Potential of marine lactic acid bacteria to ferment Sargassum sp. for enhanced anticoagulant and antioxidant properties

Authors

  • P. Shobharani,

    1. Food Microbiology Department, Central Food Technological Research Institute (Council of Scientific and Industrial Research), Mysore, India
    Search for more papers by this author
  • P.M. Halami,

    1. Food Microbiology Department, Central Food Technological Research Institute (Council of Scientific and Industrial Research), Mysore, India
    Search for more papers by this author
  • N.M. Sachindra

    Corresponding author
    1. Meat, Fish and Poultry Technology, Central Food Technological Research Institute (Council of Scientific and Industrial Research), Mysore, India
    • Food Microbiology Department, Central Food Technological Research Institute (Council of Scientific and Industrial Research), Mysore, India
    Search for more papers by this author

Correspondence

N.M. Sachindra, CFTRI, Mysore, Karnataka 570 020, India. E-mail: sachiprathi@yahoo.com

Abstract

Aim

To evaluate the suitability of marine lactic acid bacteria (LAB) as starter cultures for Sargassum sp. fermentation to enhance its antioxidant and anticoagulation activity.

Methods and Results

LAB isolated from marine source were characterized for their ability to utilize seaweed as a sole carbon source and applied to Sargassum fermentation. Fermentation period was optimized by monitoring the fermented sample at regular interval for a period of 18 days. Results revealed that a fermentation period of 12 days was effective with maximum culture viability and other desirable characteristics such as pH, total titratable acidity, total and reducing sugars. Under optimum fermentation period, the sample fermented with P1-2CB-w1 (Enterococcus faecium) exhibited maximum anticoagulation activity and antioxidant activity.

Conclusions

The study reveals a novel well-defined starter culture from marine origin intended for seaweed fermentation for recovery of bioactive molecules.

Significance and Impact of the study

The study provides information for the enhancement of bioactive molecules in an eco-friendly manner and also paves a way towards the development of wide range of seaweed functional foods.

Introduction

Lactic acid bacteria (LAB) constitute a large group of nonsporulating, Gram-positive, catalase- and oxidase-negative rods/cocci that produce lactic acid as major end product of carbohydrate fermentation. They have a long history for being responsible for fermentative preservation of many foods. LAB are ubiquitous in nature and have been isolated from various habitats. They not only contribute distinct flavour, texture and aroma to fermented product but can also produce lactic acid and other antimicrobial peptides that can reduce the risk of pathogenic microbes. In spite of the voluminous information about LAB, only few studies are available for LAB from marine origin (Ringo and Gatesoupe 1998).

Marine algae are rich source of biologically active compounds and are well recognized for their polysaccharides and polyphenols that have pharmacological and therapeutic application (Sowmya et al. 2011). The brown alga Sargassum have been extensively exploited for their various biological activities including anticoagulant, antioxidant, antimicrobial, anti-inflammatory, anticancer, anti-herpes activity and anti-hyperlipidemic activity (Sachindra et al. 2010; Wang et al. 2011). To obtain these bioactive molecules, researchers have applied various methods including acid base hydrolysis, hot water or solvent extraction and enzymatic digestion (Heo et al. 2003; Athukorala et al. 2007; Ekanayake et al. 2008). Although these methods are found to be effective, there are several limitations such as toxicity, high cost and complex procedure. In certain cases, enzymatic digestion has been employed for higher yield but its substrate specificity, pH adjustment and residual effects are known to increase the production cost (Heo et al. 2003). Hence, fermentation technique using LAB has been employed in the present study as a cost-effective method for extraction of bioactive molecules.

Application of marine bacterium with higher decomposing activity for seaweed degradation is known to pose several problems including reduction of dietary value and adverse effect on seaweed. To overcome these problems, cellulase has been applied for initial decomposition followed by lactic acid fermentation (Uchida and Murata 2002). In this regard, recently we have screened and characterized a cellulase from Bacillus megaterium, a marine isolate with a potential ability to hydrolyse seaweed cell wall (Shobharani et al. 2012). The same enzyme was used in the present study for initial saccharification followed by fermentation with native LAB isolates of marine origin for enhancement of antioxidant and anticoagulant activity.

