidium bromide followed by analysis by UV illumination.

Table 1.  Primer sequences used for real time PCR gene expression
Gene nameForward primerReverse primerAmplicon size (bp)Primer concentration (nmol/l)
β-2 microglobulinACCCAGCAGAGAATGGAAAGCCATCTTCTCTCCATTCTTTAGCAAATC101200
MMP-2TTCTTCTTCAAGGACCGGTTCAGAGCTCAGGCCAGAATGTGG95300
MMP-9CAGGCGTGGGCCAGTTCGTCGCGCGGCAAGTCT101200
MT1-MMPGCCCATCGGCCAGTTCTCCCAATGCTTATCCCCTTTGA101200
ADAM TS-4TCACCGGCACCATCAATGTGGAGTTCGGTCCCTCGATAC100200
TIMP-2TCTACGGCAACCCCATCAAGGGAGGGAGCCGTGTAGATGA101200
TIMP-3CCGGACAAGAGCATCATCAAGAAGTTAGTGTCCGAGGGAAGCT101200

SDS-PAGE and immol/lunoblotting

To prepare total protein extracts, lamellar tissue was ground to a powder under dry ice using a mortar and pestle, followed by homogenisation on ice using a power homogeniser2 in RIPA buffer (20 mmol/l Tris-HCl pH 7.5, 150 mmol/l NaCl, 1% Triton-X 100, 0.5% sodium deoxycholate, 0.1% SDS containing Complete Protease Inhibitors7 1 ml/100 mg tissue, 5 × 20 s). The cell suspensions were incubated on ice for 30 min with occasional vortexing. Samples were centrifuged 10,000 g, 10 min at 4°C and protein concentration of the supernatants determined using the BCA protein assay8. To determine levels of MT1-MMP expression and processing in lamellar samples, 100 µg of total protein was separated by SDS-PAGE. Gels were electro-transferred onto polyvinyl-D-fluoride (PVDF) Hybond-P membrane9 at 30 V for 16 h at 4°C. Membranes were blocked and washed in milk solution (20 mmol/l Tris-HCl pH 7.4, 150 mmol/l NaCl, 0.1% Tween-20, 5% skim milk powder) prior to incubation in MT1-MMP (clone 113 5B7) primary antibody10 overnight at 4°C. Membrane washing was repeated followed by incubation with an HRP-conjugated secondary antibody11 for 1 h at room temperature. After washing in PBS, antibody was detected by chemiluminescence using the Super Signal substrate8 as per the manufacturer's instructions. Optimal exposures were obtained by exposure to x-ray film and bands were scanned using Adobe Photoshop and analysed by densitometry using ImageJ 1.38.

Substrate zymography

To determine MMP substrate activity and visualise protease forms present in lamellar samples, substrate zymography was performed. Gelatin zymography was performed as in Mungall and Pollitt (1999) with some modification. Total protein samples (20 µg) were run on 10% SDS-PAGE gels containing 0.1% gelatin12 under nonreducing conditions, 90 min at 110 V. Commercial human MMP-210 and equine buffy coat samples (MMP-9) were used as standards. Gels were incubated twice in 2.5% Triton for 30 min to remove SDS, followed by incubation overnight at 37°C in zymography incubation buffer (50 mmol/l Tris-HCl pH 7.5, 5 mmol/l CaCl2). Gels were stained 1 h with Coomassie Brilliant Blue (30% methanol, 10% acetic acid containing 0.5% w/v Coomassie Brilliant Blue) followed by destaining (30% methanol, 10% acetic acid) until clear bands are visible on blue background. Casein zymography was performed as for gelatin zymography except gels were embedded with 0.1% casein12. Casein gels were prerun at 110 V for 20 min prior to loading of samples. Gels were dried and scanned using Adobe Photoshop and analysed by densitometry using ImageJ 1.38.

