Exogenous ergosterol protects Saccharomyces cerevisiae from d-limonene stress

Authors

  • J. Liu,

    1. Key Laboratory of Industrial Biotechnology, Ministry of Education and School of Biotechnology, Jiangnan University, Wuxi, Jiangsu, China
    Search for more papers by this author
  • Y. Zhu,

    1. Key Laboratory of Industrial Biotechnology, Ministry of Education and School of Biotechnology, Jiangnan University, Wuxi, Jiangsu, China
    Search for more papers by this author
  • G. Du,

    1. Key Laboratory of Industrial Biotechnology, Ministry of Education and School of Biotechnology, Jiangnan University, Wuxi, Jiangsu, China
    2. State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu, China
    Search for more papers by this author
  • J. Zhou,

    Corresponding author
    1. The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, Jiangsu, China
    • Key Laboratory of Industrial Biotechnology, Ministry of Education and School of Biotechnology, Jiangnan University, Wuxi, Jiangsu, China
    Search for more papers by this author
  • J. Chen

    Corresponding author
    1. The Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, Jiangnan University, Wuxi, Jiangsu, China
    • Key Laboratory of Industrial Biotechnology, Ministry of Education and School of Biotechnology, Jiangnan University, Wuxi, Jiangsu, China
    Search for more papers by this author

Correspondence

Jingwen Zhou and Jian Chen, School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi, 214122, China. E-mail: zhoujw1982@jiangnan.edu.cn, jchen@jiangnan.edu.cn

Abstract

Aims

Enhancement of the tolerance of Saccharomyces cerevisiae to monoterpenes has the potential to improve the de novo biosynthesis of these chemicals as well as the efficient utilization of monoterpene-containing citrus waste. The aims of the current work are to demonstrate the mechanisms by which ergosterol, an important component of cell membranes, protects S. cerevisiae from d-limonene stress and to provide some useful information for further metabolic engineering of the yeast.

Methods and Results

Saccharomyces cerevisiae cells were treated with a sublethal dose of d-limonene for 2 h, and then ergosterol was added to investigate the physiological responses of S. cerevisiae. In d-limonene-treated cells, the membrane fluidity, permeability and saturated fatty acid ratio increased, whereas the intracellular ergosterol concentration decreased sharply. Addition of ergosterol restored membrane and intracellular ergosterol to normal levels. Exogenous ergosterol triggered nearly all of the genes that encode the biosynthesis of ergosterol.

Conclusions

In S. cerevisiae, the cell membrane is the target of d-limonene. Intracellular ergosterol availability is correlated with the d-limonene tolerance of the cells.

Significance and Impact of the Study

The results indicate that modification of the ergosterol biosynthesis pathway could be a promising strategy for constructing a robust yeast strain with enhanced tolerance.

Introduction

Limonene is a typical monoterpene and a component of essential oils derived primarily from valuable aromatic plants. In most cases, monoterpenes constitute about 90% of essential oils (Bakkali et al. 2008). Citrus essential oil contains approximately 70% limonene (Papanikolaou et al. 2008). Limonene is widely used in medicines and the food industry due to its broad spectrum of antimicrobial activities, and it is also an important material in the perfume industry (Solórzano-Santos and Miranda-Novales 2011). To date, Saccharomyces cerevisiae has shown a prosperous future for terpene production. However, metabolic engineering of S. cerevisiae for efficient monoterpene production has been restricted by its limited tolerance to these chemicals (Bakkali et al. 2008). During circus waste recycling for ethanol production, the high remaining levels of d-limonene in the citrus waste would seriously inhibit yeast growth during biological treatment (Pourbafrani et al. 2010).

