SEARCH

SEARCH BY CITATION

Keywords:

  • high-energy diet;
  • testicular metabolism;
  • male reproductive function;
  • pre-diabetes;
  • glucose metabolism

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

Diabetes mellitus is a metabolic disorder that may arise from diet habits and is growing to epidemic proportions. Young male diabetic patients present high infertility/subfertility prevalence resulting from impaired reproductive function and poor semen quality. We aimed to evaluate the effects of a high-energy diet (HED) on glucose tolerance/insulin levels and correlate the observed effects on male reproductive function with overall testicular metabolism. After 1 month, HED fed rats showed increased glycaemic levels, impaired glucose tolerance and hypoinsulinaemia. Moreover, an imbalance of intratesticular and serum testosterone levels was observed, whereas those of 17β-estradiol were not altered. High-energy diet also affected the reproductive parameters, with HED rats exhibiting a significant increase in abnormal sperm morphology. Glycolytic metabolism was favoured in testicles of HED rats with an increased expression of both glucose transporters 1 (GLUT1) and 3 (GLUT3) and the enzyme phosphofrutokinase 1. Moreover, lactate production and the expression of metabolism-associated genes and proteins involved in lactate production and transport were also enhanced by HED. Alanine testicular content was decreased and thus intratesticular lactate/alanine ratio in HED rats was increased, suggesting increased oxidative stress. Other energetic substrates such as acetate and creatine were not altered in testis from HED rats, but intratesticular glycine content was increased in those animals. Taken together, these results suggest that HED induces a pre-diabetic state that may impair reproductive function by modulating overall testicular metabolism. This is the first report on testicular metabolic features and mechanisms related with the onset of a pre-diabetic state.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

Diabetes mellitus (DM) includes a group of metabolic diseases that can be caused by a physical or functional loss of β-cell mass, ascribable to an autoimmune process (type-1 diabetes) and/or increased insulin need (type-2 diabetes)(American Diabetes Association, 2012). DM is considered one of the greatest threats to the modern global health and its incidence is rising rapidly, in part due to the current eating habits, particularly among young people (Ismail, 2008; Dicker, 2010; American Diabetes Association, 2012). Infertility and subfertility prevalence is high in male patients with type-1 and type-2 DM (Delfino et al., 2007; La Vignera et al., 2009). Moreover, data from animal models strongly suggest that DM impairs male fertility at multiple levels, such as endocrine control of spermatogenesis, spermatogenesis itself, or by impairing penile erection and ejaculation (Cameron et al., 1990; Ballester et al., 2004; Scarano et al., 2006). Nevertheless, although the problems arising from DM have been widely investigated, the mechanisms responsible for the reported male reproductive dysfunction are still poorly understood (Agbaje et al., 2007; La Vignera et al., 2011).

Recent reports have highlighted changes in whole body metabolic profile in diabetic conditions (Salek et al., 2007; Zhao et al., 2010), though only one has reported the testicular metabolic profile under diabetic state (Mallidis et al., 2009). The detrimental influence of DM on testicular metabolism is receiving increased attention and recently it was suggested that testicular cells of diabetic individuals may present metabolic adaptations that allow them to minimize the negative effects promoted by the disease (Amaral et al., 2006; Riera et al., 2009). In fact, glucose metabolism is crucial for normal development of spermatogenesis (Boussouar & Benahmed, 2004). Amongst testicular cells, the Sertoli cells (SCs), the key somatic component of the seminiferous epithelium (Rato et al., 2010), are essential in the metabolic control of spermatogenesis because their carbohydrate metabolism presents some unique characteristics (Alves et al., 2012b; Rato et al., 2012b). After entering into these cells through GLUT1 and GLUT3, glucose undergoes the glycolytic pathway producing pyruvate, being the majority of it converted into lactate that functions as ‘fuel’ for developing germ cells (Boussouar & Benahmed, 2004; Alves et al., 2012c; Rato et al., 2012a). Even in non-physiological conditions, SCs adapt their metabolism to maintain lactate production. Recently, we reported the effect of sex hormones, which are known to be deregulated in DM (Seethalakshmi et al., 1987), and of insulin deprivation in SCs concluding that these cells adapt their metabolism by modulating the expression of key metabolic enzymes and transporters of glucose metabolism (Oliveira et al., 2012).

Pre-diabetes is characterized by mild-hyperglycaemia and arises as a high-risk factor for diabetes (Tabák et al., 2012). The most common alterations evidenced in pre-diabetic state are impaired fasting glucose levels and/or glucose intolerance because of glucose control deregulation, as well as β-cell dysfunction (Utzschneider et al., 2009; American Diabetes Association, 2012). Increasing levels of circulating glucose cause overall metabolic changes, which may be reflected at testicular level. Testicular metabolism present unique characteristics being highly dependent on glucose metabolism and may adapt to peripheral glucose fluctuations that occur under diabetic conditions (Alves et al., 2012a; Oliveira et al., 2012). These mild increased glycaemic levels may lead to the production of free oxygen radicals, which could themselves cause tissue damage and impair reproductive function (Amaral et al., 2006). Nevertheless, the knowledge concerning the impairment of the overall testicular metabolism caused by the pre-diabetic state is virtually null and scarce in concerning DM, being that in most cases the available information is associated with more advanced or severe stages of the disease. Thus, we aimed to use an animal model that could mimic the initial stages of DM induced by food intake. We used a high-energy diet (HED) fed male rat model, to evaluate diet effect on the glucose tolerance/insulin levels and correlate with the male reproductive function and overall testicular metabolism. To our knowledge, this study is the first to apply a metabolomics technology approach to give new insights regarding the effect of a diet-induced pre-diabetic state on the testicular metabolism, to disclose some of the molecular mechanisms related to poor quality diets intake and subfertility/infertility associated with DM.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

Animals

Twelve 2-month-old male Wistar rats (Charles River Laboratories, Barcelona, Spain) were used. The animals were housed in our accredited animal colony and maintained with food and water ad libitum in a constant room temperature (20 ± 2 °C) on a 12-h cycle of artificial lighting. All experiments were performed according to the ‘Guide for the Care and Use of Laboratory Animals’ published by the US National Institutes of Health (NIH Publication no. 85-23, revised 1996) and the European directives for the care and handling of laboratory animals (Directive 86/609/EEC).

Experimental design

Rats were randomly divided (six per group) in control and HED groups. The control group animals were fed with a standard chow diet (4RF21 certificate, Mucedola, Italy) and the HED group received an additional high-energy emulsion as described elsewhere (Ai et al., 2005; Zou et al., 2006; Sivabalan et al., 2008). Briefly, in the first five treatment days, animals were given progressively 1–5 mL of emulsion consisting of 20 g lard oil, 1 g thyreostat, 5 g cholesterol, 1 g sodium glutamate, 10 g sucrose, 20 mL Tween 80, 30 mL propylene glycol prepared in a final volume of 100 mL by adding distilled water. Thereafter, they were administrated daily with 5 mL of the emulsion until they reach 1 month of treatment.

