SEARCH

SEARCH BY CITATION

Keywords:

  • testis;
  • mouse;
  • immunology

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Lymphangiogenesis occurs in various organs under inflammatory conditions. Recently, it was demonstrated that activated macrophages play an important role in the process of lymphangiogenesis. However, lymphangiogenesis during testicular inflammation has not yet been studied. Here, we investigated lymphangiogenesis in experimental autoimmune orchitis, a immunologic male infertility model, in mice. Histological changes were observed using immunohistochemical staining with the monoclonal antibodies against F4/80 (mature macrophage marker), lymph vessel endothelium HA-receptor 1 (LYVE-1) (lymphatic endothelial cells marker) and CD31 (endothelial cells marker). The expression of angiogenesis and lymphangiogenesis factors, such as vascular endothelial growth factor (VEGF)-A, VEGF-C, VEGF-D and TNF-α, which are secreted by activated macrophages, were examined using real-time RT-PCR. The results showed that lymphangiogenesis occurred along the undersurface of the tunica albuginea but not into the interstitium proper between the seminiferous tubules (STs) during the orchitis. It was noted that some F4/80-positive macrophages expressed LYVE-1 at the undersurface of the tunica albuginea and also in the testicular interstitium proper. RT-PCR analysis revealed that the expressions of VEGF-A, VEGF-D and TNF-α were significantly increased but that of VEGF-C remained unchanged in the inflammatory testes. This study suggests that testicular macrophages are involved in the specific lymphangiogenesis in the chronic inflammation.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Lymphatic capillaries are important for the recirculation of fluid that enters tissues from blood capillaries and for the maintenance of tissue homeostasis with extensive fluid and cell efflux (Witte et al., 2006). They have an additional role in transporting antigen-presenting cells from tissues to lymph nodes (Mebius et al., 1991; Randolph et al., 2005; Ji, 2006; Witte et al., 2006). Lymphangiogenesis develops under inflammatory conditions (Alitalo et al., 2005; Oliver & Alitalo, 2005; Ji, 2006). Testicular cancer is one of the most frequent malignancies in young men and easily metastasizes to the retroperitoneal lymph nodes through the emerging lymphatic capillaries (Nicolai et al., 2004). Therefore, an understanding of lymphangiogenesis in the testis is very useful to control inflammation and inhibit the lymphatic spread of testicular cancer. In a recent study, we demonstrated that the lymphatic capillaries are present in and just beneath the tunica albuginea but not in the interstitium proper in the normal testis of mice (Hirai et al., 2012). However, lymphangiogenesis under pathological conditions remains unclear in the testis.

VEGF family stimulates cellular responses by binding to tyrosine kinase receptors (VEGFRs) on the cell surface. VEGF-A mainly binds to VEGFR-1 (Flt-1) which induces angiogenesis, and VEGF-C and VEGF-D are ligands for VEGFR-3 (Flt-4), which mediates lymphangiogenesis (Table 1). It was reported that TNF-α may also be actively involved in lymphangiogenesis (Rui-Cheng, 2011). Recently, it was also reported that TNF-α, VEGF-A, VEGF-C and VEGF–D are produced by macrophages and induced angiogenesis and lymphangiogenesis (Schoppmann et al., 2002; Cursiefen et al., 2004; Baluk et al., 2005; Kerjaschki, 2005; Maruyama et al., 2005; Jeon et al., 2008; Rui-Cheng, 2011). Moreover, it was also shown that the lymph vessel endothelium HA-receptor 1 (LYVE-1), a commonly used marker to identify lymphatic endothelial cells (LECs), is expressed on macrophages under inflammatory conditions (Maruyama et al., 2005; Schledzewski et al., 2006; Kataru et al., 2009). Therefore, macrophages are critical for the development of inflammation-dependent lymphangiogenesis.