The plasma membrane is the first line of defence against environmental stresses, and it has been found that limonene affects the membrane composition of Yarrowia lipolytica yeast and some bacteria (Di Pasqua et al. 2006; Papanikolaou et al. 2008). In other cases, changes in membrane fluidity and integrity were observed during various stress conditions, by regulating the biosynthesis of fatty acids and sterols (Ding et al. 2009; Ta et al. 2010; Dupont et al. 2011; Turk et al. 2011). In unicellular eukaryotic organisms, ergosterol is the predominant sterol, and it is present in their membranes at concentrations of about 10% to 30% (mol/mol). Two forms of ergosterol are found in yeast and other eukaryotes: free ergosterol and ergosterol esters. Free ergosterol is mainly located in the plasma membrane and is responsible for cell integrity. The ergosterol esters are sequestered in cytosolic lipid particles, where they are involved in maintaining sterol homoeostasis (Shobayashi et al. 2005).

In response to stress conditions, S. cerevisiae employs numerous mechanisms to maintain its physiological activities. Previous reports have suggested that the ability of microorganisms to counteract stress conditions is correlated with their ergosterol content, and it has also been reported that mutant strains with ergosterol biosynthesis deficiency exhibit decreased resistance to oxidative stress (Pungartnik et al. 2011). Ta et al. (2010) found that ergosterol depletion strains were more sensitive to lactone, and the addition of ergosterol restored their normal functions. In some cases, the presence of ergosterol in the medium increased the tolerance of yeast cells to oxidative stress (Mannazzu et al. 2010), showing that S. cerevisiae could utilize ergosterol from the medium. Therefore, it is proposed that ergosterol content is correlated with the ability of S. cerevisiae to exhibit resistance to stress conditions.

In vitro studies have shown that d-limonene induces membrane fatty acid alterations in bacteria (Di Pasqua et al. 2006). Other researchers found that essential oils inhibit the growth of S. cerevisiae, partially by affecting the mitochondrial membranes (Bakkali et al. 2005). However, the effect of d-limonene on yeast cells growing on ergosterol has not been investigated. Knowledge of the effects of an ergosterol-supplemented medium on S. cerevisiae cells should facilitate the construction of a robust strain with enhanced d-limonene tolerance. Thus, the aim of this study was to analyse the physiological responses of S. cerevisiae induced by ergosterol supplementation in the presence of d-limonene and to determine how these modifications affect cell viability, membrane function, intracellular ergosterol concentration and the biosynthesis of ergosterol.

Materials and methods

Strains, media, culture conditions and d-limonene treatment

A S. cerevisiae strain CEN.PK2 (MAT a/α) from EUROSCARF (Frankfurt, Germany) was used throughout this study. A single colony of the strain was inoculated into a 250-ml flask with 25 ml YPD medium (10 g l−1 yeast extract, 20 g l−1 tryptone and 20 g l−1 glucose) and incubated at 200 rev min−1 and 30°C for 24 h. This provided seed cultures for inoculation into 500-ml flasks containing 50 ml fresh YPD medium that were grown to early log phase (OD600 = 1·0) and then treated with a sublethal dose (0·02%, v/v) of d-limonene. Different concentrations (0, 0·1 and 0·2 mmol l−1) of ergosterol (dissolved in surfactant) were added. Tween 80 (0·5%, v/v) was also added to enhance d-limonene solubility (Parveen et al. 2004). Tween 80 was regard as safe for cell growth at a concentration of 0·5% (Wei et al. 2003). A similar conclusion also has been made by our in vitro experiments (data not shown). In the present study, cells supplemented with Tween 80 (0·5%, v/v) in the absence of d-limonene treatment were used as the negative control.

Viability and cell staining

The viability of strains during 2 h of limonene stress was evaluated by a colony-forming assay, as previously described by Ta et al. (2010). In brief, cells were grown to early log phase (OD600 = 1·0) in YPD medium and then treated with 0·02% (v/v) d-limonene for 2 h. The cell pellets were washed and resuspended with sterilized distilled water, and serial dilutions of the suspension were spotted onto YPD agar medium supplemented with 0, 0·1 and 0·2 mmol l−1 ergosterol. The plates were photographed after 48-h incubation at 28°C.

Cell death was also evaluated using methylene blue (as methylene blue dye is reduced to a colourless compound in living cells), according to the method of Greenhalf et al. (1996) with small modifications. Briefly, yeast cells from different treatments were collected, washed and resuspended in methylene blue and incubated at 28°C for 5 min. The stained cells were visualized and counted using a haemocytometer under light microscopy. Plates to which no ergosterol had been added were used as controls.