Data analysis

Group means (n = 5) of each time point compared to 0 h samples were analysed by ANOVA with the Dunnett post t test13. Significance was set at P<0.05. Graphs represent the mean ± s.e.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

Clinical and histological findings

All horses exhibited decreased appetite by 8 h POD and developed diarrhoea by 16 h. Digital pulses were initially detected at 13–29 h POD and all horses developed clinical signs of lameness, characterised by weight shifting, between 20–43 h POD (Croser and Pollitt 2006; Milinovich et al. 2007). Lameness was graded using the Obel grading scale (Obel 1948). Prior to euthanasia, Obel grades were as follows: Grade 1= one horse, Grade 2= one horse, Grade 3= 3 horses. Histological changes were observed by haematoxylin and eosin stain between 12–30 h POD (Croser and Pollitt 2006), while immunohistochemical changes in BM components were first observed at 12 h POD (Visser and Pollitt 2011).

Gelatinase expression during laminitis development

A representative gelatin zymogram from Horse 4 is shown in Figure 1a. Gelatin zymograms of lamellar tissue from 0 h biopsies contain small amounts of 92 kDa proMMP-9, 72 kDa proMMP-2 and 62 kDa active MMP-2 (Fig 1a). Increased expression of proMMP-9 was observed initially at 18–24 h POD in individual horses, however no processing to the active 82-kDa MMP-9 form was observed at any time (Figs 1a,b). Overall, the relative level of MMP-9 gene expression reflected protein levels, as gene expression increased as early as 12 h POD; however, significance was only observed at 24 h POD and later (Fig 1e).

image

Figure 1. Gelatinase expression and activation during laminitis development: a) a representative gelatin zymogram from one horse; b) densitometry analysis of proMMP-9 protein levels; c) proMMP-2 protein levels; d) active MMP-2 protein levels; e) RT-PCR gene expression levels; f) MMP-2 gene expression levels. All graphs are mean ± s.e. of 5 horses. RT-PCR results are expressed as relative fold change at each time point relative to 0 h. *P<0.05, **P<0.01 ANOVA by Dunnett test compared to 0 h.

Download figure to PowerPoint

Increased proMMP-2 expression was observed in lamellar biopsy tissues at 12–24 h in all horses (Figs 1a,c). Conversion of proMMP-2 to the active MMP-2 form occurred at 18–48 h POD (Figs 1a,d). Relative levels of MMP-2 gene expression did not reflect protein levels, as there was no significant increase (Fig 1f).

MT1-MMP expression during laminitis development

Lamellar tissue obtained from samples prior to OF dosing showed expression of proMT1-MMP. Increased levels of proMT1-MMP were observed only at 48 h POD; however, no processing to the active MT1-MMP form was observed (Fig 2a). Similarly, relative MT1-MMP gene expression levels did not show any significant change (Fig 2b).

image

Figure 2. MT1-MMP densitometry analysis and relative gene expression levels are shown in a) and b), respectively. Graphs depict mean ± s.e. of 5 horses. Densitometry represents average of western blotting results. RT-PCR results are expressed as relative fold change at each time point relative to 0 h. *P<0.05, ANOVA by Dunnett test compared to 0 h.

Download figure to PowerPoint

ADAMTS-4 expression during laminitis induction

Relative levels of ADAMTS-4 gene expression were increased at 12 h POD in 3 of 5 horses compared to time 0. All horses showed significantly increased levels of gene expression at 18–48 h POD dosing (Fig 3).

image

Figure 3. ADAMTS-4 gene expression during laminitis development. ADAMTS-4 relative gene expression was determined in lamellar tissue extracts. Graph is mean ± s.e. of 5 horses expressed as the relative fold change at each time point relative to time 0. *P<0.05, **P<0.01 ANOVA by Dunnett test compared to time 0 h.