Thrombosis, a condition created by formation of clot inside blood vessel resulting in cardiovascular disorders, is considered to be the leading cause of death throughout the globe (WHO 2007). Although heparin, an anticoagulant isolated from pig intestine or bovine lungs, is available for treatment of thrombotic diseases, their side effects including thrombocytopenia, haemorrhagic effect, ineffectiveness in congenital deficiency and inability to inhibit thrombin bound to fibrin have created the necessity to discover the alternative source of anticoagulants for safer therapy. In this regard, marine algae have gained much attention because of their potential anticoagulant property (Pereira et al. 2002; De Zoysa et al. 2008; Rodrigues et al. 2011). Further oxidative free radical released by chemical reactions and metabolic processes are known to cause lipid and protein oxidation, DNA damage and cellular degeneration that are related to cardiovascular diseases, inflammatory conditions, ageing, cancer and other variety of disorders. Several synthetic antioxidants such as butylated hydroxyanisole (BHA), butylated hydroxyl toluene (BHT) and tertiary butyl hydroxy quinine (TBHQ) have proven promising effect through their free radicals scavenging activity either by acting as hydrogen or electron donors and thus protecting the body from degenerative diseases. The safety and toxicity of such synthetic antioxidants are considered to be of great concern for their broad spectrum usage. Hence, there is an increasing demand for alternative antioxidants that are safe, nontoxic and more active with low-cost production. As reported previously, seaweeds are known to contain reactive antioxidant molecules as well as secondary metabolites that act as a source of natural antioxidants (Sowmya et al. 2011). Thus, the present invention comprises the study to enhance the anticoagulant and antioxidant activity of seaweed through fermentation by native marine isolates of LAB.

Materials and methods

Materials

Sargassum sp. from west coast of India were collected immediately after harvest and then transported under iced condition. The seaweed samples were then washed thoroughly with distilled water, dried in through-flow drier (55°C for 15 h) and milled using Apex mill to fine powder and sieved using 20 mesh. All microbial media chemicals were purchased from Hi Media Pvt Ltd, Mumbai, India. Ascorbic acid, 3,5-dinitrosalicylic acid (DNS), glucose, NaCl, ferric chloride and calcium chloride were of AR grade from Sisco Research Laboratory, Bangalore, India. 2,2-Diphenyl 1-picrylhydrazyl (DPPH), 2,2-azinobis-3-ethylbenzothiazoline-6-sulphonate (ABTS), peroxidase, synthetic antioxidant standards, Taq DNA polymerase, MgCl2, dNTPs and PCR buffer were procured from Sigma-Aldrich Inc., St Louis, MO, USA. Activated partial thromboplastin time (APTT) reagent, prothrombin time (PT) and heparin were from Tulip Diagnostics (P) Ltd, Goa, India. All other chemicals used were of analytical reagent grade.

Bacterial cultures and growth conditions

The LAB isolates used in the study were grown in deMann Rogosa and Sharpe (MRS) broth at 37°C for 24 h. Pediococcus pentosaceus NCIM 5420, Pediococcus acidilactici NCIM 5424, Lactobacillus plantarum MTCC 1328, Lactobacillus fermentum (milk) of food origin and Enterococcus durans NCIM 5427, Enterococcus faecium NCIM 5363 previously isolated from fish waste and deposited at culture collection centre of Food Microbiology Department, Central Food Technological Research Institute (CFTRI), Mysore, were used as reference cultures.

Isolation and screening of LAB for seaweed fermentation

For isolation of LAB, marine samples such as sediments, water and seaweeds were collected from the west coast of India. Serially diluted sample was plated on modified MRS agar media containing Sargassum dry powder (1%) as a substitute to glucose and supplemented with bromocresol purple (0·002%) as indicator. After 24–48 h of incubation at 37°C, the yellow-coloured colonies grown (i.e. acid producing) were purified by repeated streaking and Gram-positive, catalase-negative, nonspore forming and nonhaemolytic cultures were selected. For further screening, cultures were grown in seaweed extract media containing hot water extract of Sargassum sp (1%) as sole carbon source along with yeast extract (0·1%) and NaCl (0·5%).

Bacterial identification and characterization

The genomic DNA from selected bacterial cultures was extracted according to the method described by Mora et al. (2000), and the 16S rRNA gene was amplified by using forward primer BSF (3′ GAGTTTGATCCTGGCTCAGG 5′) and reverse primer (3′TCATCT GTCCC ACC TTCGGC 5′) as per the conditions described by Raghavendra and Halami (2009). The sequencing of the purified PCR product was performed at Vimta Labs facility, Hyderabad, India. The taxonomical identification of LAB was performed by blast search. Phylogenetic tree was constructed by using neighbour-joining method with bootstrap (1000 replicates) by Kimura 2-parameter model using mega 4 program (Kumar et al. 2008). Nucleotide sequences of the new isolates were deposited at NCBI DNA database with accession number JQ901098 to JQ901101, and the cultures were deposited at laboratory culture collection centre of Food Microbiology Department, CFTRI, Mysore.