Plasma membrane permeability assay

The movements of cellular membrane components provide the membrane with a certain fluidity, and this fluidity can be evaluated using different fluorescent probes. The fluorescence anisotropy of these probes is inversely related to the fluidity of their environment, as an increase in the anisotropy reflects a decrease in the fluidity. The permeability of the plasma membrane was evaluated in triplicate using o-nitrophenyl-β-d-galactopyranoside (ONPG). During passage through the plasma membrane, ONPG can be cleaved by β-galactosidase, resulting in the appearance of a yellow colour. Thus, the absorbance at 420 nm indicates the plasma membrane permeability, as previously described (Chow and Palecek 2004).

In brief, d-limonene-treated cells with and without (control) exogenous ergosterol were collected and washed twice with 10 mmol l−1 sodium phosphate buffer (pH 7·4) and suspended in the same buffer to an OD600 of 0·6. Then, ONPG was added to quartz cuvettes containing 2 ml of cell suspension to a final concentration of 100 μg ml−1. After sufficient yellow colour had developed, the reaction was stopped by addition of Na2CO3 to a final concentration of 0·5 mol l−1. Substrate cleavage by β-galactosidase was monitored by light absorption measurements at 420 nm in a spectrophotometer (UV-2450; Shimadzu, Kyoto, Japan).

Ergosterol extraction and quantitative assay

Ergosterol was extracted and quantified as previously described by Fields et al. (2011). In brief, yeast cells were harvested and washed twice with sterilized distilled water, and the dry cell weight (DCW) was determined. Three millilitres of alcoholic KOH (25 g KOH plus 35 ml ddH2O, with 100% ethanol added to a total volume of 100 ml) was added to the yeast pellets and mixed by vortexing for 1 min. Cell suspensions were then transferred to borosilicate glass screw-cap tubes and incubated at 85°C in a water bath for 1 h, and then the tubes were allowed to cool to ambient temperature. Sterols were extracted with n-heptane (Sigma-Aldrich, St Louis, MO, USA), followed by vigorous vortexing for 3 min. The n-heptane layer was isolated and stored at −20°C for 24 h prior to high-performance liquid chromatographic (HPLC) analysis. HPLC was conducted (on an Agilent 1100 series, Santa Clara, CA, USA) using a UV detector set at 282 nm with a Zorbax SB-C18 column (250 × 4·6 mm). Methanol/water (95 : 5, v/v) was used as the mobile phase, and the elution rate was 1·5 ml min−1. Ergosterol (Sigma-Aldrich) was used to obtain a calibration curve. Each experiment was repeated three times. Statistical significance (< 0·05) was determined by Student's t-tests.

Evaluation of membrane fluidity

The membrane fluidity was evaluated by measuring the fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene (DPH), as DPH can become anchored in the lipid region of the membrane surface in contact with water and is normally used to monitor changes in membrane dynamics. The method used was as previously described (Sharma 2006), with some modifications. In brief, harvested cells were suspended in 0·1 mol l−1 potassium phosphate buffer (pH 6·8) at OD600 = 0·6. Then, 2 μl of 1 mmol l−1 DPH was added, and the mixture was incubated at 27°C for 10 min in a thermostatted chamber and protected from light. After incubation, the cells were washed three times with the same buffer. Fluorescence anisotropy was measured using a spectrofluorimeter (model 650-60; Hitachi, Tokyo, Japan), with 360 and 450 nm as the excitation and emission wavelengths, respectively. Fluorescence anisotropy (ϒ) was calculated as follows:

display math

where IVV and IVH indicate the values of the fluorescence intensities determined at vertical and horizontal orientations of the emissions polarizer, when the excitation polarizer is set in the vertical position. A similar equation applies to IHV and IHH with the excitation polarizer set in a horizontal position. G is a correction factor for background fluorescence and light scattering. Decreases in the degree of fluorescence anisotropy reflect increases in the fluidity of the lipid bilayer, which controls or alters the mobility of DPH in the membrane.