Water, food consumption and the animal's weight were monitored every 2 days. After the treatment, animals were killed by cervical dislocation. Blood was collected by cardiac puncture to non-heparinized tubes. Testes were removed, weighed and processed for testicular interstitial fluid (TIF) collection, according to Porter et al. (2006) or stored at −80 °C.

Blood glycaemia

Non-fasting glycaemia was determined every 6 days. Blood samples were collected from the tail vein and blood glucose levels were measured through glucose oxidase reaction by using a glucometer (One Touch Ultra, Lifescan, Johnson & Johnson, Milpitas, CA, USA)

Glucose tolerance test

At 3 months of age the animals were subjected to a glucose tolerance test as described by Nunes et al. (2007). Briefly, 16–18 h before the test, access to food was removed from the animals. An intraperitoneal injection with 6 mL glucose 30% (w/v) per kg of body weight was given to each animal. Blood glucose levels were measured every 30 min during 2 h.

Insulin, testosterone and 17β-estradiol determination

Insulin, Testosterone (T) and 17β-estradiol (E2) levels were determined using commercial rat EIA kits according to manufacturer's instructions. T and E2 EIA Kits were purchased from Cayman Chemical Company (Ann Arbor, MI, USA). Insulin ELISA measurement kit was purchased from Mercodia (Uppsala, Sweden). The EIA kits used had detection limits of approximately 40 μU/mL (for insulin), 6 pg/mL (for T) and 20 pg/mL (for E2).

Epididymal sperm parameters

Epididymis were isolated and placed in pre-warmed (37 °C) HBSS (pH 7.4), minced with a scalpel blade and the suspension was incubated for 5 min (37 °C). Sperm motility was evaluated by placing a drop of sperm suspension (2–3 × 106 sperm cells) in a warmed slide (37 °C) and motile sperm percentage was assessed in 10 random fields, using an optical microscope (×100 magnification), and the average value was used as the total sperm motility. Sperm viability was assessed examining eosin-nigrosin stained epididymal sperm smears. A total of 333 spermatozoa were counted in random fields under a light microscope. Dead spermatozoa stained pink, because its membrane integrity is compromised, causing the dye (eosin) uptake. Epididymal sperm concentration was determined using a dilution of 1 : 50 in HBSS solution to fill the two grids of a Neubauer counting chamber. The number of sperm cells was then counted under an optical microscope (×400 magnification). For the assessment of sperm morphology we used standard methods (Lopes et al., 2009). Sperm morphology was evaluated using Diff-Quick (Baxter Dale Diagnostics AG, Dubinger, Switzerland) stained smears according to manufacturers' instructions. A total of 333 spermatozoa were evaluated, in random fields. To be classified as normal, a sperm cell must have a hook-shaped head and no defects of head, neck or tail. Otherwise, spermatozoa were considered abnormal.

NMR spectroscopy

A combined extraction of polar and apolar metabolites was performed as previously described (Alves et al., 2011b). The aqueous phase containing the water-soluble metabolites was lyophilized. NMR spectra was acquired as described previously (Alves et al., 2011b). Sodium fumarate was used as an internal reference (6.50 ppm) to quantify the following metabolites (multiplet, δ, ppm): lactate (doublet, 1.33 ppm); alanine (doublet, 1.45 ppm); acetate (singlet, 1.90 ppm); creatine (singlet, 3.0 ppm); glycine (singlet, 3.54 ppm). The relative areas of 1H-NMR resonances were quantified using the curve-fitting routine supplied with the NUTSpro NMR spectral analysis program (Acorn, CA, USA).

Polymerase chain reaction

Semi-quantitative PCR was performed to analyse lactate dehydrogenase A (LDH A), monocarboxylate transporter 4 (MCT4), GLUT1, GLUT3, phosphofrutokinase 1 (PFK1) and lactate dehydrogenase C (LDHC) mRNA expression as described by Oliveira et al. (2011). Both optimal annealing temperature and the amplification size of fragments are shown in Table 1. mRNA expression was normalized with 18S gene expression and expressed as fold variation (induction/reduction) vs the control group.

Table 1. Oligonucleotides and cycling conditions for PCR amplification of LDHA, MCT4, GLUT1, GLUT3, PFK1, LDHC and 18S
GeneSequence (5′-3′)AT ( °C)Amplicon size (bp)
  1. AT: annealing temperature; C: number of cycles during exponential phase of amplification.

LDHASense:CGTCGTCCCCCATCGTGCAC60345
 Antisense:GGGCCCCCGCGGTGATAATG  
MCT4Sense:CGTCGTCCCCCATCGTGCAC60629
 Antisense:GGGCCCCCGCGGTGATAATG  
GLUT1Sense:TCCGGCGGGAGACGCATAGT61842
 Antisense:CCCGCATCATCTGCCGACCC  
GLUT3Sense:GCGCAGCCCTTCCGTTTTGC63806
 Antisense:CCCCTCGAAGGCCCGGGTAA  
PFK1Sense:GAGTGCTGACAAGCGGCGGT61839
 Antisense:GTGGCCCAGCACGGTCACTC  
LDHCSense:ATGTGGGCATGGCGTGTGCC66477
 Antisense:CCCAGCCATGGCAGCTCGAA  
18SSense:AAGACGAACCAGAGCGAAAG56149
 Antisense:GGCGGGTCATGGGAATAA  

Western blot

Western Blot procedure was performed as previously described by Alves et al. (2011a). The resulting membranes were incubated with rabbit anti-GLUT1 (1 : 300, CBL242), rabbit anti-GLUT3 (1 : 1000, ab41525), rabbit anti-PFK1 (1 : 500, Sc67028), rabbit anti-MCT4 (1 : 1000, Sc50329), rabbit anti-LDH (1 : 10000, ab52488) and rabbit anti-ALT (1 : 500, Sc99088). Mouse anti-tubulin (1 : 5000, A5441) was used as protein loading control for testicular tissue. The immunoreactive proteins were detected separately with goat anti-rabbit IgG-AP (1 : 5000, Sc2007) or goat anti-mouse IgG-AP (1 : 5000, Sc2008). Membranes were reacted with ECF detection system. The densities from each band were obtained using the Quantity One Software (Bio-Rad, Hertfordshire, UK), divided by the respective tubulin band density and then normalized against the respective control.

Enzymatic activity assays

Lactate dehydrogenase (LDH) activity was determined using a commercial assay kit (Promega, Madison, WI, USA) and following the manufacturer's instructions. Phosphofructokinase 1 (PFK1) activity was determined as previously described (Vaz et al., 2012). The enzyme activity was expressed as units per milligram of protein. The attained activities were expressed as fold variation vs. the control group.

