Serotypes and virulence profiles of atypical enteropathogenic Escherichia coli (EPEC) isolated from bovine farms and abattoirs

Authors


Correspondence

Declan Bolton, Department of Food Safety, Ashtown Food Research Centre, Teagasc, Ashtown, Dublin 15, Ireland. E-mail: declan.bolton@teagasc.ie

Abstract

Aims

The objective of this study was to examine the prevalence of enteropathogenic Escherichia coli (EPEC) on beef and dairy farms and in beef abattoirs and to characterize the isolates in terms of serogroup and virulence markers.

Methods and Results

Bovine faecal samples (n = 1200), farm soil samples (n = 600), hide samples (n = 450) and carcass samples (n = 450) were collected from 20 farms and three abattoirs throughout Ireland over a 12-month period. After selective enrichment, samples testing positive for the intimin gene (eae) using PCR screening were cultured, and colonies were examined for the presence of the eae, vt1 and vt2 genes. Colonies that were positive for the intimin gene and negative for the verotoxin genes were further screened using PCR for a range of virulence factors including tir, espA, espB katP, espP, etpD, saa, sab, toxB, iha, lpfAO157/OI-141, lpfAO113 and lpfAO157/OI-154. PCR screening was also used to screen for variations in the intimin gene (eae). Of the 2700 source samples analysed, 3·9% (47 of 1200) of faecal, 2% (12 of 600) of soil, 6·4% (29 of 450) of hide and 0·7% (3 of 450) of carcass samples were PCR positive (for the presence of the eae gene). All 140 isolates obtained were atypical EPEC (aEPEC), while θ and β intimin types were common. The virulence factors hlyA, tir, lpfA O113, lpfA O157/OI-154, and iha were frequently detected, while lpfAO157/OI-141, saa, espA, espB and toxB were also present but to a lesser extent.

Conclusions

It was concluded that cattle are a source of aEPEC, many of which have the virulence machinery necessary to be pathogenic to humans.

Significance and Impact of the Study

These findings suggest the need for increased research on aEPEC with particular emphasis on food safety and public health risk.

Introduction

Escherichia coli (E. coli) are the most abundant facultative bacteria of the human intestinal tract (Nataro 2006). Most are commensals; however, a group known as enteropathogenic E. coli (EPEC) is considered to be important pathogens, particularly due to their association with paediatric infection worldwide. The symptoms of such infections include persistent diarrhoea, which is linked to high rates of morbidity and mortality in developing countries as well as serious if sporadic outbreaks in developed countries (Nataro and Kaper 1998). EPEC infections have been reported to be the second most frequent cause of death among children under five and are responsible for nearly one in five child deaths worldwide (1·5 million deaths each year; UNICEF/WHO. 2009). EPEC is also reported as being responsible for diarrhoeal disease in young calves and is often a causative factor where a problem of reoccurring diarrhoea is evident on a farm (China et al. 1998; Oswald et al. 2000).

EPEC are defined as E. coli isolates positive for the intimin gene (eae) but lacking verotoxin genes (vt1 and/or vt2). It is hypothesized that enterohaemorrhagic E. coli (EHEC), a pathogenic subtype of E. coli, emerged from EPEC through the acquisition of genes coding for verotoxins by transduction (Reid et al. 2000; Wick et al. 2005; Bardiau et al. 2009). Despite the fact that EPEC do not possess toxin genes, they are capable of causing illness. One of the central mechanisms involved in EPEC pathogenesis is the formation of attaching and effacing (A/E) lesions, which facilitate the intimate attachment of the bacteria to the enterocyte membrane and the effacement of the microvilli of the enterocyte (Jerse et al. 1990; Blanco et al. 2006a). The genetic determinants for the production of A/E lesions are located on a large chromosomal pathogenicity island known as the locus of enterocyte effacement (LEE). The LEE region includes genes that encode a group of proteins involved in the formation of a type III secretion system (TTSS) and secreted proteins (Esp genes). The central portion of the LEE encodes the proteins intimin and the intimin receptor Tir (Blanco et al. 2006b). Intimin itself is a 94-KDa outer membrane protein encoded by the gene eae (Jerse et al. 1990). The eae gene is used as one of the markers for the identification of EPEC.