Evaluation of the phospholipid fatty acid composition of the plasma membrane

Lipids were extracted from whole-cell homogenates by the method of Mannazzu (Mannazzu et al. 2008). Briefly, fatty acid methyl esters (FAMEs) were prepared by acid-catalyzed esterification (2% H2SO4 in anhydrous methanol) at 70°C for 2 h. Components of 1 μl of the FAMEs solution were separated on a 30-m fused-silica capillary polar column [BPX70 (70% biscyanopropyl polysiloxane), inner diameter 0·22 mm, film thickness 0·25 μm; SGE, Austin, TX, USA] using a Shimadzu GC-17A chromatograph coupled with a QP-5000 mass spectrometer (Shimadzu). FAMEs were identified by comparing the corresponding mass spectra with a spectrum database. The relative amounts of FAMEs were calculated from the peak areas. The degree of unsaturation (mol% unsaturated fatty acid (UFA)/mol% saturated fatty acid (SFA); UFA : SFA ratio) and the mean chain length were determined.

RNA extraction

Cells were harvested at 2000 g for 5 min and then washed twice with double distilled water and stored at −80°C until RNA preparation. Total RNA from the untreated control and d-limonene-treated cells with and without exogenous ergosterol was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions. The RNA was quantified and checked in a Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) at 260 and 280 nm. The integrity of the isolated RNA was verified using an automated electrophoresis system (Bio-Rad, Hercules, CA, USA).

Quantitative real-time PCR assay

cDNA was synthesized from 5 μg of total RNA using PrimeScript® RT Reagent Kit Perfect Real Time (Takara, Dalian, China). PCR was performed with the resulting cDNA as a template. All primer sequences are given in Table 1. The efficiencies and specificities of the primers were determined from dilution experiments and melting curves, respectively. Quantitative real-time PCR (QPCR) experiments were performed using SYBR® Premix Ex TaqTM kit (Taraka, Dalian, China), and the parameters for PCR were the following: pre-incubation at 95°C for 30 s; 40 cycles of amplification at 95°C for 5 s, 60°C for 20 s; and, finally, cooling at 50°C for 30 s. Reactions were conducted using a LightCycler 480 II Real-time PCR instrument (Roche Applied Science, Mannheim, Germany) and were run in triplicate; mean values were used for further calculations. The fold change was determined by the 2−ΔΔCT method normalized to the ACT1 gene (actin).

Table 1. Primer pairs used for quantitative real-time PCR
GenePrimer sequences (5′–3′)Amplicon sizePCR efficiency
ERG13 FACTACAATGGCGTCTCTACC1651·927
RCAAGTCCAAGTCTGTCAAGTC  
HMG2 FGGTTGGGAAGATATGGAAGTTG1312·014
RACGACATCACCAGGAATAGTAG  
HMG1 FGCCCAGTAGTCCGTTTCCC1931·915
RATTGCGTCACCAGTAGTTGTTC  
ERG8 FAGTGGCTTCATTCCTGTTTCG1771·958
RTTCGGTAACGCTATCCTCCTG  
MVD1 FACACAGCATCCGTTACCG1121·944
RTGCGATAAAGTCACTGATATGG  
IDI1 FACTGCCGACAACAATAGTATGC1671·918
RGTTTCTCCGCTTTCGTCATTTG  
ERG20 FCATTGAACTACAACACTCCAG1701·951
RGGCGACCAAGAAGTAAGC  
BTS1 FGGCTTGGATATATACTGGAGAGAC1461·919
RCCGTGGTGTGAGGAAGGAG  
ERG10 FTCCGCTATGAAGGCAATC1631·918
RCGACACCATCAACAAGAAC  
ERG12 FTCTGCGTTGAGAACCTACC1851·918
RTCCTGAGACAAGCCATCG  
ACS1 FCGCAGCAGAAGAAGGAAC1121·929
RTGTGGAGAATAGTGGGTAGC  
ACS2 FCTGATGACGAATCCGACAAC1641·920
RAGCCACAGCCAACATAGC  
ALD6 FGAGATGCTGCTGCCTATG1021·928
RGACCACAGACACCGATTG  
ACT1 FACCGCTGCTCAATCTTCTTC1641·919
RATGATGGAGTTGTAAGTAGTTTGG  
ERG4 FGGTGACAAGACAGGTAGGAAGAC1841·939
RTGAACCCGCAAGACAAGGC  
ERG6 FAAGACCTGGCGGACAATGATG1991·970
RAGAGCAGCAGTAACTTCCTTGG  