Biochemical characterization

Preliminary phenotypic features, growth responses to pH, NaCl concentration in cultivation medium (MRS; deMan et al. 1960) and growth temperature were analysed for native cultures according to Bergey's Manual of Systematic Bacteriology. Carbohydrate fermentation pattern of the isolates was studied by cultivating in MRS media (devoid of beef extract and carbon source) supplemented with filter-sterilized sugar (1%) and bromocresol purple (0·002%). Casein and starch hydrolysis were analysed by growing the cultures in respective media and observing for zone of hydrolysis (Stanier et al. 1989). Citrate utilization was confirmed by growing in Simmons citrate agar media (Simmons 1926) and examined for change in colour of the media.

Optimization of fermentation conditions

Bacterial growth and inoculum preparation

For inoculum preparation, the selected cultures grown in MRS broth (100 ml) were centrifuged at 10 000 g for 10 min. The cell pellet was washed with saline and resuspended in the same. This was serially diluted to obtain an inoculum concentration of 105 CFU ml−1 as determined by the plate count method.

Preparation of crude cellulase

Bacillus megaterium, a potent cellulolytic culture (Shobharani et al. 2012), was grown in LB broth (100 ml) supplemented with carboxy methyl cellulose (CMC; 0·1%) for 24 h, and centrifuged at 10 000 g for 10 min. The cell-free supernatant obtained was filter sterilized using 0·2 μm filter (Millipore, India), followed by freeze drying to obtain crude cellulase and stored at −20°C until use.

Fermentation of seaweed

The fine Sargassum seaweed powder (1%) was suspended in distilled water supplemented with yeast extract (0·1%) and glucose (0·5%). This seaweed broth was autoclaved and subjected to initial enzymatic hydrolysis by using crude cellulase enzyme (4%), followed by incubation at 60°C for 4 h. To this hydrolysed seaweed broth, native LAB cultures were inoculated at a concentration of 105 CFU ml−1 and incubated at 37°C for 18 days under static condition to carryout fermentation. Autoclaved seaweed broth was used as a test control, and cellulase hydrolysed seaweed broth was used as sample control. From each sample, an aliquot was drawn at regular interval of 3 days and analysed for viable cell count, pH, total titratable acidity, total and reducing sugars.

Viable cell count of LAB in fermented seaweed broth was determined by standard plate method using MRS medium. pH of the fermented seaweed was measured with a pH meter (Model no. μPHCAL5; Analab Scientific Instruments, Pvt Ltd, Gujarat, India). To analyse total yield, total titratable acidity, and total and reducing sugars, supernatant from each sample of fermented seaweed broth was collected by centrifugation at 10 000 g for 15 min at 4°C. Total dry matter content (yield) was determined by measuring the weight of fermented seaweed broth supernatant (1 ml) and control samples after oven drying (100°C for 6–8 h). Total titratable acidity was measured by titrating the known quantity of sample with 0·05 N NaOH using phenolphthalein as indicator and expressed as equivalent to mg ml−1 lactic acid. Total sugars were measured by phenol–sulphuric acid method (Dubois et al. 1956) and reducing sugar by DNS method (Miller 1959). For anticoagulation and antioxidant activity, the supernatant was freeze dried and reconstituted in distilled water to a concentration of 4 mg ml−1.

Anticoagulation assays

Human blood was collected from healthy individual donors with 2·5% sodium citrate (9 : 1). The plasma was separated from blood cells by centrifugation at 1500 g for 20 min at 4°C and stored at −80°C until use. For APTT assay, citrated plasma (50 μl) was mixed with 50 μl of reconstituted sample and incubated at 37°C for 1 min. APTT reagent (50 μl) was added to the mixture and incubated for 1 min at 37°C. Clotting time was determined after addition of 50 μl of 0·05 mmol CaCl2 solution. For PT determination, supernatant of fermented seaweed broth (50 μl) was mixed with 50 μl of citrated human plasma and incubated at 37°C for 2 min. Clotting time was recorded after addition of 50 μl of PT reagent. Similarly, assay was carried out with samples from test control and sample control. Relative clotting factor was determined by dividing the clotting time of fermented sample by the time obtained under similar condition with blank (water). The activity was expressed as international units mg−1 using parallel standard curve prepared with heparin standard. Similar assays were carried out with samples from test and sample control.