Statistical analysis

The statistical significances of differences of all experimental data were assessed by Student-t test (GraphPad Software, San Diego, CA). All experimental data are shown as mean ± SEM; p < 0.05 was considered significant. Further analysis of the statistical power (SP) of differences of experimental data was evaluated with a one-tail test assuming an alpha of 0.05 that corresponds to a 0.95 confidence interval, as described by Levin (2011), using the software provided by http://www.dssresearch.com/KnowledgeCenter/toolkitcalculators/statisticalpowercalculators.aspx.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

High-energy diet fed rats developed mild hyperglycaemia, glucose intolerance and hypoinsulinaemia

Glycaemic values of HED fed animals were not significantly different, when compared with the control group, until the 12th treatment day. Afterwards, the glycaemia in rats from the HED group rose slightly but significantly (SP = 95%) to moderate hyperglycaemic values that were maintained up until 30th day (Fig. 1; Part A).

image

Figure 1. Blood glucose profile of the Control group (●) and the High-energy diet (HED) group animals (▲) during the 30 days of HED treatment (Part A) and blood glucose levels of the Control group (●) and the HED group animals (▲) measured during the intraperitoneal glucose tolerance test (Part B). Figure shows pooled data of independent experiments, indicating the blood glucose levels variation. Results are expressed as mean ± SEM (n = 6 for each condition). *Significantly different relative to control (p < 0.05).

Download figure to PowerPoint

As mild hyperglycaemia could lead to a glucose intolerance status, we performed an intraperitoneal glucose tolerance test that shown a significant difference in glucose profile between the animals of both groups (Fig. 1; Part B). The HED rats showed a significant increase in blood glycaemia during the 120 min of the glucose tolerance test indicating that HED rats developed glucose intolerance. These results pointed towards an insulin dysfunction status thus, we evaluated fasting insulin levels. HED rats showed a decrease in blood insulin levels of 2.64-fold (SP = 100%) when compared with control animals (Table 2).

Table 2. Average values of the animals insulin, weight and gonads measured in Control group and HED group animals after 30 days treatment
ParametersControl groupHED group
  1. HED: high-energy diet.

  2. Results are expressed as means ± SEM (n = 6 for each condition).

  3. a

    Significantly different relative to control (p < 0.05).

Insulin (μU/mL)12.54 ± 1.464.75 ± 1.51a
Body weight (g)335.67 8.69274.50 ± 8.91a
Gonad weight (g)3.61 ± 0.073.30 ± 0.04

Testosterone serum and intratesticular levels are highly reduced in HED rats

When we evaluated total T serum concentration, we observed a significant decrease of 8.5-fold in HED group when compared with the control (SP = 81%) (Fig. 2; Part A). However, serum E2 levels were not altered in both groups (Fig. 2; Part B).

image

Figure 2. Testosterone levels in intratesticular interstitial fluid and serum of Control group and High-energy diet (HED) group animals (Part A). The 17β-estradiol levels in intratesticular interstitial fluid and serum of Control group and HED group animals (Part B). Results are expressed as mean ± SEM (n = 6 for each condition). *Significantly different relative to control (p < 0.05).

Download figure to PowerPoint

Testicular cells are bathed by the TIF and the establishment of an appropriate fluid is crucial for an adequate hormonal control of spermatogenesis. As expected, our results showed that the sex hormones levels in TIF are 100-fold higher than in serum, as the sex hormones levels in the TIF are known to be significantly higher than those found in serum (Hess & Carnes, 2004; Jarow & Zirkin, 2005; Roth et al., 2010). In addition, the HED rats showed a significant decrease in T levels present in TIF when compared with control animals (SP = 100%) (Fig. 2; Part A). On the other hand HED did not significantly alter E2 concentration in TIF (Fig. 2; Part B).

Epididymal sperm motility and morphology are affected by the HED

No differences were observed for sperm viability and concentration between the HED group and the control group (Table 3). However, sperm motility was significantly higher (SP = 74%) in HED animals (68 ± 2%) than in control animals (58 ± 5%) (Table 3). Another important parameter to evaluate male fertility potential is sperm morphology (Menkveld et al., 2011). The average percentage of normal epididymal spermatozoa (Table 3) was significantly lower in the HED group animals (45.9 ± 2.3%) than in the control group (61.0 ± 0.6%) (SP = 100%).

Table 3. Epididymal sperm motility, viability, concentration and morphology of control group and HED group animals
Sperm ParametersControl GroupHED Group
  1. HED: high-energy diet.

  2. Results are expressed as means ± SEM (n = 6 for each condition).

  3. a

    Significantly different relative to control (p < 0.05).

Motility (%)58 ± 568 ± 2a
Viability (%)67 ± 276 ± 3
Concentration (107 cell/mL)2.8 ± 0.32.8 ± 0.7
Morphology (% normal spermatozoa)61.0 ± 0.645.9 ± 2.3a

High-energy diet causes a significant increase on intratesticular GLUT1 and GLUT3 levels and PFK enzymatic activity

Testicles are high-energy demand tissues, presenting a high glycolytic flux. A rate-limiting step for glucose metabolism is its import through the cytoplasmic membrane hexose transporters (Fink et al., 1992) thus, we evaluated the possible effect of HED on GLUT1 and GLUT3 transporters transcript and protein levels. Concerning GLUT1, the mRNA levels showed a slight non-significant increase (SP = 46%) in testicles of the HED animals (Fig. 3; Part A) that was followed by a 1.58-fold increase in protein levels compared with the control group (SP = 100%) (Fig. 3; Part B). GLUT3 mRNA expression in testicles from HED rats was 1.39-fold increased (SP = 93%) relative to that of controls and was followed by a 1.17-fold increase in protein levels (SP = 66%) (Fig. 3; Part B).

image

Figure 3. Effect of high-energy diet (HED) on testicular GLUT1, GLUT3 and PFK1 mRNA (Part A) and protein (Part B) levels. Pooled data of independent experiments, indicating the fold variation levels found in testis of HED group rats when compared with the Control group rats (dashed line). Part C represents an illustrative Western Blot experiment. Results are expressed as mean ± SEM (n = 5 for each condition). *Significantly different relative to control (p < 0.05).