Results

Exogenous ergosterol enhanced the resistance of yeast cells to d-limonene

To address whether ergosterol supplementation could relieve d-limonene stress in S. cerevisiae, yeast cells at the early log phase were harvested and then treated with 0·02% (v/v) d-limonene. To determine their viability, serial dilutions of d-limonene treated cells were spotted on YPD plates containing 0, 0·1 and 0·2 mmol l−1 of ergosterol (Fig. 1a). Plates that contained no ergosterol were used as controls. After 2 h of d-limonene treatment, cell survival decreased sharply in the control plates. As expected, the number of colonies on plates containing ergosterol was higher than on plates without ergosterol. There were also more colonies in plates containing 0·2 mmol l−1 ergosterol than in plates containing 0·1 mmol l−1 ergosterol.

Figure 1.

(a) Effect of exogenous ergosterol on the viability of d-limonene treated cells. (b) Viability of d-limonene-treated cells shown by methylene blue staining. EGS represents d-limonene-treated cells supplemented with ergosterol. Error bars represent standard deviations (n = 3). Statistically significant difference (< 0·05) was determined by Student's t-test, and it is indicated by an asterisk.

The viability of d-limonene-treated cells was also evaluated by the methylene blue staining method, as methylene blue dye can only stain inactive strains. After 2 h of treatment with a sublethal dose of d-limonene, 52 ± 4% of cells were stained and could thus be considered to have lost their reducing activity. When supplemented with 0·2 mmol l−1 of ergosterol, only 36 ± 5% of the cells were stained (Fig. 1b). These results were consistent with the colony-forming results on agar plates, showing that exogenous ergosterol enhanced S. cerevisiae tolerance to d-limonene.

Exogenous ergosterol induced physiological alterations in the cell membrane

To further investigate the mechanisms involved in d-limonene tolerance in S. cerevisiae, the physiological status of the cell membrane was studied, as it is the first line of defence against unfavourable conditions. The changes in membrane fluidity in the presence of d-limonene are shown in Fig. 2, as determined by measuring fluorescence anisotropy using DPH. The fluorescence anisotropy of d-limonene treated cells was relatively lower than that of cells supplemented with ergosterol, indicating a reduced fluidity was induced by exogenous ergosterol. Exogenous ergosterol restored membrane fluidity to prevent d-limonene stress. The results obtained indicate an important role for ergosterol in restoring the natural fluidity of the S. cerevisiae membrane during d-limonene stress.

Figure 2.

Evaluation of membrane fluidity via fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene-stained strains. White, light grey and dark grey bars represent control, d-limonene-treated cells and d-limonene-treated cells supplemented with ergosterol, respectively. Error bars represent standard deviations (n = 3). Statistically significant difference (< 0·05) was determined by Student's t-test, and it is indicated by an asterisk. EGS represents d-limonene-treated cells supplemented with ergosterol.

Cell permeability was evaluated by measuring the absorbance at 420 nm using ONPG. As shown in Fig. 3, the membrane permeability of the untreated control was relatively low prior to being exposed to d-limonene. However, when ergosterol was added to the d-limonene-treated cells, the cells at least partially recovered their natural permeability. These results indicate that exogenous ergosterol help to maintain membrane permeability during d-limonene stress.

Figure 3.

Evaluation of the inner membrane permeability of d-limonene treated cells with and without exogenous ergosterol. Squares, circles and triangles represent untreated control, d-limonene-treated cells and d-limonene-treated cells with ergosterol supplementation, respectively. Error bars represent standard deviations (n = 3). Statistically significant differences (< 0·05) were determined by Student's t-test.