Download figure to PowerPoint

TIMP expression during laminitis induction

Expression levels of the TIMP-2 gene were observed to decrease as early as 12 h POD in some horses, although significance was only observed from 30 h onwards (Fig 4a). Expression of TIMP-3 was variable among the horses throughout the biopsy timeline and thus no consistent trend in the gene expression can be confirmed (Fig 4b).

image

Figure 4. TIMP gene expression during laminitis development. Relative gene expression levels for TIMP-2 (a) and TIMP-3 (b) are shown. Graphs are mean ± s.e. of 5 horses. RT-PCR results are expressed as relative fold change at each time point relative to time 0. *P<0.05, **P<0.01 ANOVA by Dunnett test compared to time 0 h.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

Laminitis pathogenesis may involve dysregulation of MMP activity, a premise that links protease activity to lamellar basement membrane destruction and dysadhesion. It was inferred from increased MMP expression associated with laminitis, that these proteases were the causative agents of lamellar damage (Johnson et al. 1998; Pollitt et al. 1998; Kyaw-Tanner and Pollitt 2004; Kyaw-Tanner et al. 2008; Loftus et al. 2008, 2009). However, these studies involved single time point analyses, usually after clinical signs were manifest. Using our novel technique of lamellar biopsy during OF induction (Croser and Pollitt 2006; Visser and Pollitt 2011) we have determined that BM changes, including loss of collagen type IV and Ln-332, occur as early as 12 h POD, well before the appearance of laminitis clinical signs (Visser and Pollitt 2011). Here we report (using the same tissue samples) that conversion of proMMP-2 to its active form occurs simultaneously with or up to 12 h after detection of BM changes. Thus, we conclude that MMP-2 may not be the protease responsible for initiating the BM damage observed in carbohydrate overload laminitis.

Although MMP-2 may not be an initiating factor in laminitis, a role in intensifying BM damage cannot be ruled out. Thus, the mechanism of how this MMP is regulated during laminitis is still important to consider. One of the primary mechanisms of MMP regulation is at the level of transcription; however, in this study no increase in the level of MMP-2 gene transcription is observed. This is contrary to previous observations by our group (Kyaw-Tanner and Pollitt 2004) but similar to results obtained from samples at various time points induced with black walnut extract (BWE) (Loftus et al. 2006, 2007).

Similarly, there was no change in MT1-MMP transcription or activation. This further contradicts the notion of lamellar MMP-2 involvement and activation through the MT1-MMP/ TIMP-2 complex. A recent study also found that MT1-MMP gene expression itself as well as the MT1-MMP activator PACE4 were not significantly upregulated in either carbohydrate overload induction or chronic laminitis samples (Loftus et al. 2009). Additionally, decreased TIMP-2 gene expression was observed as early as 12 h POD. Thus our TIMP-2 gene expression data coincide with those of others (Kyaw-Tanner et al. 2008; Coyne et al. 2009) and add that TIMP-2 repression decreases as laminitis progresses. TIMP-2 is able to bind to and inhibit all MT-MMPs (Lambert et al. 2004). If TIMP-2 protein levels follow gene expression during laminitis development, as observed here, this may allow for uncontrolled activation of other BM degrading MT-MMPs and subsequent BM damage. Dysregulation of the MMP/TIMP balance during laminitis appears specific for TIMP-2 as there was no consistent change in gene expression of TIMP-3, similar to other reports (Coyne et al. 2009). Thus, either direct cleavage of BM components by MMP-2 or MT1-MMP or by subsequent protease activation relays are unlikely to be involved in early disease progression.

Other MMPs and protease families are also known to cleave BM components and activate additional proteases (Kessenbrock et al. 2010). Both MMP-3 and MMP-7 activate proMMP-2 (Crabbe et al. 1994; Wang et al. 2005) and process Ln-332 in vitro (Pirila et al. 2003), while MMP-7 degrades laminin and collagen type IV in intact BMs (Bejarano et al. 1988). However, preliminary casein zymography experiments did not detect significant expression or activation of these MMPs in lamellar extracts (Visser 2009). Additionally, gene expression of the collagenase MMP-13 is increased during carbohydrate-induced laminitis (Wang et al. 2009a). To date only MT1-MMP has been studied in laminitis samples, although all members of the MT-MMP family are able to activate proMMP-2 (Morrison et al. 2001; Nie and Pei 2003; Zhao et al. 2004) and cleave ECM components including Ln-1 and collagen type IV (for review see Hernandez-Barrantes et al. 2002), therefore potential roles for these proteases still need to be considered.