Table 1. Types of VEGF
VEGFsMain functionMain activated receptor
VEGF-AAngiogenesisVEGFR-1(Flt-1),VEGFR-2(KDR/Flk-1)
VEGF-BEmbryomic angiogenesisVEGFR-1(Flt-1)
VEGF-CLymphangiogenesisVEGFR-2(KDR/Flk-1), VEGFR-3(Flt-4)
VEGF-DLymphangiogenesisVEGFR-2(KDR/Flk-1), VEGFR-3(Flt-4)

Experimental autoimmune orchitis (EAO) is a model of chronic inflammation of the testes, leading to male infertility. Previously, the immunization of mice with a testicular homogenate (TH) emulsified in complete Freund’s adjuvant (CFA) followed by intravenous injections of Bordetella pertussis (BP) is necessary for the induction of EAO, in which inflammatory cell responses are evoked in the testis, epididymis and vas deference (Sato et al., 1981; Kohno et al., 1983). On reaction of sera of the TH+CFA+BP-induced EAO with normal frozen sections of testes, it was found that the autoantibodies against germ cells (=spermatogonia, spermatozoa, spermatids and spermatocytes) and also against somatic cells (=Sertoli cells, Leydig cells and the basement membrane of the ST) were detected (Sato et al., 1981; Yule et al., 1988). Recently, we have shown that two subcutaneous injections of viable syngeneic testicular germ cells (TGC) on days 0 and 14 without the use of any adjuvants induced EAO with lymphocytic infiltration and spermatogenic disturbance. On reaction of sera of the TGC-induced EAO with normal frozen sections of testes, the autoantibodies against spermatids and spermatocytes but not Sertoli cells, Leydig cells or the basement membrane of the ST were detected. The histopathology of TGC-induced EAO is similar to that of idiopathic spermatogenic disturbance in men (Itoh et al., 1991, 1995; Rival et al., 2008; Naito et al., 2012). The aim of this study is to investigate the characteristics of lymphangiogenesis during EAO as a chronic testicular inflammatory model.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Animals

A/J mice (8 weeks of age) were purchased from SLC (Shizuoka, Japan) and kept at the Laboratory Animal Center of Tokyo Medical University for 2 weeks before use. They were maintained at 22–24 °C and 50–60% relative humidity with a 12-h light dark cycle. The approval of the Tokyo Medical University Animal Committee (s-22020) was obtained for this study.

Preparation of TGC

Testes were excised from 10-week-old mice, teased with scissors in cold Hanks’ balanced salt solution (HBSS), and then passed through a stainless-steel mesh. The TGC were harvested by centrifugation at 400 g for 15 min, washed three times in cold Hanks’ balanced salt solution, and then adjusted to 1 × 107 TGC/200 μL/mouse after determining their viability by trypan blue dye exclusion. The TGC suspension contained more than 99% germ cells at various stages of spermatogenesis and the remaining cells (<1%) were Sertoli and interstitial cells (Itoh et al., 1991).

Experimental design

Male mice (= 10), 10 weeks of age, were subcutaneously injected twice with 1 × 107 TGC/mouse on days 0 and 14, i.e. at a 2-week interval, for the induction of EAO. Male mice (= 10, 10 weeks of age) injected with HBSS alone were used as controls. The mice were deeply anaesthetized with pentobarbital (65 mg/kg body weight), and their testes were removed on day 120 after the first immunization for histological samples (TGC-immunized mice: = 5; Control mice: = 5). In addition, immunohistochemical samples and protein samples were collected from right and left testes of the mice, respectively. Testes for RNA samples were collected at days 40 and 120 (TGC-immunized mice: = 5; Control mice: = 5).

Histological procedure

The testes from five TGC-immunized mice and five control mice were removed under deep anaesthesia and fixed with Bouin’s solution. Then they were embedded in plastic (Technovit 7100; Kulzer & Co., Wehrheim, Germany) without cutting the organs to avoid artificial damage to the testicular tissue. Sections (5 μm) were obtained at 15–20 μm intervals, and stained with Gill haematoxylin III and 2% eosin Y for light microscope observation.