Antioxidant activity

Antioxidant activity of reconstituted sample was analysed by seven different assays such as reducing potential, metal chelation, DPPH scavenging, nitric oxide scavenging, hydrogen peroxide scavenging, ABTS scavenging activity and singlet oxygen quenching activity as explained by Sowmya and Sachindra (2012). Similar assays were carried out with samples from test and sample control.

Statistical analysis

The experiments were conducted in triplicates, and the results were subjected to statistical analysis using anova, and mean separation was accomplished by Duncan's multiple range test.

Results

Isolation and characterization of LAB from marine samples

Various samples from marine source were screened for LAB cultures on modified MRS media with bromocresol purple as indicator. A total of 92 yellow-coloured colonies were selected and examined for Gram reaction, cell shape, motility, catalase, sporulation and haemolytic activity. Among 92 isolates, 52 were Gram positive, nonmotile, catalase negative and were tentatively designated as LAB. Of 52 isolates, 48% isolates were cocci, 29% rods (in chains) and 23% coccobacilli in structure. All the isolates were nonsporulating and did not show any haemolysis or inhibition zone as tested on defibrinated blood agar media. These selected cultures (52 isolates) were further analysed for their ability to grow in presence of seaweed extract. Among them, four cultures coded as LC, Nw-1a, 2NW-1a and P1-2CB-w1 were able to grow within 24 h of incubation and were selected for further study.

Identification and characterization of marine LAB isolates

Potential cultures (four isolates) with an ability to grow in presence of seaweed extract were identified by 16S rDNA sequencing. The sequences containing at least 750–800 bp were used for database query. Sequence Blast using Megablast tool of GenBank (http://www.ncbi.nlm.nih.gov/) revealed that the isolates were Lc – Ped. acidilactici; Nw-1a – Weissella paramesenteroides; 2Nw-1a – Ped. pentosaceus; P1-2CB-w1 – Ent. faecium. Representatives of maximum homologous (98–99%) sequences of each isolate were obtained from NCBI GenBank and were used for the construction of phylogenetic tree (Fig. 1).

Figure 1.

Phylogenetic tree of 16S rDNA sequence. The evolutionary history was inferred using the neighbour-joining method. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Phylogenetic analyses were conducted in MEGA4. Representative sequences were obtained from GenBank (accession number in parentheses).

Growth behaviour of marine LAB in different NaCl concentration, pH, temperature and their carbohydrate utilization pattern is presented in Table 1. The isolates were slightly alkaliphilic and are halotolerant. The cultures were able to grow significantly in media containing 2·5 and 6·5% of NaCl whereas on further increase of NaCl concentration (10%) no growth was observed. All the isolates were found to grow at 30° and 40°C but only Nw-1a and 2Nw-1a were able to grow at 45°C. The isolates showed growth at wide range of pH, and it is noteworthy that they are able to grow at acidic pH 4·2 and also in alkaline pH 9·0.

Table 1. Biochemical characterization of marine isolates and standard cultures
TestsNative isolatesStandard culture
LCNw-1a2Nw-1aP1-2CB-w1P.P CB4P.A K7E. F-VRE.D-VRLFLP 1328
  1. The results were scored as ‘+’ positive; ‘−’ negative; ‘d’ delayed or weakly positive.

  2. P.P CB4, Pediococcus pentosaceus NCIM 5420; P.A K7, P. acidilactici NCIM 5424; EF-VR, Enterococcus faecium NCIM 5363; ED-VR, Enterococcus durans NCIM 5427; LF, Lactobacillus fermentum; LP 1328, Lactobacillus plantarum MTCC 1328.

Heat tolerance (°C)
60+++++++++
70
Growth at 45°C++d+++++
Growth at 50°CddD
Growth at different NaCl conc (%)
2·5+++++++++
6·5++++++++
10
Growth at different pH
4·2++++D
7·5++++++++++
9·0+++++++
Vancomycin (30 μg ml−1)++++++
Acid from glucose++++++++++
Gas production (CO2)+
Sugar utilization          
d (+) Raffinose+++++
d-Fructose+++++++++
Sorbitold
d-Galactose+d++++++++
l (+) Rhamnose+dddd+
d (−) Arabinose++++++++++
Glycerol
Sucrose+++++++
Mannitold+++
Lactosed++++++
Starch hydrolysis
Casein hydrolysis+++
Citrate utilization

Acid production with glucose was observed in all the isolates, whereas gas production (CO2) was found only in Nw-1a indicating its heterofermentative nature. Carbohydrate utilization pattern depicted that the current Pediococcus isolates LC and 2Nw-1a were unable to ferment raffinose, whereas the standard Pediococcus cultures NCIM 5420 and NCIM 5424 were able to ferment raffinose. Among the isolates, Nw-1a and 2Nw-1a were able to hydrolyse casein and only P1-2CB-w1 showed starch hydrolysis. None of the isolates were able to utilize citrate.