Download figure to PowerPoint

After glucose transport, a key regulatory step of glycolytic pathway is mediated by PFK1 that irreversibly converts fructose 6-phosphate to fructose 1,6-bisphosphate (Chehtane & Khaled, 2010). Thus, we evaluated the HED effect in PFK1. The mRNA levels of PFK1 were 1.31-fold increased (SP = 68%) in HED rats compared with the control (Fig. 3; Part A), however, protein levels showed a 0.65-fold reduction when compared with control (SP = 100%) (Fig. 3; Part B). These apparent contradictory results in mRNA and protein levels, led us to evaluate PFK1 activity in testicular tissue homogenates. Although HED animals presented lower testicular PFK1 protein levels, the correspondent enzyme activity was significantly higher (0.039 ± 0.013 U/mg protein) than in control animals (0.013 ± 0.002 U/mg protein), exhibiting a three-fold increase (SP = 88%) (Fig. 4).

image

Figure 4. Effect of high-energy diet (HED) on testicular Phosphofructokinase-1 and lactate dehydrogenase activities. Bars show pooled data of independent experiments, indicating the fold variation of enzymes activities in testis of HED group rats when compared with the Control group rats(dashed line). Results are expressed as mean ± SEM (n = 5 for each condition). *Significantly different relative to control (p < 0.05).

Download figure to PowerPoint

HED increased intratesticular lactate content, LDH and MCT4 levels

For a successful spermatogenic event, lactate plays a crucial role, acting as ‘fuel’ for germ cells (Boussouar & Benahmed, 2004). Thus, we aimed to analyse the HED effect in the intratesticular lactate content and on the expression and activity of lactate-related enzymes and transporters.

Lactate content was significantly increased by 33% (SP = 74%) in the testes of HED rats to 8.34 ± 0.65 μmol/mg tissue (Table 4), thus it would be expectable that overall LDH levels would be increased in these animals. In testes, there are two main LDH isoforms: a typical LDHA and the testis-specific LDHC (Goldberg et al., 2010). We analysed the mRNA levels of both, LDHA and LDHC, and the overall LDH protein levels. Although testicular LDHA mRNA levels were not significantly different, the LDHC levels were significantly increased by 1.37-fold (SP = 87%) in HED rats when compared with control (Fig. 5; Part A). In agreement, whole-testis LDH protein content was also higher (2.10-fold) in HED than in control rats (SP = 100%) (Fig. 5; Part B). However, LDH activity was not significantly different between both control and HED groups (Fig. 4).

Table 4. Variation in the relative intratesticular metabolite content in control group and HED group animals
Metabolites (μmol/mg tissue)Control groupHED Group
  1. HED: high-energy diet.

  2. Results are expressed as means ± SEM (n = 5 for each condition).

  3. a

    Significantly different relative to control (p < 0.05).

Lactate6.29 ± 0.818.34 ± 0.65a
Alanine3.31 ± 0.352.91 ± 0.13a
Acetate0.37 ± 0.0630.51 ± 0.09
Creatine54.9 ± 4.661.3 ± 2.5
Glycine5.15 ± 0.546.44 ± 0.36a
image

Figure 5. Effect of high-energy diet (HED) on testicular LDHA, LDHC, MCT4 mRNA (Part A) or LDH, MCT4, ALT protein (Part B) levels. Pooled data of independent experiments, indicating the fold variation levels found in testis of HED group rats when compared with the Control group rats (dashed line). Part C represents an illustrative Western Blot experiment. Results are expressed as mean ± SEM (n = 5 for each condition). *Significantly different relative to control (p < 0.05).

Download figure to PowerPoint

After being produced, in the blood-testis barrier, lactate is exported through MCT4 (Brauchi et al., 2005). Therefore, we evaluated the effect of HED on MCT4 expression levels. MCT4 mRNA levels presented a significant 1.44-fold increase (Fig. 5; Part A) that was followed by a significant 2.19-fold increase in MCT4 protein levels (Fig. 5; Part B) in testis from HED rats when compared with the control group (SP = 100%).

HED modulates intratesticular alanine and glycine concentrations

Alanine metabolism is closely related to lactate production and metabolism, which can be converted to pyruvate by alanine aminotransferase (ALT) prior to the eventual conversion of pyruvate to lactate by LDH (Rato et al., 2012a). So, we measured alanine intratesticular content and ALT protein levels in the testes of animals from both groups. Alanine content was decreased by 12% in HED rats (SP = 31%), which presented an intratesticular concentration of 2.91 ± 0.13 μmol/mg tissue. This was concomitant with the significant 2.90-fold increase (SP = 100%) in ALT protein expression in HED rat testes (Fig. 5; Part B).

We also measured the intratesticular concentration of acetate as we have previously reported that acetate metabolism, which is important to membrane remodelling in germ cells and thus to spermatogenesis, is under strict insulin control (Alves et al., 2012c). Intratesticular acetate concentration in HED rats was slightly increased (not significantly). We also detected and measured the intratesticular concentration of two aminoacids, glycine and creatine, known to be used as energetic sources for testicular cells (Kaiser et al., 2005). Intratesticular glycine concentration significantly increased (SP = 75%) from 5.1 ± 0.5 in control group to 6.4 ± 0.3 in HED group (Table 4), whereas intratesticular creatine concentration was also increased by the HED (but not significantly) (Table 4).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

Diabetes mellitus is a heterogeneous metabolic disorder affecting whole body system and can result as a consequence of diet habits. There are evidences that DM negatively affects male reproductive function at multiple levels (Cameron et al., 1990; Ballester et al., 2004; Scarano et al., 2006). In this study, we used a high-energy fed rodent model, to evaluate the effects of the initial stages of development of DM on the male reproductive function. Pre-diabetes is the state in which some, but not all, of the diagnostic criteria for diabetes are met. Pre-diabetes is often connected with the metabolic syndrome, which in turn is closely associated with obesity (Liu et al., 2007; Grundy, 2012). The pre-diabetic state is characterized by impaired fasting glucose or glucose intolerance and by mild-hyperglycaemia (Tabák et al., 2012). In this study, the administration of a HED to adult rats led to the development of those two characteristics, glucose intolerance and mild-hyperglycaemia, suggesting that HED animals developed a pre-diabetic state. HED animals also presented a significant lower weight gain when compared with control animals, a feature consistent with what is reported in several other studies using high-energy/high-fat diets that did not induce weight gain (Prieto-Hontoria et al., 2009; Betz et al., 2012). Indeed, those authors described that rats fed with high-fat diets displayed a lower body weight gain probably because of low protein content in high-fat diets, which favours an increase of brown adipose tissue and not the heavier white adipose and muscle tissues. This may explain why the HED animals exhibited a lower weight gain after high-energy diet treatment. Nonetheless, control and HED animals presented similar gonadal weights, which indicate that the testicular architecture is maintained.