Exogenous ergosterol induced alterations in membrane fatty acid composition

The major fatty acids in S. cerevisiae are palmitic acid (C16:0), palmitoleic acid (C16:1), stearic acid (C18:0) and oleic acid (C18:1). To investigate the changes in fatty acid composition in the presence of d-limonene, samples with and without exogenous ergosterol were investigated. As shown in Fig. 4, the quantity of UFA in d-limonene treated cells decreased significantly compared to the untreated control (from 87·9% to 34·2%). In addition, the presence of exogenous ergosterol was found to be consistent with an increase in UFAs, with the quantities of UFAs (C16:1 and C18:1) increasing from 34·2% to 65·1%. Besides, palmitoleic acid (C16:1) exhibited a higher increased proportion than that of oleic acid (C18:1), and similar phenomenon reappeared in S. cerevisiae under heat shock (Kim et al. 2006).

Figure 4.

Alterations in fatty acids proportions in the membrane of Saccharomyces cerevisiae. Saccharomyces cerevisiae grown at the early log phase were divided into three treatments, and the membrane fatty acids profiles were investigated. White, light grey and dark grey bars represent untreated control, d-limonene-treated cells and d-limonene-treated cells with ergosterol supplementation, respectively. Error bars represent standard deviations (n = 3). Statistically significant differences (< 0·05) were determined by Student's t-test, and they are indicated by an asterisk. EGS represents d-limonene-treated cells supplemented with ergosterol.

Exogenous ergosterol induced alterations in intracellular ergosterol concentration

The variations in the fluidity, permeability and fatty acid concentrations of the S. cerevisiae membrane suggested that exogenous ergosterol may contribute to membrane stabilization. To further investigate the relationship between the intracellular ergosterol content and stress tolerance, the quantity of ergosterol in d-limonene-treated S. cerevisiae cells with and without exogenous ergosterol was measured HPLC; the ergosterol content of untreated cells was used as the control (Fig. 5).

Figure 5.

Ergosterol concentration measured by high-performance liquid chromatography. White, light grey and dark grey bars represent untreated control, d-limonene-treated cells and d-limonene-treated cells supplemented with ergosterol, respectively. Error bars represent standard deviations (n = 3). Statistically significant difference (< 0·05) was determined by Student's t-test, and it is indicated by an asterisk.

Quantitative analyses showed that yeast cells treated with d-limonene decreased their intracellular ergosterol (66·92% vs the control). However, it is worth noting that ergosterol supplementation induced a higher intracellular ergosterol content (83·08% vs the control), compared to d-limonene-treated cells without exogenous ergosterol, which shows that exogenous ergosterol increased the ergosterol concentration in S. cerevisiae cells treated with d-limonene.

Exogenous ergosterol induced gene alterations at transcription level

Ergosterol is biosynthesized through the mevalonate pathway in S. cerevisiae, which is encoded by a series of genes. To address the tolerance of S. cerevisiae to d-limonene at the molecular level, the transcription levels of 14 genes that are involved in the biosynthesis of ergosterol were investigated in this study (Fig. 6). In the presence of d-limonene, nearly all genes were induced, especially the ALD6 (4·70 ± 0·06) and HMG2 (9·32 ± 0·15) genes. In general, the gene changes were around two-fold.

Figure 6.

Evaluation of gene changes at the transcription level using quantitative real-time PCR. The untreated yeast cells were chosen as the control. Open squares represent d-limonene-treated cells without ergosterol supplementation; solid squares represent d-limonene-treated cells supplemented with ergosterol. Experiments were performed in triplicate.

Interestingly, when the d-limonene-treated cells were supplemented with ergosterol, nearly all genes showed increased expression levels with the exception of HMG2 (0·82 ± 0·02), and some genes were upregulated by more than eight-fold. For example, the expressions of HMG1, ERG12, ERG6 and ERG10 were upregulated 10·66-, 8·75-, 9·19- and 9·21-fold, respectively. In addition, ergosterol supplementation triggered an upregulation of genes encoding the biosynthesis of ergosterol compared to the untreated control in the presence of d-limonene.