Fermentation of Sargassum sp using native marine LAB isolates

During initial trials, the LAB isolates with a cell concentration of 5 log CFU ml−1 were found to sustain in seaweed broth (data not shown). As the high content of fucose and sulfate in brown algae hinders cell wall degradation by bacterial species (Michel et al. 1996), the crude cellulase from B. megaterium was used in the present study for initial hydrolysis of Sargassum and subsequently inoculated with LAB isolates to carry out fermentation. The viability of all the LAB isolates was found to increase significantly (P < 0·05) during fermentation up to 12 days. On further incubation, there was a reduction in their cell count. Ent. faecium (P1-2CB-w1) exhibited maximum viability with 9·25 ± 0·10 log CFU ml−1 on 12th day (Fig. 2a) but no significant difference (P > 0·05) was observed in cell count between different samples. In all the samples, pH reduced significantly (P < 0·05) from 6·5 to 3·6–4·0 by 12th day of fermentation (except test and sample control) and was maintained on further incubation (Fig. 2b). With pH reduction, there was a significant (P < 0·05) increase in lactic acid content, with an optimum concentration (mean 1·8 μg ml−1) on the 12th day (Fig. 2c). The sample fermented with P1-2CB-w1 (Ent. faecium) showed maximum lactic acid content (1·85 μg ml−1) as compared with other samples. By the above observation of drop in pH and increase in lactic acid content, it was confirmed that fermentation process has occurred in seaweed broth.

Figure 2.

Viability of culture (a), pH change (b) and total titratable acidity (c) during fermentation of seaweed using different lactic acid bacteria isolates. Values are mean of three independent experiments. (image) LC (P. acidolactici); (image), Nw-1a (W. paramesenteroides); (image), 2NW-1a (P. pentosaceus); (image), P1-2CB-W1 (E. faecium); (image), test control; (image), LC (P. acidolactici); (image), 2NW-1a (P. pentosaceus); (image), sample control; (image), NW-1a (W. paramesenteroides); (image), P1-2CB-W1 (E. faecium).

Utilization of sugars leached out of seaweed broth by LAB isolates was evident from the initial increase of cell number and reduced total sugars content in the fermented samples as compared with control (enzyme-hydrolysed sample). There was almost 11% reduction in total sugars in sample fermented with P1-2CB-w1 (Ent. faecium) on 3rd day of incubation (Fig. 3a). But on further increase in fermentation period up to 12 days, simultaneous increase in total sugar and cell count was observed indicating additional hydrolysis of seaweed polysaccharide and fermentation by LAB. On further incubation, the total sugar content did not increase significantly (P > 0·05) but reduction in cell viability was observed. This may be due to low pH and accumulation of organic acids during fermentation rather than lack of carbohydrate substrate. Reducing sugar content was also found to increase with initial lag phase and reached maximum on 12th day (Fig. 3b). Thus, the study reveals that an incubation period of 12 days was optimum for fermentation of Sargassum sp.

Figure 3.

Total sugar (a) and reducing sugar content (b) during fermentation of seaweed using different lactic acid bacteria isolates. Values are mean of three independent experiments. (image) test control; (image), 2Nw-1 (P. pentosaceus); (image), LC (P. acidolactici); (image), Nw-1a (W. paramesenteroides); (image) sample control; (image), P1-2CB-W1 (E. faecium).

Anticoagulation activity of fermented Sargassum sp

Blood coagulation is a complicated mechanism, hence two different (APTT and PT) assays were carried out to determine the inhibition pathway of coagulation cascade (intrinsic and extrinsic, respectively). In the present study, the samples after optimum fermentation period of 12 days were evaluated for anticoagulant properties. All the samples showed higher activity in APTT assay as compared with PT (Table 2), which indicated that the fermented sample does not act on extrinsic coagulation pathway but rather inhibit intrinsic coagulation cascade. Fermented samples showed significantly higher anticoagulant activity than test control or sample control indicating the enhancement of activity through fermentation over enzyme-hydrolysed samples (sample control). Both APTT and PT correlated (r = 0·91) with total sugar content in the sample but not with reducing sugar or polyphenol content. Sample fermented with Ent. faecium (P1-2CB-w1) had significantly (P < 0·05) higher anticoagulation activity (APTT; 480·42 s per 100 μg).