However, those animals presented a slight but significant increase in glycaemia levels. The mild glycaemia observed in the HED animals does not meet the criteria for established DM (Sinzato et al., 2009), but these animals showed an impaired glucose tolerance (2-h post-load glucose, levels of glycaemia remained >140 mg/dL and <200 mg/dL) indicating a ‘status’ of increased risk for DM, often designated as pre-diabetic state (Andrikopoulos et al., 2008; Gupte et al., 2010). The pre-diabetic state has also been associated with impairment of insulin secretion and decreased insulin serum levels (Andrikopoulos et al., 2008). Indeed, our results showed a significant decrease in serum insulin concentration in HED rats. Taken together these markers exhibited by HED rats suggest that a pre-diabetic state was developed in these animals (Tabak et al., 2009; Ize-Ludlow et al., 2011) increasing the relevance of this study.

DM has also been associated with sex steroid levels imbalance (Seethalakshmi et al., 1987; Maric et al., 2010). In fact, HED rats showed a significant decrease in intratesticular and serum T levels that could be explained by the lower serum insulin levels, as it has been reported that insulin may act directly in brain through its receptors located in hypothalamus and pituitary (Havrankova et al., 1978) and that low insulin levels negatively affect T secretion. In addition, it was demonstrated that insulin administration is able to restore the hypothalamus-pituitary-gonad axis functioning and normalize T levels in diabetic mice (Schoeller et al., 2012). Moreover, studies with neuron-specific insulin receptor knockout mouse have evidenced the role of insulin in male fertility maintenance (Bruning et al., 2000). Concerning estradiol levels we did not observe significant differences at serum and intratesticular levels between animals from both groups. These results are in accordance with those obtained by Burul-Bozkurt et al. (2010) that reported no alterations on the plasma estradiol levels in streptozotocin-treated rats. The results obtained in this study can be explained by the fact that the animal model developed a pre-diabetic state and not an advanced stage of disease where a marked sex steroid hormone deregulation occurs (Maneesh et al., 2006; Maric et al., 2010).

It is well documented that sperm parameters are compromised in diabetic individuals (Padron et al., 1984; Ali et al., 1993; La Vignera et al., 2011). In this study, evaluation of reproductive parameters showed altered motility and morphology, although no differences in sperm concentration and viability were observed between animals of both groups. As referred above, glycaemia is slightly increased in pre-diabetes. In addition, there is evidence that glucose metabolism may be enhanced by the pre-diabetic state, thus favouring oxidative stress. Indeed, higher glucose availability may lead to an increased glycolytic activity and therefore an overproduction of reactive oxygen species (ROS). In the seminiferous tubules, ROS are continuously produced by the Sertoli cells and the germ cells as a result of their continuous metabolic activity (Fujii et al., 2003). Different testicular cells show different susceptibility to ROS (Bauche et al., 1994; Fujii et al., 2003). Thus, an increased oxidative environment leads to cellular damages such as lipid peroxidation and DNA fragmentation with consequent sperm abnormalities (Rabbani et al., 2010). Nevertheless, a higher availability of glucose will increase sperm ATP production. There are evidences regarding a direct relation between glucose availability and consumption by spermatozoa (Hoppe, 1976). Other authors have also reported that epididymal cells uptake glucose by facilitated transport (Brooks, 1979) and gradient concentration (Hinton & Howards, 1982). These facts suggest that a high serum glucose concentration, as happens in a mild hyperglycaemic state, may increase the epididymal glucose content, that after being internalized by spermatozoa is readily metabolized to produce ATP by oxidative phosphorylation and may lead to an increase in sperm motility (Williams & Ford, 2001). Crucial for sperm formation and normal spermatogenesis is the overall testicular metabolism. Recently, we have reported the influence of sex steroid hormones on testicular cells metabolism (Oliveira et al., 2011; Alves et al., 2012c; Rato et al., 2012a) concluding that hormonal deregulation can modulate SCs metabolism, and thus spermatogenesis. Glucose is a key substrate in testicular energy metabolism, as testes present high glycolytic flux, but these organs are not able to accumulate this metabolite (Mallidis et al., 2009) because glucose is rapidly oxidized in this tissue (Setchell & Hinks, 1967). It was also reported that, SCs cultured in the absence of glucose (Riera et al., 2009) and under insulin deprivation presented an altered glucose metabolism and modulation of GLUT1 and GLUT3 transcript levels (Oliveira et al., 2012). As expected, because of lower insulin and higher glucose levels in HED rats, GLUT1 and GLUT3 protein levels increased to favour the glucose uptake by the cells. Once inside the cells, glucose enters in the glycolytic process and PFK1 irreversibly catalyses fructose-6-phosphate to fructose-1-6-bis-phosphate (Chehtane & Khaled, 2010) in a rate-limiting step for glucose metabolism. Following the GLUT1 and GLUT3 increase, testicular PFK1 activity was also increased in HED rats supporting that the glycolytic process was stimulated in HED rats. Interestingly, at translational level, HED reduced the protein levels but increased the mRNA levels of PFK1. In fact the observed increase in PFK1 mRNA levels may not be immediately reflected in protein levels. This may be the consequence of several factors associated with gene expression regulatory mechanisms complexity, such as, mRNA retention in the nucleus, processing, stability and half-life time of mRNA molecule, control of protein translation efficiency, post-translational modifications and protein degradation (Vaz et al., 2012). Taking into account these facts, the authors assessed PFK1 activity and observed that HED PFK1 activity was two-fold higher than control group, suggesting that glycolytic process was stimulated in HED animals. Also, it has been described that lactate is a modulator of glycolytic enzymes expression and activity (Leite et al., 2011). In fact, intratesticular lactate concentration was found to be increased in HED rats and therefore one cannot exclude the possible regulatory role of this metabolite in PFK1 protein levels. Overall, the HED stimulated glucose uptake by GLUTs and PFK1 activity.

In testis, lactate is no longer considered a dead-end waste product of glycolysis, but an active metabolite that is known to be produced in high quantities by SCs and acts as a fuel for developing germ cells (Boussouar & Benahmed, 2004). Therefore, as expected, intratesticular lactate concentration in HED rats was significantly increased. This is also concomitant with the significant increase in mRNA and protein levels of LDH, which is responsible for the interconversion of pyruvate derived from glucose metabolization into lactate (Rato et al., 2012a). Once produced by testicular cells, namely by SCs, lactate is exported through MCT4 (Rato et al., 2012a). Accordingly, MCT4 protein and mRNA levels were also increased suggesting that HED stimulates lactate production and export by testicular cells.