Gene expression analysis

The testes were obtained from five control mice and five TGC-immunized mice on days 40 and 120, respectively. Total RNA was isolated from the entire testis using the TRIzol RNA extraction kit (Invitrogen, CA, USA) according to the manufacturer’s instructions, and the RNA pellets were dissolved in 10 μL of RNase-free distilled water. Total RNA was measured at 260/280 nm using a UV spectrophotometer and was stored at −80 °C prior to use. cDNA was prepared from 10 μg of total RNA in a 100-μl reaction mixture using random primers according to a standard protocol (high capacity cDNA archive kit; PE Applied Biosystems, Foster City, CA, USA). The PCR reactions were carried out on an iCycler thermal cycler (Bio-Rad, Hercules, CA, USA), and the mixtures were stored at −80 °C before analysis. Real-time PCR was performed on 3 ng of cDNA using the validated SYBR Green gene expression assay in combination with the SYBR Premix Ex Taq II (TaKaRa Bio Inc., Ohtsu, Japan) for measuring murine VEGF-A, VEGF-C, VEGF-D, TNF-α and GAPDH. All primers used in this study are listed in Table 2. Quantitative real-time PCR was performed in duplicate in a thermal cycler dice real-time system TP800 (TaKaRa). The data were analysed using thermal cycler dice real-time system software (TaKaRa), and the comparative Ct method (2ΔΔCt) was used to quantify gene expression levels. Data of the real-time PCR products were standardized to GAPDH, which was used as the negative control. To confirm the specific amplification of the target genes, each gene product was further separated on a 1.5% agarose gel to detect any single bands at the theoretical product sizes, and the dissociation curves were analysed to detect any single peaks.

Table 2. List of primers used real-time RT-PCR
Primer nameDirectionSequence 5′–3′MGI gene IDProduct length (bp)
  1. MGI: Mouse Gene Informatics.

VEGF-AForwardReverseCTGTGCAGGCTGCTGTAACGGTTCCCGAAACCCTGAGGAG103178363
VEGF-CForwardReverseCAAGGCTTTTGAAGGCAAAGTGCTGAGGTAACCTGTGCTG109124360
VEGF-DForwardReverseCTCCAGGAACCCACTCTCTGTCCTGGCTGTAGAGTCCCTG108037397
TNF-aForwardReverseTCTTCTCATTCCTGCTTGTGGTCTGGGCCATAGAACTGATGA104798126
GAPDHForwardReverseCCTTGAGATCAACACGTACCAGCGCCTGTACACTCCACCAC9564089

Protein isolation and western blotting analysis

The testes from five TGC-immunized mice on day 120 and five control mice were homogenized in lysis buffer consisting of 10 mM phosphate buffer (pH 7.2), 0.1% Triton X-100, 1 mM phenylmethylsulfonylfluoride, 1 μg/mL leupeptin and 1 μg/mL chymostatin. Protein concentrations were determined by the Bradford method using Bovine Serum Albumin as a standard. Samples were boiled for 3 min in 0.125 M Tris-HCl, 10% 2-mercaptoethanol, 4% SDS, 0.004% bromophenol blue and 10% sucrose, and then electrophoretically separated on a 7.5% gradient gel (ATTO Corporation, Tokyo, Japan) with 50 μg protein per sample lane. Precision Plus Protein Standards (Bio-Rad Laboratories, CA, USA) were used as molecular mass markers. After electrophoresis, proteins were transferred to polyvinylidene fluoride membranes (Immobilon-P Transfer Membranes; ATTO) by electroblotting. After rinsing in PBS with 0.1% Tween-20 (PBS-Tween), non-specific binding was blocked by incubation of the blotted membranes in PBS-Tween containing 3% BSA (Sigma, MO, USA) for 1 h at room temperature (RT). Thereafter, the membranes were incubated with F4/80 (purified rat anti-mouse; Abcam, Cambridge, UK, 1 : 500 dilution), CD31 (purified rat anti-mouse; Biolegend, San Diego, CA, USA, 1 : 100 dilution), LYVE-1 (purified rabbit anti-mouse; Abcam, 1 : 500 dilution) and β-actin (purified anti-mouse; Sigma, 1 : 1000 dilution) in PBS-Tween at 4 °C overnight. After washing in PBS-Tween, the membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-rat IgG for F4/80 and CD31, HRP-conjugated anti-rabbit IgG (ECL) for LYVE-1 (Amersham Biosciences, Buckinghamshire, UK) diluted 1 : 10,000 in PBS-Tween, at RT for 1 h. The membranes were then washed five times with PBS-Tween, and then the blotting was examined using an ECL Plus Western Blotting Detection Reagents System.