Table 2. Anticoagulation activity of fermented seaweed
SampleAPTTPT
Clot time (s per 100 μg)RCFIU mg−1Clot time (s per 100 μg)RCFIU mg−1
  1. Blank (water): Activated partial thromboplastin time (APTT): clot time – 101·38 s and prothrombin time (PT): clot time – 11·1 s; Relative clotting factor (RCF) = Clot time of sample (s)/Clot time of blank; international units (IU) with respect to heparin. Values are mean of three independent experiments. Values in columns with same superscripts does not differ significantly (P > 0·05).

Test control253·202·491·36 ± 0·02a14·461·300·056 ± 0·005a
Sample control263·482·591·42 ± 0·01b15·061·370·058 ± 0·004a
LC (Pediococcus acidilactici)282·002·781·52 ± 0·02c18·50·830·071 ± 0·002b
Nw-1a (W. paramesenteroides)344·003·391·85 ± 0·02d18·300·820·070 ± 0·002b
2NW-1a (Ped. pentosaceus)314·003·091·69 ± 0·03e16·030·720·062 ± 0·003a
P1-2CB-w1 (Enterococcus faecium)480·424·742·58 ± 0·02f21·470·970·083 ± 0·003c

Antioxidant activity of fermented Sargassum sp

Antioxidant activity as assayed by seven different assays showed an enhanced activity on fermentation as compared with control (Table 3). The activity correlated with the increase in polyphenols content. The highest polyphenol content (30·09 ± 1·23 μg mg−1 gallic acid equivalent) was observed in sample fermented with Ent. faecium (P1-2CB-w1), which may be the reason for the higher antioxidant activity.

Table 3. Antioxidant activity of fermented seaweed
SamplesAntioxidant activity
PPRPMCDPPHNOH2O2ABTSSO
  1. PP, Polyphenols (Gallic acid equivalent: μg mg−1 dry weight); RP, Reducing potential (Ascorbic acid equivalent: μg mg−1 dry weight); MC, metal chelation ability (EDTA equivalent: μg mg−1 dry weight); DPPH, 2,2-Diphenyl 1-picrylhydrazyl scavenging activity [tertiary butyl hydroxy quinine (TBHQ) equivalent: μg mg−1 dry weight]; NO, Nitric oxide scavenging (TBHQ equivalent: μg mg−1 dry weight); H2O2, Hydrogen peroxide scavenging activity (α-tocopherol equivalent: μg mg−1 dry weight); ABTS scavenging (TBHQ equivalent, μg mg−1 dry weight); SO, Singlet oxygen scavenging (α-tocopherol: μg mg−1 dry weight).

  2. Values are mean of three independent experiments. Values in column with same superscripts does not differ significantly (P > 0·05).

Test control22·05 ± 0·96a8·41 ± 0·29d38·89 ± 1·22a19·30 ± 1·44a654·29 ± 42·57a187·31 ± 13·98a25·64 ± 0·61a103·22 ± 2·33a
Sample control22·91 ± 0·58ab5·57 ± 0·29c44·66 ± 6·52a19·79 ± 0·91a652·70 ± 8·96a256·24 ± 6·17b25·85 ± 0·31ab115·53 ± 1·52b
LC (Pediococcus acidolactici)24·27 ± 1·17b2·43 ± 0·04a54·02 ± 0·20b30·04 ± 1·92b635·28 ± 6·72a304·52 ± 14·40c28·00 ± 1·10b119·67 ± 1·30c
Nw-1a (Weissella paramesenteroides)24·08 ± 0·59ab2·57 ± 0·07a55·60 ± 0·81b27·77 ± 0·26b619·44 ± 6·72a348·73 ± 1·23d28·40 ± 0·42b119·39 ± 0·77c
2NW-1a (Ped. pentosaceus)28·61 ± 0·35c3·72 ± 0·11b66·80 ± 1·27c36·02 ± 2·18c807·96 ± 44·81b407·92 ± 17·48e34·83 ± 1·20c153·08 ± 0·77d
P1-2CB-w1 (Enterococcus faecium)30·09 ± 1·23c5·32 ± 0·26c70·05 ± 1·78c45·64 ± 0·33d768·35 ± 28·01b453·36 ± 8·74f35·10 ± 1·67c152·83 ± 0·27d