EPEC are divided into typical and atypical groups based on the presence/absence of virulence genes. Typical EPEC strains possess a virulence plasmid known as the EPEC adherence factor plasmid (pEAF), which includes a gene encoding the bundle-forming pili (bfp), required for localized adherence on cultured epithelial cells. Typical EPEC have only been isolated from humans and are considered to be a leading cause of infantile diarrhoea in developing countries (Carneiro et al. 2006). EPEC, which lack the pEAF plasmid and therefore do not express bundle-forming pili, are classified as atypical EPEC (aEPEC). This group are increasingly being recognized as important emerging pathogens (Trabulsi et al. 2002; Carneiro et al. 2006). aEPEC have been isolated from both humans and animals and are considered to be an important causative factor for the onset of diarrhoeal disease in industrialized countries.

Serogroups that have been defined as ‘classical’ aEPEC by the World Health Organization (WHO) (WHO 1987) include O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142 and O158 and have been characterized in several studies (Scotland et al. 1996; Dulguer et al. 2003; Campos et al. 2004). ‘Nonclassical’ aEPEC are not as well known and much less researched (Dulguer et al. 2003; Blanco et al. 2006a; Abe et al. 2009). It is generally accepted that aEPEC strains are a significant cause of human infections in developed countries and more frequently isolated from patients with diarrhoea than typical EPEC (Blanco et al. 2006a).

A combination of virulence factors plays a role in the complex system, which determines the pathogenicity of EPEC. These virulence factors may be located either chromosomally or on plasmids. A number of genes have been identified as being of particular importance for the pathogenicity of EPEC and include the chromosomally located long polar fimbriae (lpfA) genes (thought to have a role in attachment), the plasmid (pO157)-associated enterohaemolysin gene (hlyA) (releases haemogloblin from red blood cells providing a source of iron for the bacterial cells), the extra-cellular serine protease gene (espP) (facilitates the passage of proteins through the outer membrane), the catalase peroxidize gene (katP) (defends the cells against peroxide-mediated oxidative damage), the TTSS-associated etpD gene and the adherence-associated toxB gene (a potential adhesin thought to be required for full adherence). Other adherence factors associated with EPEC include the iha gene, which encodes the IrgA homologue adhesin (Iha).

Although controversial, a four-stage model has been proposed for the pathogenesis of EPEC infection (Clarke et al. 2003). During the first stage, the EPEC cells express the bfp, intimin and the EspA filaments, which mediate adherence to epithelial cells in stage 2. Tir and effector molecules are then injected into the host cell using a TTSS. The former locks onto intimin resulting in intimate attachment (stage 3), while the latter activates cell signalling pathways causing host cell cytoskeleton alterations. Stage four is characterized by the formation of the characteristic EPEC pedestal structure. The effector molecules continue to disrupt host cell processes ultimately resulting in electrolyte loss and cell death.

While there has been considerable research on pathogenic E. coli, most studies have focused on VTEC O157:H7 while aEPEC have been largely overlooked. What data are available pertains to human infections. To date, attribution has not been possible as the equivalent food studies and potential routes of infection have not been established. This study explored beef and dairy farms as sources of EPEC and as such provides much needed information on prevalence and pathogenicity factors, important for assessing virulence and potential impact on public health.

Materials and methods

Sample collection

Twenty bovine (beef and dairy) farms and three bovine abattoirs were randomly selected for inclusion in this study. Each farm and abattoir were sampled on six occasions over the course of a 1-year period at various locations around Ireland. Samples taken from the abattoir (hide and carcass) were not linked to samples (faecal and soil) taken during the farm visits. At each bimonthly farm visit, 10 fresh faecal (from the ground) and five soil samples (taken from areas where the animals congregated such as beside a water trough) were aseptically transferred into 150-ml polystyrene sterile containers (Dublin 15; Sterilin Ltd, Mulhuddard, Dublin, Ireland). A total of 1200 faeces and 600 soil samples were taken throughout the study. Samples were stored at 4°C for no more than 24 h prior to analysis.

In the abattoirs, 450 hide and 450 carcass samples were tested. All abattoir sampling was performed using a sterile polyurethane sponge (Sydney Heath & Son Ltd, Staffordshire, UK) and the inverted bag technique. Briefly, a sterile polyurethane sponge (100 mm × 100 mm × 10 mm) was premoistened in 10 ml of maximum recovery diluent (MRD; Oxoid, Basingstoke, UK). On each sampling trip, hide and carcass swab samples were taken by grasping the sponge through the bag and exposing it. Once the sample was taken, the sponge was withdrawn back into the bag and secured with an elastic band. Twenty-five individual hide swabs were taken at the rump area (100 cm2) immediately before the hide was removed. The carcasses were tested using the whole carcass swab technique (Lasta et al. 1992), immediately before the carcass entered the chilling area. All swab samples were stored at 4°C for no more than 24 h prior to analysis.