The ADAMTS proteases are involved in cartilage matrix degradation (Jones and Riley 2005) by specifically cleaving the chondroitin sulphate proteoglycan, aggrecan (Tortorella et al. 1999; Nakamura et al. 2000). A role for ADAMTS-4 in laminitis development has recently been suggested (Budak et al. 2009; Coyne et al. 2009). In this study ADAMTS-4 expression was increased at the first sampling point in some horses, suggesting an early role for this molecule. Attempts to evaluate ADAMTS-4 protein levels in lamellar extracts using commercial antibodies were unsuccessful in our laboratory, but active protein expression as well as release of aggrecan or other proteoglycan fragments in laminitis development still needs to be confirmed.

Limited proteolysis of collagen type IV by ADAMTS-4 does occur (Lauer-Fields et al. 2007). We have shown that lamellar BM collagen type IV is lost as early as 12 h POD (Visser and Pollitt 2011), the same time that ADAMTS-4 gene expression begins to increase in some horses. In addition to aggrecan, ADAMTS-4 cleaves other chondroitin sulphate proteoglycans such as brevican and versican (Nakamura et al. 2000; Westling et al. 2004) as well as members of the small leucine rich proteoglycan group, decorin and biglycan (Kashiwagi et al. 2001). Similar to cartilage, large polysulphated proteoglycans are present in lamellar ECM (Pawlak et al. 2009; Wang et al. 2009b) and their loss from the lamellar BM during laminitis development may compromise lamellar suspensory function (Pollitt 2010).

Increased lamellar zymogen MMP-9 as well as increased MMP-9 gene transcription concurs with other reports (Johnson et al. 1998; Black et al. 2006; Loftus et al. 2006, 2008, 2009; Noschka et al. 2009). The accumulation of proMMP-9 in the lamellae occurs early during laminitis induction, at 18–24 h. However, no conversion to the active form was observed so it is unlikely that this MMP has a causative role in lamellar damage or downstream protease activation.

In this study we have shown that the proteases MMP-2 and MMP-9, historically associated with laminitis development, appear not to initiate laminitis pathogenesis. Rather, other proteases such as ADAMTS-4 and regulators such as TIMP-2 may be involved in early lamellar damage. Alternative proteases and the degradation of additional lamellar matrix components need to be considered in further studies.

Source of funding

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

Funding was provided by the Rural Industries Research and Development Corporation of Australia and the Animal Health Foundation of St Louis, Missouri, USA. M.B.V. was the recipient of an Endeavour International Postgraduate Research Scholarship from the University of Queensland.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

We thank Emma Croser, Christopher Owens, Katie Asplin, Ali Nourian and Marianne Keller for assistance with tissue collection and animal experiments.