Immunohistochemistry

The testes from five TGC-immunized mice on day 120 and five control mice were removed under deep anaesthesia and then embedded in OCT compound (Miles Laboratories, Naperville, IN, USA). The organs in OCT compound were immediately frozen in liquid nitrogen oxide and stored at −80 °C until used. Sections of 5 μm were cut with a cryostat (HM550; Microm, Waldorf, Germany) and air-dried. They were fixed in acetone for 2 min at −20 °C, and then rinsed in phosphate-buffered saline (PBS, pH 7.4) and 0.3% H2O2 in methanol for 30 min at RT. The sections were then incubated with protein block serum free (Dako, Glostrup, Denmark). The sections were then incubated with mAbs against F4/80 (F4/80 antibody, mature macrophage marker, purified rat anti-mouse F4/80; Abcam, 1 : 500 dilution) for 2 h at RT. After washing with PBS, the anti-F4/80 stained sections were incubated with HRP-conjugated goat anti-rat IgG mAbs (second mAbs; Serotec, Morphosys, UK, 1 : 100 dilution) as second antibody for 1 h at RT. Negative controls comprised sections reacted with normal rat normal serum (Dako). The sections were then incubated with normal goat serum, followed by incubation with mAbs LYVE-1 (LYVE-1 antibody-lymphatic vessel marker, Abcam, 1 : 500 dilution) for 2 h at RT. After washing with PBS, the anti-LYVE-1 stained sections were incubated with HRP-conjugated goat anti-rabbit IgG mAbs (second mAbs; Serotec, Morphosys, 1 : 100 dilution) as second antibody for 1 h at RT. Negative controls comprised sections reacted with normal rabbit normal serum (Dako). The sections were then incubated with normal goat serum, followed by incubation with mAbs against CD31 (CD31 antibody, endothelial cell marker, Purified anti-mouse CD31; Biolegend, 1 : 100 dilution) for 2 h at RT. After washing with PBS, the anti-CD31 stained sections were incubated with HRP-conjugated goat anti-rat IgG mAbs (second mAbs; Serotec, MorphoSys, 1 : 100 dilution) as second antibody for 1 h at RT. Negative controls comprised sections reacted with normal rat serum (Dako). The HRP-binding sites were detected with 0.05% 3,3′-diaminobenzidine tetrahydrochloride (DAB) and 0.01% H2O2 after washing of the sections with PBS. Positively stained cells were taken as cells that had a brown-coloured cytoplasm at the light microscopic level. These sections were finally counterstained with haematoxylin. LYVE-1 molecules are localized on the lymphatic endothelial cells (LECs) but not on the blood vessels. CD31 molecules are intensely localized on the blood vessel walls and were also weakly present on the peripheral LECs in normal testis. Therefore, LYVE-1 and CD31 double-positive indicate peripheral lymphatic vessel in testis (Hirai et al., 2012).

Confocal laser-scanning microscope analysis

The relation between the expression of LYVE-1 and CD31 was investigated by confocal laser-scanning microscope analysis. To visualize LYVE-1 and CD31 with green and red fluorescences, respectively, sections were incubated for 2 h in a pooled solution of Alexa 488-conjugated goat anti-rabbit IgG (second mAbs; Molecular Probes Inc., CA, USA, 1 : 200 dilution) and Alexa 546-conjugated goat anti-rat IgG (second mAbs; Molecular Probes Inc., 1 : 200 dilution) after incubation with mAbs against LYVE-1 and CD31. The interrelation between LYVE-1-positive cells and F4/80-positive cells was also investigated using the same method. To visualize LYVE-1 and F4/80 with green and red fluorescences, respectively, sections were incubated for 2 h in a pooled solution of Alexa 488-conjugated goat anti-rabbit IgG (second mAbs; Molecular Probes Inc., 1 : 200 dilution) and Alexa 546-conjugated goat anti-rat IgG (second mAbs; Molecular Probes Inc., 1 : 200 dilution) after incubation with mAbs against LYVE-1 and F4/80. Fluorescence was examined using a confocal laser-scanning microscope (Fluoview FV500, Olympus, NY, USA).