DPPH radical scavenging activity increased with an increase in total phenol content (Table 3). DPPH is a lipophilic radical with stable nitrogen molecule that could be reduced by addition of hydrogen or electrons (Blois 1958; Soltani et al. 2011). Maximum scavenging (45·64 ± 0·33 μg mg−1 TBHQ equivalent) was observed in case of seaweed fermented with P1-2CB-w1 (Ent. faecium). Further on fermentation, seaweed was found to increase their metal chelating effect on ferrous ions. Control sample before fermentation exhibited 58·6% chelating ability that increased to 80–84% by LAB fermentation, which was equivalent to 54–70 μg of EDTA. Costa et al. (2011) obtained heterofucan from Sargassum filipendula by proteolytic digestion having 54·8% ferrous chelating ability.

Reducing activity was highest in test control (8·41 ± 0·29 μg mg−1 dry weight of ascorbic equivalent) but reduced on fermentation (Table 3). Nitric oxide scavenging activity was found to increase significantly (P < 0·05) on fermentation using the isolates 2Nw-1a (Ped. pentosaceus) and P1-2CB-w1 (Ent. faecium). H2O2 scavenging activity was found to increase upon fermentation and was more than double of test control in samples fermented with Ent. faecium and Ped. pentosaceus. H2O2 is a weak oxidizing agent and can inactivate enzymes by oxidation of their thiol group. Hence the higher H2O2 scavenging ability of the seaweed on fermentation can prove the potent criteria of seaweed as antioxidant agent. Further, ABTS and singlet oxygen scavenging activity was also found to increase on fermentation. Significant correlation was observed between polyphenols content and antioxidant activity (r = 0·82–0·92) except for reducing power. As polyphenol content increased after fermentation, it implies that fermentation enhances the antioxidant property of fermented product.

Discussion

Marine environment is characterized by presence of salts and alkaline condition, which affect the life of organism inhabiting such location. According to the available literature, isolation and identification of LAB from such marine environment are limited and have been generally confined to those from fermented fish or fish waste (Ringo and Gatesoupe 1998). Hence in the present study, different marine samples including sea sediments, water, and fresh and decomposed seaweed have been used to isolate potential LAB for seaweed fermentation.

Polysaccharides present in seaweed are known to promote the growth of LAB microflora (Kuda et al. 1992), which supported the present investigation for applying LAB in seaweed fermentation. Further considering the fact that LAB from marine origin would have the characteristic ability to grow in presence of seaweed, present work was carried out to isolate and select a suitable LAB to use as starter culture for seaweed fermentation to guarantee maximum production of bioactive molecules.

The potential LAB cultures isolated from marine source were identified as Ped. acidilactici (Lc), Weissella paramesenteroides (Nw-1a), Ped. pentosaceus (2Nw-1a) and Ent. faecium (P1-2CB-w1) through biochemical assays and 16S rDNA sequencing. All the isolates were able to grow under wide range of pH and temperature indicating their capability to survive under drastic environmental conditions. In general, Ped. acidilactici and Ped. pentosaceus of food origin are unable to grow in alkaline condition (Franz et al. 2006). Similar result was observed in the present study with the standard culture Ped. pentosaceus NCIM 5420 and Ped. acidilactici NCIM 5424 (food isolates), whereas the marine isolates LC and 2Nw-1a identified as Ped. acidilactici and Ped. pentosaceus, respectively, were able to grow even at pH 9·0.

Application of these LAB isolates in the fermentation of Sargassum sp. demonstrated an increase in lactic acid content, which correlated with the drop in pH. Simultaneously, an increase in total and reducing sugars was observed along with cell viability up to 12 days. Upon further incubation, although there was no significant (P > 0·05) reduction in sugars, there was a drastic reduction in cell viability. Previous studies have indicated that low pH and accumulation of acids during fermentation can decrease growth rate (Gupta et al. 2011). From the study, it can be concluded that an incubation period of 12 days was optimum period for fermentation of Sargassum sp.