The lactate produced by cells is derived from pyruvate that is at crossroads between lactate and alanine. These interconversion reactions are crucial in testicular cells for the occurrence of a normal spermatogenesis (Rato et al., 2012b). Therefore, we evaluated the possible role for alanine in lactate intratesticular concentration. In fact, intratesticular alanine concentration was significantly decreased in HED group suggesting that this metabolite is also highly consumed for lactate production. This amino acid is converted from pyruvate via transaminase reaction, catalysed by ALT (Yang et al., 2002) and as expected HED rats presented an increase in ALT protein levels. Importantly, the lactate/alanine ratio is of great importance, and often used as an index of the redox state of tissues and cells (O'Donnell et al., 2004), because it reflects the NAD+/NADH ratio. The decreased levels of alanine together with the increased lactate concentration leads to an oxidized redox state, thus, an increased testicular lactate/alanine ratio in HED rats reflects a higher degree of overall testicular oxidative stress. Testicular cells often consume several other substrates than lactate and glucose. For instance SCs can consume a variety of substrates to maintain lactate production for the developing germ cells. Thus, we detected and quantified relevant metabolites that act as energy sources for testicular cells (Alves et al., 2012c; Rato et al., 2012a). Glycine was found to be significantly increased in HED rats. This amino acid is an important precursor for the Krebs cycle and protein synthesis (Kaiser et al., 2005) and, as shown above, glycolysis was highly stimulated by HED and is the metabolic preferential pathway under these conditions thus explaining the increased levels of glycine. In addition, concomitant with this hypothesis, creatine levels increased in HED rats, although creatine can also be used as an energy source (Moore et al., 1998). Recently we reported the hormonal control of acetate metabolism by sex steroids and insulin in cultured human SCs (Alves et al., 2012c) and showed that under insulin deprivation, acetate production is completely suppressed, whereas E2 favoured acetate production and di-hydrotestosterone decrease its production. Thus, it would be expected that intratesticular acetate concentration could be decreased as insulin concentration was significantly decreased, but one cannot forget that SCs present a unique hormonal control of their metabolic profile (Alves et al., 2012b), that may not be followed by other testicular cells. Also, this intermediate of fatty acids synthesis and cholesterol is important for spermatogenesis as its metabolism produces essential sub-products to maintain lipid synthesis and remodelling in developing germ cells.

These are clear evidences that testes develop adaptive mechanisms to ensure an adequate microenvironment for germ cells development. Intratesticular metabolic flux has arisen as one of the new challenges that reproductive biology faces in next century. In this study we describe important metabolic features and possible mechanisms within testes concerning the onset of a pre-diabetic state. Pre-diabetes is often associated with an initial stage of development of DM and, moreover, it is well known that pre-diabetes can be reversed to normoglycaemia (Tuomilehto et al., 2001; Perreault et al., 2012). To the best of our knowledge, this is the first report giving new insights over testicular metabolic mechanisms at this very early stage of DM development. Our results show that pre-diabetes may lead to subtle testicular metabolic changes, with altered sperm parameters. These results are of great significance and this topic should deserve special attention in future, as there is an increasing incidence of DM among young diabetic individuals and the reasons for subfertility/infertility associated to the early stages of this pathology remain to be clarified. Further knowledge on the functioning and regulation of these mechanisms, especially in early onset of the disease, will be essential to counteract the undesirable effects of DM on male reproductive function.

Funding

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

This work was supported by the Portuguese ‘Fundação para a Ciência e a Tecnologia’ – FCT co-funded by FEDER via Programa Operacional Factores de Competitividade – COMPETE/QREN (PTDC/QUI-BIQ/121446/2010 and PEst-C/SAU/UI0709/2011). L. R (SFRH/BD/72733/2010) and M. G. A (SFRH/BPD/80451/2011) were financed by FCT. P. F. O was financed by FCT through FSE and POPH funds (Programa Ciência 2008).