Data analysis

Data were expressed as mean ± standard deviation (SD), and then the anova/post hoc test was used for statistical analysis. < 0.05 was taken as being significant.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Control animals showed no pathological changes in the testes. In EAO, severe spermatogenetic disturbance and accumulation of inflammatory cells were observed both around the tunica albuginea and in the interstitium proper between ST of the EAO (Fig. 1). The pronounced hypertrophy of the tunica albuginea was also seen in all EAO-affected testes examined (Fig. 1A and B). To identify angiogenesis and lymphangiogenesis inducing factors, we analysed the mRNA expression of VEGF-A, VEGF-C, VEGF-D and TNF-α. The mRNA expressions of VEGF-A and TNF-α were significantly increased in EAO on both days 40 and 120. The mRNA expression of VEGF-D was significantly increased in EAO on day 120 but not on day 40, whereas that of VEGF-C remained unchanged in EAO on both days 40 and 120 (Fig. 2). In EAO, the expression of F4/80 was significantly increased on western blots (Fig. 3A). The expression of CD31, the marker of blood capillaries and LYVE-1, the marker of lymphatic capillaries, were also significantly increased on western blots (Fig. 3A). The localizations of macrophages, blood capillaries and lymphatic capillaries were analysed by immunohistochemical analysis. In control testes, F4/80-positive macrophages and CD31-positive cells were scattered around the tunica albuginea and also in interstitium proper between the STs. On the other hand, the LYVE-1-positive cells were present at the undersurface of the tunica albuginea but not in the interstitium proper in control testes (Fig. 3B c, i). Same results were obtained in all controls. In EAO, the increased number of F4/80-positive macrophages and CD31-positive cells were detected both around the tunica albuginea and in the interstitium proper (Fig. 3B a, b, d, e, g, h, j, k). The LYVE-1-positive cells were also increased not only at the undersurface of the tunica albuginea but also in the interstitium proper in EAO. However, LYVE-1-positive cells in the interstitium proper did not form an apparent structure of lymphatic capillary (Fig. 3B f, l). The relationship of CD31- and LYVE-1-positive cells was demonstrated in Fig. 4C, F, I and L. It was shown that all LYVE-1-positive cells expressed CD31 around the tunica albuginea (Fig. 4A–F). In contrast, LYVE-1 and CD31 double-positive cells were not observed in the testicular interstitium (Fig. 4G–L). It was noted that some LYVE-1-positive cells around the tunica albuginea expressed F4/80 (Fig. 5A–F). On the other hand, it was demonstrated that all LYVE-1-positive cells expressed F4/80 in interstitium (Fig. 5G–L). Similar results were obtained immunohistochemically in all EAO-affected testes.

image

Figure 1. Histological sections of testes of control (A and C) and EAO (B and D) animals. Sections around the tunica albuginea (A and B). Sections in the interstitium proper (C and D). Bar: 50 μm.

Download figure to PowerPoint

image

Figure 2. Expressions of VEGF-A, VEGF-C, VEGF-D and TNF-α by real-time PCR analysis on 40 and 120 days after immunization. Relative intensity was calculated after expression in the control for each time point was normalized as 1. Each bar represents mean ± SD (= 5). Asterisks indicate < 0.05 vs. control group. Double asterisks indicate < 0.01 vs. control group.

Download figure to PowerPoint

image

Figure 3. Western blotting and immunohistochemical staining by F4/80, CD31 and LYVE-1. (A) Results of western blotting. F4/80 (a), CD31 (b), LYVE-1 (c) and β-actin (d–f). (B) Results of Immunohistochemical staining. F4/80 (a, d, g, j), CD31 (b, e, h, k) and LYVE-1 (c, f, i, l) positive cells were shown around the tunica albuginea of control testis (a–c) and EAO (d–f), in the interstitium proper of control testis (g–i) and EAO (j–l). Negative control (m–o). Bar: 50 μm.