Manufacturers' addresses

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References

1 Invitrogen, Carlsbad, California, USA.

2 Omni International Inc, Marietta, Georgia, USA.

3 Promega, Madison, Wisconsin, USA.

4 Applied Biosystems, Foster City, California, USA.

5 Sigma Genosys, Castle Hill, New South Wales, Australia.

6 Eppendorf, Hamburg, Germany.

7 Roche, Basel, Switzerland.

8 Pierce, Rockford, Illinois, USA.

9 GE Healthcare, Piscataway, New Jersey, USA.

10 Calbiochem, Gibbstown, New Jersey, USA.

11 Zymed, South San Francisco, California, USA.

12 Sigma, St. Louis, Missouri, USA.

13 GraphPad Software, La Jolla, California, USA.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Authors' declaration of interests
  8. Source of funding
  9. Acknowledgements
  10. Manufacturers' addresses
  11. References
  • Bejarano, P.A., Noelken, M.E., Suzuki, K., Hudson, B.G. and Nagase, H. (1988) Degradation of basement membranes by human matrix metalloproteinase 3 (stromelysin). Biochem. J. 256, 413-419.
  • Black, S.J., Lunn, D.P., Yin, C., Hwang, M., Lenz, S.D. and Belknap, J.K. (2006) Leukocyte emigration in the early stages of laminitis. Vet. Immunol. Immunopathol. 109, 161-166.
  • Budak, M.T., Orsini, J.A., Pollitt, C.C. and Rubinstein, N.A. (2009) Gene expression in the lamellar dermis-epidermis during the developmental phase of carbohydrate overload-induced laminitis in the horse. Vet. Immunol. Immunopathol. 131, 86-96.
  • Chakraborti, S., Mandal, M., Das, S., Mandal, A. and Chakraborti, T. (2003) Regulation of matrix metalloproteinases: an overview. Mol. Cell. Biochem. 253, 269-285.
  • Clark, I.M., Swingler, T.E., Sampieri, C.L. and Edwards, D.R. (2008) The regulation of matrix metalloproteinases and their inhibitors. Int. J. Biochem. Cell Biol. 40, 1362-1378.
  • Clutterbuck, A.L., Harris, P., Allaway, D. and Mobasheri, A. (2008) Matrix metalloproteinases in inflammatory pathologies of the horse. Vet. J. 187, 27-38.
  • Cowland, J.B. and Borregaard, N. (1999) The individual regulation of granule protein mRNA levels during neutrophil maturation explains the heterogeneity of neutrophil granules. J. Leukoc. Biol. 66, 989-995.
  • Coyne, M.J., Cousin, H., Loftus, J.P., Johnson, P.J., Belknap, J.K., Gradil, C.M., Black, S.J. and Alfandari, D. (2009) Cloning and expression of ADAM-related metalloproteases in equine laminitis. Vet. Immunol. Immunopathol. 129, 231-241.
  • Crabbe, T., Smith, B., O'Connell, J. and Docherty, A. (1994) Human progelatinase A can be activated by matrilysin. FEBS Lett. 345, 14-16.
  • Croser, E. and Pollitt, C. (2006) Acute laminitis: Descriptive evaluation of serial hoof biopsies. Proc. Am. Ass equine Practnrs. 52, 542-546.
  • De la Rebiere de Pouyade, G., Riggs, L.M., Moore, J.N., Franck, T., Deby-Dupont, G., Hurley, D.J. and Serteyn, D. (2009) Equine neutrophil elastase in plasma, laminar tissue, and skin of horses administered black walnut heartwood extract. Vet. Immunol. Immunopathol. 135, 181-187.
  • Hernandez-Barrantes, S., Bernardo, M., Toth, M. and Fridman, R. (2002) Regulation of membrane type-matrix metalloproteinases. Semin. Cancer Biol. 12, 131-138.
  • Johnson, P.J., Tyagi, S.C., Katwa, L.C., Ganjam, V.K., Moore, L.A., Kreeger, J.M. and Messer, N.T. (1998) Activation of extracellular matrix metalloproteinases in equine laminitis. Vet. Rec. 142, 392-396.
  • Jones, G.C. and Riley, G.P. (2005) ADAMTS proteinases: A multi-domain, multi-functional family with roles in extracellular matrix turnover and arthritis. Arthritis Res. Ther. 7, 160-169.
  • Kashiwagi, M., Tortorella, M., Nagase, H. and Brew, K. (2001) TIMP-3 is a potent inhibitor of aggrecanase 1 (ADAM-TS4) and aggrecanase 2 (ADAM-TS5). J. Biol. Chem. 276, 12501-12504.