Discussion

As an antibacterial compound, limonene has been suggested to affect cell activity and, especially, the cell membrane structures of some prokaryotes (Di Pasqua et al. 2006). Ergosterol is the main sterol in S. cerevisiae, and it plays a key role in maintaining membrane permeability and fluidity, similarly to the way cholesterol does in mammalian cells (Veen et al. 2003). Previous studies mainly focused on the antifungal properties of d-limonene (Delaquis et al. 2002). However, the relationship between ergosterol and d-limonene tolerance in S. cerevisiae has been overlooked.

To address whether exogenous ergosterol can serve as a means of mitigating d-limonene stress, ergosterol was added to d-limonene-treated S. cerevisiae cells. In vitro studies indicated that exogenous ergosterol reduced d-limonene stress in S. cerevisiae (Fig. 1a). In addition, the methylene blue staining results proved that d-limonene-treated cells with ergosterol supplementation exhibit a higher viability (Fig. 1b). These results demonstrate that yeast strains can use extracellular ergosterol to diminish d-limonene stress. Moreover, they also suggest that intracellular ergosterol is associated with d-limonene resistance.

Ergosterol content is reported to be essential to the survival of yeast strains because it is correlated with the integrity and fluidity of the plasma membrane under unfavourable conditions (Sakamoto and Murata 2002). It has also been reported that yeast cells containing a higher ergosterol content demonstrate higher ethanol resistance (Inoue et al. 2000) and that ergosterol can protect yeast cells from dehydration (Dupont et al. 2011). Low ergosterol content has been shown to be correlated with poor yeast tolerance under extreme conditions (Pungartnik et al. 2011). The supplementation of fatty acids and ergosterol to the medium was found to significantly enhance yeast tolerance to cold and oxidative stress, respectively (Redon et al. 2009; Mannazzu et al. 2010). However, no research concerning the protective role of ergosterol in S. cerevisiae in the presence of d-limonene has been reported. The ergosterol content in d-limonene-treated cells decreased sharply, whereas in the same cells exposed to exogenous ergosterol, the intracellular ergosterol content was partially recovered (Fig. 5). These results demonstrate that exogenous ergosterol increased the intracellular ergosterol content of S. cerevisiae in the presence of d-limonene.

Consistent with the increased resistance to d-limonene upon ergosterol supplementation, genes encoding the biosynthesis of ergosterol in S. cerevisiae were investigated through QPCR (Fig. 6). The results showed that nearly all mevalonate pathway genes were upregulated during d-limonene stress, which is similar to a previous report on essential oil (Khan et al. 2010) and α-terpinene, another typical monoterpene (Parveen et al. 2004). A similar mechanism has been shown to operate in mammalian cells, in which d-limonene is found to inhibit the biosynthesis of cholesterol, which has a similar function to ergosterol in microbes, through inhibition of 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGR). HMGR is the key rate-limiting enzyme in sterol biosynthesis and is also subject to feedback regulation in yeasts, plants and animals (Hampton and Rine 1994). Yeasts have two isozymes of HMGR, termed Hmg1p and Hmg2p, that are encoded by HMG1 and HMG2, respectively.

Thus, it could be concluded that ergosterol supplementation increases the availability of ergosterol to counteract d-limonene stress. However, the relationship between induced ergosterol biosynthetic pathway and exogenous ergosterol under stress conditions has been seldom reported, and the mechanism remains largely unclear. Ergosterol supplementation was found to be helpful for the recovery of cell membranes under stress conditions (Redon et al. 2009; Mannazzu et al. 2010). It could be presumed that a repaired cell membrane suggested a moderate condition for the acceleration of ergosterol biosynthetic through the upregulation of genes in the ergosterol biosynthesis pathway. A recent study demonstrated that ergosterol supplementation is associated with membrane structure alterations (Turk et al. 2011). Thus, it could be postulated that exogenous ergosterol protects yeast cells against d-limonene stress by enhancing the supply of membrane precursor, which results in the accelerated repairing of plasma membrane function.