Download figure to PowerPoint

image

Figure 4. Confocal images stained by LYVE-1 and CD31. LYVE-1 staining (green) (A, D, G, J), CD31 staining (red) (B, E, H, K) and corresponding merged images (yellow) (C, F, I, L) were shown around the tunica albuginea of control testis (A–C) and EAO (D–F), in the interstitium proper of control testis (G–I) and EAO-affected testis (J–L). Bar: 50 μm.

Download figure to PowerPoint

image

Figure 5. Confocal images stained by LYVE-1 and F4/80. LYVE-1 staining (green) (A, D, G, J), F4/80 staining (red) (B, E, H, K) and corresponding merged images (yellow) (C, F, I, L) were shown around the tunica albuginea of control testis (A–C) and EAO (D–F), in the interstitium proper of control testis (G–I) and EAO-affected testis (J–L). Bar: 50 μm.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

This study is the first to investigate lymphangiogenesis in chronic testicular inflammation. It was shown that lymphatic capillaries extended along the undersurface of the tunica albuginea but not into the testicular interstitium proper. Moreover, it was revealed that the F4/80-positive macrophages expressed LYVE-1. These cells migrated and were incorporated into the lymphatic capillaries around the tunica albuginea. The expressions of VEGF-D and TNF-α, lymphangiogenesis inducing factors, were significantly increased, but that of VEGF-C remained unchanged.

Lymphatic capillaries are important for maintenance of normal tissue homeostasis with extensive fluid and cell efflux (Witte et al.,2006). We previously showed that the STs are bathed in a sea of lymph in mice and tissue fluid drains from lymphatic capillaries that arise at the undersurface of the tunica albuginea (Hirai et al., 2012). It was observed that the interstitium area in EAO was expanded on active inflammatory condition and then reduced with resolution of lymphocytic inflammation under post-inflammatory condition (Naito et al., 2012). The present study showed that lymphatic capillaries extend along the undersurface of the tunica albuginea in EAO. This indicates that increased lymphatic capillaries preferentially surround inflammatory lesions and play important roles in draining the increased interstitial fluid and infiltrated lymphocytes effectively.

We recently demonstrated that there is no LYVE-1-positive cell in normal testicular interstitium proper between the STs (Hirai et al., 2012). This study showed that LYVE-1-positive cells appeared in the interstitium proper of inflammatory testis. Moreover, all these cells are F4/80 positive and CD31 negative. These data suggested that LYVE-1-positive cells in the interstitium proper in testicular inflammation were mature macrophages but not endothelia of lymphatic capillary. Previously, in vitro experiments demonstrated that macrophages alone were accumulated and were capable of forming tube-like structures (Maruyama et al., 2005). Here, we found that LYVE-1-positive macrophages had appeared in the testicular interstitium proper in EAO. These cells were frequently detected around blood capillaries but did not form capillary structure. On the other hand, the LYVE-1-positive macrophages were incorporated into the wall of lymphatic capillaries under the tunica albuginea. This suggests that some F4/80-positive mature macrophages expressing LYVE-1 migrate and are incorporated into the lymphatic capillaries for lymphangiogenesis during inflammatory testis. F4/80 is expressed in a wide range of mature tissue macrophages. Macrophages are mainly divided into two subsets, M1 and M2 on the basis of their secretory repertoire, receptor expression pattern and phenotypical criteria. It was reported that M2-polarized tumour-associated macrophages accelerated lymphangiogenesis in lung adenocarcinoma (Zhang et al., 2011). A previous study showed that both M1 and M2 macrophages were increased, although M1 subset is the main pathogenic subpopulation in EAO induced by TH + CFA+ BP (Rival et al., 2008). The analysis of macrophage subpopulations in TGC-induced EAO should make us investigate lymphangiogenesis furthermore in this experimental model.

It was reported that set points of angiogenesis and lymphangiogenesis were different in each organ (Baluk et al., 2005, Cursiefen et al., 2006). This study demonstrated that the expression of VEGF-A significantly increased, but those of VEGF-C and VEGF-D remained unchanged in early stage of EAO (on day 40). We also showed that those of VEGF-A and VEGF-D were significantly increased in developed EAO (on day 120) (Fig. 2). These data suggest that the angiogenesis induced by VEGF-A signal may occur earlier than lymphangiogenesis induced by VEGF-D signal. We are going to analyse the set points of angiogenesis and lymphangiogenesis in EAO.