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References

The authors thank Maria João Silva and Maria José Pinto for their technical assistance in animal care and handling. They also thank Johnsons Portugal and Dalila Côrte for the glucometer and compatible reactive strips they provided.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Funding
  8. Acknowledgements
  9. References
  • Agbaje IM, Rogers DA, McVicar CM, McClure N, Atkinson AB, Mallidis C et al. (2007) Insulin dependent diabetes mellitus: implications for male reproductive function. Hum Reprod 22, 18711877.
  • Ai J, Wang N, Yang M, Du ZM, Zhang YC & Yang BF. (2005) Development of Wistar rat model of insulin resistance. World J Gastroenterol 11, 36753679.
  • Ali ST, Shaikh RN, Siddiqi NA & Siddiqi PQ. (1993) Semen analysis in insulin-dependent/non-insulin-dependent diabetic men with/without neuropathy. Arch Androl 30, 4754.
  • Alves MG, Machado NG, Sardao VA, Carvalho RA & Oliveira PJ. (2011a) Anti-apoptotic protection afforded by cardioplegic celsior and histidine buffer solutions to hearts subjected to ischemia and ischemia/reperfusion. J Cell Biochem 112, 38723881.
  • Alves MG, Oliveira PJ & Carvalho RA. (2011b) Substrate selection in hearts subjected to ischemia/reperfusion: role of cardioplegic solutions and gender. NMR Biomed 24, 10291037.
  • Alves MG, Oliveira PF, Socorro S & Moreira PI. (2012a) Impact of diabetes in blood-testis and blood-brain barriers: resemblances and differences. Curr Diabetes Rev 8, 401412.
  • Alves MG, Rato L, Carvalho RA, Moreira PI, Socorro S & Oliveira PF. (2012b) Hormonal control of Sertoli cell metabolism regulates spermatogenesis. Cell Mol Life Sci 70(5), 777793.
  • Alves MG, Socorro S, Silva J, Barros A, Sousa M, Cavaco JE et al. (2012c) In vitro cultured human Sertoli cells secrete high amounts of acetate that is stimulated by 17beta-estradiol and suppressed by insulin deprivation. Biochim Biophys Acta 1823, 13891394.
  • Amaral S, Moreno AJ, Santos MS, Seica R & Ramalho-Santos J. (2006) Effects of hyperglycemia on sperm and testicular cells of Goto-Kakizaki and streptozotocin-treated rat models for diabetes. Theriogenology 66, 20562067.
  • American Diabetes Association (2012) Diagnosis and classification of diabetes mellitus. Diabetes Care 35(Suppl 1), S64S71.
  • Andrikopoulos S, Blair AR, Deluca N, Fam BC & Proietto J. (2008) Evaluating the glucose tolerance test in mice. Am J Physiol Endocrinol Metab 295, E1323E1332.
  • Ballester J, Munoz MC, Dominguez J, Rigau T, Guinovart JJ & Rodriguez-Gil JE. (2004) Insulin-dependent diabetes affects testicular function by FSH- and LH-linked mechanisms. J Androl 25, 706719.
  • Bauche F, Fouchard MH & Jegou B. (1994) Antioxidant system in rat testicular cells. FEBS Lett 349, 392396.
  • Betz MJ, Bielohuby M, Mauracher B, Abplanalp W, Muller HH, Pieper K et al. (2012) Isoenergetic feeding of low carbohydrate-high fat diets does not increase brown adipose tissue thermogenic capacity in rats. PLoS ONE 7, e38997.
  • Boussouar F & Benahmed M. (2004) Lactate and energy metabolism in male germ cells. Trends Endocrinol Metab 15, 345350.
  • Brauchi S, Rauch MC, Alfaro IE, Cea C, Concha II, Benos DJ et al. (2005) Kinetics, molecular basis, and differentiation of L-lactate transport in spermatogenic cells. Am J Physiol Cell Physiol 288, C523C534.
  • Brooks DE. (1979) Carbohydrate metabolism in the rat epididymis: evidence that glucose is taken up by tissue slices and isolated cells by a process of facilitated transport. Biol Reprod 21, 1926.
  • Bruning JC, Gautam D, Burks DJ, Gillette J, Schubert M, Orban PC et al. (2000) Role of brain insulin receptor in control of body weight and reproduction. Science 289, 21222125.
  • Burul-Bozkurt N, Pekiner C & Kelicen P. (2010) Diabetes alters aromatase enzyme levels in gonadal tissues of rats. Naunyn-Schmiedeberg's Arch Pharmacol 382, 3341.
  • Cameron DF, Rountree J, Schultz RE, Repetta D & Murray FT. (1990) Sustained hyperglycemia results in testicular dysfunction and reduced fertility potential in BBWOR diabetic rats. Am J Physiol 259, E881E889.
  • Chehtane M & Khaled AR. (2010) Interleukin-7 mediates glucose utilization in lymphocytes through transcriptional regulation of the hexokinase II gene. Am J Physiol Cell Physiol 298, C1560C1571.
  • Delfino M, Imbrogno N, Elia J, Capogreco F & Mazzilli F. (2007) Prevalence of diabetes mellitus in male partners of infertile couples. Minerva Urol Nefrol 59, 131135.
  • Dicker K. (2010) Diet and Nutrition, Evans Brothers, Limited, London, UK.
  • Fink R, Wallace P, Brechtel G & Olefsky J. (1992) Evidence that glucose transport is rate-limiting for in vivo glucose uptake. Metabolism 41, 897902.
  • Fujii J, Iuchi Y, Matsuki S & Ishii T. (2003) Cooperative function of antioxidant and redox systems against oxidative stress in male reproductive tissues. Asian J Androl 5, 231242.
  • Goldberg E, Eddy EM, Duan C & Odet F. (2010) LDHC: the ultimate testis-specific gene. J Androl 31, 8694.
  • Grundy SM. (2012) Pre-diabetes, metabolic syndrome, and cardiovascular risk. J Am Coll Cardiol 59, 635643.
  • Gupte S, Labinskyy N, Gupte R, Csiszar A, Ungvari Z & Edwards JG. (2010) Role of NAD(P)H oxidase in superoxide generation and endothelial dysfunction in Goto-Kakizaki (GK) rats as a model of nonobese NIDDM. PLoS ONE 5, e11800.
  • Havrankova J, Schmechel D, Roth J & Brownstein M. (1978) Identification of insulin in rat brain. Proc Natl Acad Sci U S A 75, 57375741.
  • Hess R & Carnes K. (2004) The role of estrogen in testis and the male reproductive tract: a review and species comparison. Anim Reprod 1, 530.
  • Hinton BT & Howards SS. (1982) Rat testis and epididymis can transport [3H] 3-O-methyl-D-glucose, [3H] inositol and [3H] alpha-aminoisobutyric acid across its epithelia in vivo. Biol Reprod 27, 11811189.
  • Hoppe PC. (1976) Glucose requirement for mouse sperm capacitation in vitro. Biol Reprod 15, 3945.
  • Ismail K. (2008) Eating disorders and diabetes. Psychiatry 7, 179182.
  • Ize-Ludlow D, Lightfoot YL, Parker M, Xue S, Wasserfall C, Haller MJ et al. (2011) Progressive erosion of beta-cell function precedes the onset of hyperglycemia in the NOD mouse model of type 1 diabetes. Diabetes 60, 20862091.
  • Jarow JP & Zirkin BR. (2005) The androgen microenvironment of the human testis and hormonal control of spermatogenesis. Ann N Y Acad Sci 1061, 208220.
  • Kaiser GR, Monteiro SC, Gelain DP, Souza LF, Perry ML & Bernard EA. (2005) Metabolism of amino acids by cultured rat Sertoli cells. Metabolism 54, 515521.
  • La Vignera S, Calogero AE, Condorelli R, Lanzafame F, Giammusso B & Vicari E. (2009) Andrological characterization of the patient with diabetes mellitus. Minerva Endocrinol 34, 19.
  • La Vignera S, Condorelli R, Vicari E, D'Agata R & Calogero AE. (2011) Diabetes mellitus and sperm parameters. J Androl 33, 145153.
  • Leite TC, Coelho RG, Da Silva D, Coelho WS, Marinho-Carvalho MM & Sola-Penna M. (2011) Lactate downregulates the glycolytic enzymes hexokinase and phosphofructokinase in diverse tissues from mice. FEBS Lett 585, 9298.
  • Levin Y. (2011) The role of statistical power analysis in quantitative proteomics. Proteomics 11, 25652567.