There are large number of reports on the anticoagulation activity of fucans, a sulfated polysaccharide from brown seaweed (Chevolot et al. 1999; Silva et al. 2005). In the present study, an eco-friendly, cost-effective and safe method of fermentation has been applied for enhancing the biological activity of seaweeds. Although fermentation is a common technique applied in food and dairy products, their application in aquatic material is limited and mostly used in fermentation of fish. Uchida and Murata (2002) used cellulase and microbial consortium for fermentation of Undaria pinnatifida to be used as alternative diet for fish. De Zoysa et al. (2008) have isolated a sulfated polysaccharide with anticoagulation activity from Sargassum fulvellum by natural fermentation and suggested that fermentation of seaweed using well-controlled microbial flora will be more ideal than natural fermentation. Therefore, in the present study, initial saccharification of Sargassum sp with cellulase enzyme followed by fermentation with well-characterized LAB isolate was attempted.

All the fermented samples showed enhanced anticoagulation activity as compared with control. In comparison with the extrinsic pathway (PT assay), the fermented sample had a better inhibitory activity towards intrinsic coagulation cascade (APTT assay). The enhanced anticoagulation activity was found to have positive correlation with total sugars content indicating the role of polysaccharides in inhibiting coagulation cascade. Maximum anticoagulation activity (APTT; 480·42 s per 100 μg) was observed in sample fermented with Ent. faecium (P1-2CB-w1). Apparently, break down of complex seaweed polysaccharides to their basic or intermediate molecules with special structures strongly inhibits coagulation cascade (Yang et al. 2002), which may be the reason for highest anticoagulation activity in Ent. faecium (P1-2CB-w1) fermented sample that is correlated with maximum viability of the culture. Similarly, Pushpamali et al. (2008) demonstrated an increased anticoagulation activity with increased fermentation period of red seaweed Lomentaria cantenta, which peaked at 4th week of incubation where maximum galactans content was observed. In case of Sargassum horneri and Sargassum siliquastrum, 170 s per 100 μg of anticoagulant activity (APTT) was observed, which was higher than the ethanol extract of the same (Athukorala et al. 2007). They also observed that carbohydrase extract (APTT 180–300 s) had better activity than protease extract. Ekanayake et al. (2008) observed highest APTT value in fermented red seaweed Pachimeniopsis elliptica on 6th week of natural fermentation and reported lowest activity (43 s) in the fermented brown seaweed S. horneri.

Further antioxidant potential of fermented Sargassum was evaluated by different assay systems. Antioxidant substances are known to scavenge free radicals by donating hydrogen radicals, which in turn helps in protecting body from degenerative diseases. The genus Sargassum, brown seaweed, has been extensively studied for their antioxidant potential (Sowmya et al. 2011). Sachindra et al. (2010) have reported strong radical scavenging and singlet oxygen quenching activity of methanol extract from different seaweed of Indian waters, which correlated with polyphenol content. Previous studies have also demonstrated the antioxidant activity of polyphenols and polysaccharide isolated from seaweed (Jimenez-Escrig et al. 2001; Yuan et al. 2005). Considering this, presently fermentation technique was applied for enhancing the antioxidant property of the seaweeds.

According to the results obtained, all the fermented samples showed higher antioxidant activity as compared with control. The elevated level of activity correlated with the increased phenol content indicating the role of polyphenols in scavenging free radicals. Fermentation may cause disruption of seaweed cell wall resulting in increased polyphenol content in the fermented sample. Polyphenols are known to be effective antioxidant compounds because of their hydroxyl group that aid in scavenging free radicals (Jimenez-Escrig et al. 2001). Increase in total phenolic content can be used to judge the antioxidant property of the sample, and these phenolic compounds are found to be more effective as compared with α-tocopherol and synthetic antioxidants (Vijayabaskar and Shiyamala 2012). Similar to the present observation, Eom et al. (2011) also reported the enhancement of polyphenol content and antioxidant activity of brown algae by fermentation.

In conclusion, the LAB isolated from marine environment was found to be effective in seaweed fermentation. Higher yield and speedy recovery of bioactive molecules from Sargassum were obtained by initial saccharification using cellulase followed by fermenting with LAB under an optimum incubation period of 12 days. The present investigation identifies a potent LAB culture, Ent. faecium (P1-2CB-w1), that can enhance the anticoagulation activity two times higher as compared with control. Further, Sargassum fermented with the same culture was found to exhibit higher antioxidant activity. Hence, the present study provides a basis for the application of a potent, well-characterized LAB in formulation of marine functional foods. The study can be further extended for purification of bioactive molecules and elucidate their mechanism for therapeutic application.

Acknowledgements

The authors wish to thank the Director, CFTRI, for the facilities and CSIR, New Delhi, for grant of Research Associate fellowship to first author. This study is a part of project funded by Department of Science and Technology, New Delhi, under Indo-Japan collaborative programme.

Ancillary