Membrane fluidity is a complex reflection of fatty acyl chain conformations, trans-bilayer diffusion, rotational diffusion, lateral diffusion and the resistance of the membrane to sheer forces (Denich et al. 2003). The d-limonene-treated cells exhibited greater membrane fluidity compared to the untreated control (Fig. 2). With the addition of ergosterol to the medium, the membrane fluidity approached the normal level. It has been observed that tea tree essential oils, whose major constituent is monoterpene, can cause membrane property alterations in S. cerevisiae and result in changes in membrane fluidity (Hammer et al. 2004). Previous studies indicated that membrane fluidity is correlated with stress tolerance (Swan and Watson 1997; Simonin et al. 2008; Turk et al. 2011).

Cell permeability is critical in maintaining cell physiological functions, especially under conditions of stress. The variations in permeability indicated that exogenous ergosterol exhibited a positive effect on cell permeability in the d-limonene-treated cells, suggesting that cell membranes with exogenous ergosterol were more impermeable (Fig. 3). Similarly, others have reported that ergosterol supplementation enhanced resistance to osmotic stress in S. cerevisiae by promoting repair of membrane function (Dupont et al. 2011).

The regulation of membrane fatty acid biosynthesis profiles is another approach available to the cell under stress conditions. Indeed, it has been reported that yeast cells regulate their membrane composition under stress conditions (Swan and Watson 1997; Blagovic et al. 2005; Rupcic and Juresic 2010; Ta et al. 2010). In the presence of d-limonene, more long-chain SFAs were synthesized (Fig. 4), suggesting that S. cerevisiae decreases the UFA/SFA ratio of the membrane as a stress response. However, in d-limonene-treated cells with ergosterol supplementation, increased levels of long-chain UFAs were found, indicating an increased degree of unsaturation of cell membrane fatty acids was a positive response promoting the survival of the yeast strain.

Overall, increased UFA content and decreased membrane permeability and fluidity were detected in S. cerevisiae during d-limonene stress in the presence of exogenous ergosterol. These data prompt a debate on the relationship between membrane permeability, fluidity and fatty acid composition. In general, microorganisms alter the unsaturation of lipid fatty acids (mainly C14-C18) and decrease chain length as a response mechanism under stress conditions (Bakkali et al. 2008).

In the presence of d-limonene, the increased quantities of palmitic acid (C16:0) and stearic acid (C18:0) improved the saturation of the membrane fatty acids. However, saturated long-chain fatty acids, such as palmitic and stearic acids, are considered to be detrimental to the cells, whereas shorter chain fatty acids and UFAs are relatively harmless (Deguil et al. 2011). In d-limonene-treated cells with ergosterol supplementation, a decrease in the proportions of palmitic and stearic acids was found. Thus, supplementation of the medium with ergosterol might mediate the nature of the polar phospholipids through efficient biosynthesis of membrane components and antagonize d-limonene-induced stress.

In summary, this work demonstrated that ergosterol supplementation enhanced S. cerevisiae resistance to d-limonene stress by restoring the proper physiological function of the cell membrane. Exogenous ergosterol was also found to induce the expression of genes encoding the biosynthesis of ergosterol and resulted in the increase in the intracellular ergosterol concentration. These results will augment our knowledge of the response and tolerance mechanisms underpinning S. cerevisiae resistance to d-limonene and be helpful in constructing a robust yeast strain with enhanced tolerance that could be applied in monoterpene-containing waste recycling or de novo biosynthesis of monoterpenes.

Acknowledgements

This work was supported by the Major State Basic Research Development Program of China (973 Program, 2012CB720806), the National Natural Science Foundation of China (31000807), the Natural Science Foundation of Jiangsu Province (BK2010150, BK2011004), the Open Project Program of the Key Laboratory of Industrial Biotechnology, Ministry of Education, China (KLIB-KF200907) and the Priority Academic Program Development of Jiangsu Higher Education Institutions and the 111 Project (111-2-06).

Ancillary