  • Kessenbrock, K., Plaks, V. and Werb, Z. (2010) Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 141, 52-67.
  • Kyaw-Tanner, M. and Pollitt, C.C. (2004) Equine laminitis: increased transcription of matrix metalloproteinase-2 (MMP-2) occurs during the developmental phase. Equine vet. J. 36, 221-225.
  • Kyaw-Tanner, M.T., Wattle, O., van Eps, A.W. and Pollitt, C.C. (2008) Equine laminitis: Membrane type matrix metalloproteinase-1 (MMP-14) is involved in acute phase onset. Equine vet. J. 40, 482-487.
  • Lambert, E., Dasse, E., Haye, B. and Petitfrere, E. (2004) TIMPs as multifacial proteins. Crit. Rev. Oncol. Hematol. 49, 187-198.
  • Lauer-Fields, J.L., Minond, D., Sritharan, T., Kashiwagi, M., Nagase, H. and Fields, G.B. (2007) Substrate conformation modulates aggrecanase (ADAMTS-4) affinity and sequence specificity. Suggestion of a common topological specificity for functionally diverse proteases. J. Biol. Chem. 282, 142-150.
  • Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25, 402-408.
  • Loftus, J.P., Belknap, J.K. and Black, S.J. (2006) Matrix metalloproteinase-9 in laminae of black walnut extract treated horses correlates with neutrophil abundance. Vet. Immunol. Immunopathol. 113, 267-276.
  • Loftus, J., Johnson, P., Yin, C., Belknap, J. and Black, S. (2008) Matrix metalloproteinases and structural tissue damage in equine laminitis. In: American College of Veterinary Internal Medicine, San Antonio.
  • Loftus, J.P., Black, S.J., Pettigrew, A., Abrahamsen, E.J. and Belknap, J.K. (2007) Early laminar events involving endothelial activation in horses with black walnut- induced laminitis. Am. J. vet. Res. 68, 1205-1211.
  • Loftus, J.P., Johnson, P.J., Belknap, J.K., Pettigrew, A. and Black, S.J. (2009) Leukocyte-derived and endogenous matrix metalloproteinases in the lamellae of horses with naturally acquired and experimentally induced laminitis. Vet. Immunol. Immunopathol. 129, 221-230.
  • Milinovich, G.J., Trott, D.J., Burrell, P.C., Croser, E.L., Al Jassim, R.A., Morton, J.M., van Eps, A.W. and Pollitt, C.C. (2007) Fluorescence in situ hybridization analysis of hindgut bacteria associated with the development of equine laminitis. Environ. Microbiol. 9, 2090-2100.
  • Morrison, C.J., Butler, G.S., Bigg, H.F., Roberts, C.R., Soloway, P.D. and Overall, C.M. (2001) Cellular activation of MMP-2 (gelatinase A) by MT2-MMP occurs via a TIMP-2-independent pathway. J. Biol. Chem. 276, 47402-47410.
  • Mungall, B.A. and Pollitt, C.C. (1999) Zymographic analysis of equine laminitis. Histochem. Cell Biol. 112, 467-472.
  • Nakamura, H., Fujii, Y., Inoki, I., Sugimoto, K., Tanzawa, K., Matsuki, H., Miura, R., Yamaguchi, Y. and Okada, Y. (2000) Brevican is degraded by matrix metalloproteinases and aggrecanase-1 (ADAMTS4) at different sites. J. Biol. Chem. 275, 38885-38890.
  • Nie, J. and Pei, D. (2003) Direct activation of pro-matrix metalloproteinase-2 by leukolysin/membrane-type 6 matrix metalloproteinase/matrix metalloproteinase 25 at the asn(109)-Tyr bond. Cancer Res. 63, 6758-6762.
  • Noschka, E., Vandenplas, M.L., Hurley, D.J. and Moore, J.N. (2009) Temporal aspects of laminar gene expression during the developmental stages of equine laminitis. Vet. Immunol. Immunopathol. 129, 242-253.
  • Obel, N. (1948) Studies on the Histopathology of Acute Laminitis, Almqvist & Wiksells Boktryckeri AB, Stockholm.
  • Owen, C.A. (2008) Leukocyte cell surface proteinases: regulation of expression, functions, and mechanisms of surface localization. Int. J. Biochem. Cell Biol. 40, 1246-1272.
  • Pawlak, E., Wang, L., Alfandari, D., Johnson, P.J., Belknap, J.K. and Black, S.J. (2009) Localization and function of sulfated proteoglycans in the equine digital laminae. In: Proceedings of the Second AAEP Foundation Equine Laminitis Research Workshop, West Palm Beach.