  • Liu J, Grundy SM, Wang W, Smith SC, Lena Vega G, Wu Z et al. (2007) Ten-year risk of cardiovascular incidence related to diabetes, prediabetes, and the metabolic syndrome. Am Heart J 153, 552558.
  • Lopes G, Simoes A, Ferreira P, Martins-Bessa A & Rocha A. (2009) Differences in preservation of canine chilled semen using different transport containers. Anim Reprod Sci 112, 158163.
  • Mallidis C, Green B, Rogers D, Agbaje I, Hollis J, Migaud M et al. (2009) Metabolic profile changes in the testes of mice with streptozotocin-induced type 1 diabetes mellitus. Int J Androl 32, 156165.
  • Maneesh M, Jayalakshmi H, Singh TA & Chakrabarti A. (2006) Impaired hypothalamic-pituitary-gonadal axis function in men with diabetes mellitus. Indian J Clin Biochem 21, 165168.
  • Maric C, Forsblom C, Thorn L, Waden J, Groop PH & FinnDiane Study Group. (2010) Association between testosterone, estradiol and sex hormone binding globulin levels in men with type 1 diabetes with nephropathy. Steroids 75, 772778.
  • Menkveld R, Holleboom CA & Rhemrev JP. (2011) Measurement and significance of sperm morphology. Asian J Androl 13, 5968.
  • Moore NP, Gray TJ & Timbrell JA. (1998) Creatine metabolism in the seminiferous epithelium of rats. II. Effect of modulators of cellular biochemical function on creatine secretion by cultured Sertoli cells. J Reprod Fertil 112, 331336.
  • Nunes E, Peixoto F, Louro T, Sena CM, Santos MS, Matafome P et al. (2007) Soybean oil treatment impairs glucose-stimulated insulin secretion and changes fatty acid composition of normal and diabetic islets. Acta Diabetol 44, 121130.
  • O'Donnell JM, Kudej RK, LaNoue KF, Vatner SF & Lewandowski ED. (2004) Limited transfer of cytosolic NADH into mitochondria at high cardiac workload. Am J Physiol Heart Circ Physiol 286, H2237H2242.
  • Oliveira PF, Alves MG, Rato L, Silva J, Sa R, Barros A et al. (2011) Influence of 5alpha-dihydrotestosterone and 17beta-estradiol on human Sertoli cells metabolism. Int J Androl 34, e612e620.
  • Oliveira PF, Alves MG, Rato L, Laurentino S, Silva J, Sa R et al. (2012) Effect of insulin deprivation on metabolism and metabolism-associated gene transcript levels of in vitro cultured human Sertoli cells. Biochim Biophys Acta 1820, 8489.
  • Padron RS, Dambay A, Suarez R & Mas J. (1984) Semen analyses in adolescent diabetic patients. Acta Diabetologica Latina 21, 115121.
  • Perreault L, Pan Q, Mather KJ, Watson KE, Hamman RF & Kahn SE. (2012) Effect of regression from prediabetes to normal glucose regulation on long-term reduction in diabetes risk: results from the diabetes prevention program outcomes study. Lancet 379, 22432251.
  • Porter KL, Shetty G & Meistrich ML. (2006) Testicular edema is associated with spermatogonial arrest in irradiated rats. Endocrinology 147, 12971305.
  • Prieto-Hontoria PL, Perez-Matute P, Fernandez-Galilea M, Barber A, Martinez JA & Moreno-Aliaga MJ. (2009) Lipoic acid prevents body weight gain induced by a high fat diet in rats: effects on intestinal sugar transport. J Physiol Biochem 65, 4350.
  • Rabbani SI, Devi K & Khanam S. (2010) Pioglitazone, a PPAR-gamma ligand inhibited the nicotinamide-streptozotocin induced sperm abnormalities in type-2 diabetic Wistar rats. Pak J Pharm Sci 23, 326331.
  • Rato L, Socorro S, Cavaco JE & Oliveira PF. (2010) Tubular fluid secretion in the seminiferous epithelium: ion transporters and aquaporins in Sertoli cells. J Membr Biol 236, 215224.
  • Rato L, Alves M, Socorro S, Carvalho RA, Cavaco JE & Oliveira PF. (2012a) Metabolic modulation induced by Estradiol and DHT in immature rat Sertoli cells cultured in vitro. Biosci Rep 32, 6169.
  • Rato L, Alves MG, Socorro S, Duarte AI, Cavaco JE & Oliveira PF. (2012b) Metabolic regulation is important for spermatogenesis. Nat Rev Urol 9, 330338.
  • Riera MF, Galardo MN, Pellizzari EH, Meroni SB & Cigorraga SB. (2009) Molecular mechanisms involved in Sertoli cell adaptation to glucose deprivation. Am J Physiol Endocrin Metab 297, 907914.
  • Roth MY, Lin K, Amory J, Matsumoto A, Anawalt B, Snyder C et al. (2010) Serum LH correlates highly with intratesticular steroid levels in normal men. J Androl 31, 138.
  • Salek RM, Maguire ML, Bentley E, Rubtsov DV, Hough T, Cheeseman M et al. (2007) A metabolomic comparison of urinary changes in type 2 diabetes in mouse, rat, and human. Physiol Genomics 29, 99108.
  • Scarano WR, Messias AG, Oliva SU, Klinefelter GR & Kempinas WG. (2006) Sexual behaviour, sperm quantity and quality after short-term streptozotocin-induced hyperglycaemia in rats. Int J Androl 29, 482488.
  • Schoeller EL, Albanna G, Frolova AI & Moley KH. (2012) Insulin rescues impaired spermatogenesis via the hypothalamic-pituitary-gonadal axis in Akita diabetic mice and restores male fertility. Diabetes 61, 18691878.
  • Seethalakshmi L, Menon M & Diamond D. (1987) The effect of streptozotocin-induced diabetes on the neuroendocrine-male reproductive tract axis of the adult rat. J Urol 138, 190194.
  • Setchell BP & Hinks NT. (1967) The importance of glucose in the oxidative metabolism of the testis of the conscious ram and the role of the pentose cycle. Biochem J 102, 623630.
  • Sinzato YK, Lima PH, Campos KE, Kiss AC, Rudge MV & Damasceno DC. (2009) Neonatally-induced diabetes: lipid profile outcomes and oxidative stress status in adult rats. Rev Assoc Med Bras 55, 384388.
  • Sivabalan S, Renuka S & Menon VP. (2008) Fat feeding potentiates the diabetogenic effect of dexamethasone in Wistar rats. Int Arch Med 1, 7.
  • Tabak AG, Jokela M, Akbaraly TN, Brunner EJ, Kivimaki M & Witte DR. (2009) Trajectories of glycaemia, insulin sensitivity, and insulin secretion before diagnosis of type 2 diabetes: an analysis from the Whitehall II study. Lancet 373, 22152221.
  • Tabák AG, Herder C, Rathmann W, Brunner EJ & Kivimaki M. (2012) Prediabetes: a high-risk state for diabetes development. Lancet 379, 22792290.
  • Tuomilehto J, Lindstrom J, Eriksson JG, Valle TT, Hamalainen H, Ilanne-Parikka P et al. (2001) Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. N Engl J Med 344, 13431350.
  • Utzschneider KM, Prigeon RL, Faulenbach MV, Tong J, Carr DB, Boyko EJ et al. (2009) Oral disposition index predicts the development of future diabetes above and beyond fasting and 2-h glucose levels. Diabetes Care 32, 335341.
  • Vaz CV, Alves MG, Marques R, Moreira PI, Oliveira PF, Maia CJ et al. (2012) Androgen-responsive and nonresponsive prostate cancer cells present a distinct glycolytic metabolism profile. Int J Biochem Cell Biol 44, 20772084.
  • Williams AC & Ford WC. (2001) The role of glucose in supporting motility and capacitation in human spermatozoa. J Androl 22, 680695.
  • Yang RZ, Blaileanu G, Hansen BC, Shuldiner AR & Gong DW. (2002) cDNA cloning, genomic structure, chromosomal mapping, and functional expression of a novel human alanine aminotransferase. Genomics 79, 445450.
  • Zhao LC, Zhang XD, Liao SX, Gao HC, Wang HY & Lin DH. (2010) A metabonomic comparison of urinary changes in Zucker and GK rats. J Biomed Biotechnol 2010, 431894.
  • Zou Y, Li J, Lu C, Wang J, Ge J, Huang Y et al. (2006) High-fat emulsion-induced rat model of nonalcoholic steatohepatitis. Life Sci 79, 1100.