On the other hand, the expression of VEGF-C remained unchanged in EAO. A previous report showed that steroid hormones such as glucocorticoids suppressed tumour-associated lymphangiogenesis by downregulating VEGF-C through glucocorticoid receptors (Yano et al., 2006). Testosterone is also a steroid hormone and mainly secreted in the testes. It is known that testosterone has various immunosuppressive roles. Actually, serum testosterone levels were reduced in TH + CFA+ BP-induced EAO (Suescun et al., 1994; Fijak et al., 2012). On the other hand, they were temporally increased but not decreased from days 0 to 120 (Tokunaga et al., 2008). Therefore, downregulation of VEGF-C in EAO induced by TGC alone may be caused by testosterone. In future work, we intend to investigate the relationship between intra-testicular testosterone and the local lymphangiogenesis.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References
  • Alitalo K, Tammela T & Petrova TV. (2005) Lymphangiogenesis in development and human disease. Nature 428, 946953.
  • Baluk P, Tammela T, Ator E, Lyubynska N, Achen MG, Hicklin DJ et al. (2005) Pathogenesis of persistent lymphatic vessel hyperplasia in chronic airway inflammation. J Clin Invest 115, 247257.
  • Cursiefen C, Chen L, Borges LP, Jackson D, Cao J, Radziejewski C, D’Amore PA, Dana MR, Wiegand SJ & Streilein JW. (2004) VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. J Clin Invest 113, 10401050.
  • Cursiefen C, Maruyama K, Jackson DG, Streilein JW & Kruse FE. (2006) Time course of angiogenesis and lymphangiogenesis after brief corneal inflammation. Cornea 25, 443447.
  • Fijak M, Schneider E, Klug J, Bhushan S, Hackstein H, Schuler G, Wygrecka M, Gromoll J & Meinhardt A. (2012) Testosterone replacement effectively inhibits the development of experimental autoimmune orchitis in rats: evidence for a direct role of testosterone on regulatory T cell expansion. J Immunol. 186, 51625172.
  • Hirai S, Naito M, Terayama H, Qu N, Kuerban M, Musha M, Ikeda A, Miura M & Itoh M. (2012) The origin of lymphatic capillaries in murine testes. J Androl 33, 745751.
  • Itoh M, Hiramine C & Hojo K. (1991) A new murine model of autoimmune orchitis induced by immunization with viable syngeneic testicular germ cells alone. I: Immunological and histological studies. Clin Exp Immunol 83, 137142.
  • Itoh M, De-Rooij DG & Takeuchi Y. (1995) Mode of inflammatory cell infiltration in testes of mice injected with syngeneic testicular germ cells without adjuvant. J Anat 187, 671679.
  • Jeon BH, Jang C, Han J, Kataru RP, Piao L, Jung K et al. (2008) Profound but dysfunctional lymphangiogenesis via vascular endothelial growth factor ligands from CD11b+ macrophages in advanced ovarian cancer. Cancer Res 15, 68.
  • Ji RC. (2006) Lymphatic endothelial cells, tumor lymphangiogenesis and metastasis: New insights into intratumoral and peritumoral lymphatics. Cancer Metastasis Rev 25, 677694.
  • Kataru RP, Jung K, Jang C, Yang H, Schwendener RA, Baik JE, Han SH, Alitalo K & Koh GY. (2009) Critical role of CD11b+ macrophages and VEGF in inflammatory lymphangiogenesis, antigen clearance, and inflammation resolution. Blood 113, 56505659.
  • Kerjaschki D. (2005) The crucial role of macrophages in lymphangiogenesis. J Clin Invest 115, 23162319.
  • Kohno S, Munoz JA, Williams TM, Teuscher C, Bernard CC & Tung KS. (1983) Immunopathology of murine experimental allergic orchitis. J Immunol. 130, 26752682.