  • Pirila, E., Sharabi, A., Salo, T., Quaranta, V., Tu, H., Heljasvaara, R., Koshikawa, N., Sorsa, T. and Maisi, P. (2003) Matrix metalloproteinases process the laminin-5 gamma 2-chain and regulate epithelial cell migration. Biochem. Biophys. Res. Commun. 303, 1012-1017.
  • Pollitt, C.C. (1996) Basement membrane pathology: A feature of acute equine laminitis. Equine vet J. 28, 38-46.
  • Pollitt, C.C. (2010) The anatomy and physiology of the suspensory apparatus of the distal phalanx. Vet. Clin. N. Am.: Equine Pract. 26, 29-49.
  • Pollitt, C.C. and Daradka, M. (1998) Equine laminitis basement membrane pathology: loss of type IV collagen, type VII collagen and laminin immunostaining. Equine vet. J., Suppl. 26, 139-144.
  • Pollitt, C.C., Pass, M.A. and Pollitt, S. (1998) Batimastat (BB-94) inhibits matrix metalloproteinases of equine laminitis. Equine vet. J., Suppl. 26, 119-124.
  • Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn., Cold Spring Harbour Laboratory Press, Cold Spring Harbor.
  • Sternlicht, M.D. and Werb, Z. (2001) How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17, 463-516.
  • Tortorella, M.D., Burn, T.C., Pratta, M.A., Abbaszade, I., Hollis, J.M., Liu, R., Rosenfeld, S.A., Copeland, R.A., Decicco, C.P., Wynn, R., Rockwell, A., Yang, F., Duke, J.L., Solomon, K., George, H., Bruckner, R., Nagase, H., Itoh, Y., Ellis, D.M., Ross, H., Wiswall, B.H., Murphy, K., Hillman, M.C., Jr, Hollis, G.F., Newton, R.C., Magolda, R.L., Trzaskos, J.M. and Arner, E.C. (1999) Purification and cloning of aggrecanase-1: A member of the ADAMTS family of proteins. Science 284, 1664-1666.
  • van Eps, A.W. and Pollitt, C.C. (2006) Equine laminitis induced with oligofructose. Equine vet. J. 38, 203-208.
  • Visse, R. and Nagase, H. (2003) Matrix metalloproteinases and tissue inhibitors of metalloproteinases: Structure, function, and biochemistry. Circ. Res. 92, 827-839.
  • Visser, M.B. (2009) Investigation of Proteolysis of the Basement Membrane during the Development of Equine Laminitis, The University of Queensland, Brisbane.
  • Visser, M.B. and Pollitt, C.C. (2011) The timeline of lamellar basement membrane changes during equine laminitis development. Equine vet. J. 43, 471-477.
  • Wang, J., Lelse, B., Gustafson, A., Nanduri, B., Belknap, J.K. and Chowdhary, B. (2009a) Genome-wide transcriptome profiling of laminar tissue during early stages of carbohydrate overload-induced equine laminitis. In: Proceedings of the Second AAEP Foundation Equine Laminitis Research Workshop, West Palm Beach.
  • Wang, L., Pawlak, E., Alfandari, D., Johnson, P.J., Belknap, J.K. and Black, S.J. (2009b) Gene and protein expression of polysulfated proteoglycan ECM components in the equine digital lamellae. In: Proceedings of the Second AAEP Foundation Equine Laminitis Research Workshop, West Palm Beach.
  • Wang, F.Q., So, J., Reierstad, S. and Fishman, D.A. (2005) Matrilysin (MMP-7) promotes invasion of ovarian cancer cells by activation of progelatinase. Int. J. Cancer 114, 19-31.
  • Westling, J., Gottschall, P.E., Thompson, V.P., Cockburn, A., Perides, G., Zimmermann, D.R. and Sandy, J.D. (2004) ADAMTS4 (aggrecanase-1) cleaves human brain versican V2 at Glu405-Gln406 to generate glial hyaluronate binding protein. Biochem. J. 377, 787-795.
  • Zhao, H., Bernardo, M.M., Osenkowski, P., Sohail, A., Pei, D., Nagase, H., Kashiwagi, M., Soloway, P.D., DeClerck, Y.A. and Fridman, R. (2004) Differential inhibition of membrane type 3 (MT3)-matrix metalloproteinase (MMP) and MT1-MMP by tissue inhibitor of metalloproteinase (TIMP)-2 and TIMP-3 rgulates pro-MMP-2 activation. J. Biol. Chem. 279, 8592-8601.

Author contributions M.B.V. designed and performed experiments and prepared the manuscript. C.C.P. designed experiments and edited the manuscript.