  • Maruyama K, Ii M, Cursiefen C, Jackson DG, Keino H, Tomita M et al. (2005) Inflammation induced lymphangiogenesis in the cornea arises from CD11b-positive macrophages. J Clin Invest 115, 23632372.
  • Mebius RE, Streeter PR, Brevé J, Duijvestijn AM & Kraal G. (1991) The influence of afferent lymphatic vessel interruption on vascular addressin expression. J Cell Biol 115, 8595.
  • Naito M, Hirai S, Terayama H, Qu N, Kuerban M, Musha M, Kitaoka M, Ogawa Y & Itoh M. (2012) Postinflammation stage of autoimmune orchitis induced by immunization with syngeneic testicular germ cells alone in mice. Med Mol Morphol. 45, 3544.
  • Nicolai N, Miceli R, Artusi R, Piva L, Pizzocaro G & Salvioni R. (2004) A simple model for predicting nodal metastasis in patients with clinical stage I nonseminomatous germ cell testicular tumors undergoing retroperitoneal lymph node dissection only. J Urol 171, 172176.
  • Oliver G & Alitalo K. (2005) The lymphatic vasculature: recent progress and paradigms. Annu Rev Cell Dev Biol 21, 457483.
  • Randolph GJ, Angeli V & Swartz MA. (2005) Dendritic-cell trafficking to lymph nodes through lymphatic vessels. Nat Rev Immunol 5, 617628.
  • Rival C, Theas MS, Suescun MO, Jacobo P, Guazzone V, van Rooijen N & Lustig L. (2008) Functional and phenotypic characteristics of testicular macrophages in experimental autoimmune orchitis. Reproduction 135, 859866.
  • Rui-Cheng J. (2011) Macrophages are important mediators of either tumor- or inflammation-induced lymphangiogenesis. Cell Mol Life Sci 69, 897914.
  • Sato K, Hirokawa K & Hatakeyama S. (1981) Experimental allergic orchitis in mice. Histopathological and Immunological studies. Virchows Arch A Pathol Anat Histol. 392, 147158.
  • Schledzewski K, Falkowski M, Moldenhauer G, Metharom P, Kzhyshkowska J, Ganss R et al. (2006) Lymphatic endothelium-specific hyaluronan receptor LYVE-1 is expressed by stabilin-1+, F4/80+, CD11b+ macrophages in malignant tumours and wound healing tissue in vivo and in bone marrow cultures in vitro: implications for the assessment of lymphangiogenesis. J Pathol. 209, 6777.
  • Schoppmann SF, Birner P, Stockl J, Kalt R, Ullrich R, Caucig C, Kriehuber E, Nagy K, Alitalo K & Kerjaschki D. (2002) Tumor associated macrophages express lymphatic endothelial growth factors and are related to peritumoral lymphangiogenesis. Am J Pathol 2002, 161.
  • Suescun MO, Calandra RS & Lustig L. (1994) Alterations of testicular function after induced autoimmune orchitis in rats. J Androl 15, 442448.
  • Tokunaga Y, Terayama H, Naito M, Qu N, Hirai S, Ogawa Y, Yi SQ & Itoh M. (2008) Splenic cytokines in mice immunized with testicular germ cells. Int J Androl 31, 471476.
  • Witte MH, Jones K, Wilting J, Dictor M, Selg M, McHale N, Gershenwald JE & Jackson DG. (2006) Structure function relationships in the lymphatic system and implications for cancer biology. Cancer Metastasis Rev 25, 159184.
  • Yano A, Fujii Y, Iwai A, Kawakami S, Kageyama Y & Kihara K. (2006) Glucocorticoids suppress tumor lymphangiogenesis of prostate cancer cells. Clin Cancer Res 2, 213219.
  • Yule TD, Montoya GD, Russell LD, Williams TM & Tung KS. (1988) Autoantigenic germ cells exist outside the blood-testis barrier. J Immunol. 141, 11611167.
  • Zhang B, Yao G, Zhang Y, Gao J, Yang B, Rao Z & Gao J. (2011) M2-polarized tumor-associated macrophages are associated with poor prognoses resulting from accelerated lymphangiogenesis in lung adenocarcinoma. Clinics. 66, 18791886.