Detection of intimin-positive Escherichia coli

The E. coli control strains used in this study included EC132, serotype O111:H- (target genes: vt1, vt2, eaeA and hlyA), kindly provided by Professor Helge Karch (University of Munster, Germany); 98NK2, serotype O113:H21 (target genes: lpfO113, saa, sab), kindly provided by Dr Adrienne Patton (University of Adelaide, Australia); 38094, serotype O157:H7 (target genes: katP, etpD, Tir, espP, espA, espB, lpfO157/OI154, toxB and iha) from the CDC (Altanta, USA) and C9490, serotype O157:H7 (target gene: lpf) (Wells et al. 1983). Each sample (10 g or swab) (faecal, soil, hide swab and carcass swab) was homogenized with 90 ml of tryptone soya broth (TSB; Oxoid) containing 4 μg ml−1 vancomycin hydrochloride (Sigma-Aldrich, St Louis) and incubated overnight at 37°C. One-millilitre aliquots of the homogenized enrichment was harvested by centrifugation (7426 g for 10 min at 4°C). Genomic DNA was extracted from the resultant pellets (resuspended in MRD) using the DNeasy Tissue Kit (Qiagen, Crawley, UK), according to the manufacturer's instructions. The remainder of the enrichment samples were stored at 4°C. The sample DNA (2 μl) was screened for the presence of the eae gene using the polymerase chain reaction (PCR) in a Peltier Thermal Cycler (MJ Research Inc., Watertown, MA, USA) with primer sets and reaction conditions described by Paton and Paton (1998) (Table 1). The reaction mixture (designated mixture A) was modified using 1× Green GoTaq® reaction buffer (Promega, Madison, WI, USA) and made up to a final volume of 25 μl. PCR products (10 μl) were separated by electrophoresis on a 1·5% (wt/vol) agarose gel and visualized under UV light (GelDoc 2000 system; Bio-Rad Laboratories, Hercules, CA, USA) by ethidium bromide staining (10 mg ml−1). Products' size was determined using the BenchTop 100-bp DNA ladder (Promega).

Table 1. Target genes and primer sequence for the detection of EPEC virulence gene markers and intimin variants
PrimerSequence (5′–3′)Target (gene)References
  1. EPEC, enteropathogenic Escherichia coli.

vt1-FATAAATCGCCATTCGTTGACTAC stxA 1 Paton and Paton (1998)
vt1-RAGAACGCCCACTGAGATCATC
vt2-FGGCACTGTCTGAAACTGCTCC stxA 2 Paton and Paton (1998)
vt2-RTCGCCAGTTATCTGACATTCTG
eaeA-FGACCCGGCACAAGCATAAGCeaeAPaton and Paton (1998)
eaeA-RCCACCTGCAGCAACAAGAGG
hlyA-FGCATCATCAAGCGTACGTTCC hlyA Paton and Paton (1998)
hlyA-RAATGAGCCAAGCTGGTTAAGCT
TIR-FCATTACCTTCACAAACCGAC tir Kobayashi et al. (2001)
TIR-RCCCCGTTAATCCTCCCAT
EspAaCACGTCTTGAGGAAGTTTGG espA McNally et al. (2001)
EspAbCCGTTGTTAATGTGAGTGCG
EspBaCGATGGTTAATTCCGCTTCG espB McNally et al. (2001)
EspBbCGATGGTTAATTCCGCTTCG
ESPPaAAACAGCAGGCACTTGAACG espP McNally et al. (2001)
ESPPbAGACAGTTCCAGCGACAACC
D1CGTCAGGAGGATGTTCAG etpD Schmidt et al. (1997)
D13RCGACTGCACCTGTTCCTGATTA
wkat-BCTTCCTGTTCTGATTCTTCTGG katP Brunder et al. (1996)
wkat-FAACTTATTTCTCGCATCATCC
lpfO141-FCTGCGCATTGCCGTAAC lpfA O157/OI-141 Szalo et al. (2002)
lpfO141-RATTTACAGGCGAGATCGTG
lpfA-FATGAAGCGTAATATTATAG lpfA O113 Doughty et al. (2002)
lpfA-RTTATTTCTTATATTCGAC
O154-FCTGCAGGTCACCTACAGGCGGC lpfA O157/OI-154 Toma et al. (2004)
O154-RCTCTGCGAGTCGGCGTTAGCTG
SAADFCGTGATGAACAGGCTATTGC saa Paton et al. (2002)
SAADRATGGACATGCCTGTGGCAAC
toxB.911FATACCTACCTGCTCTGGATTGA toxB Tarr et al. (2002)
toxB.1468RTTCTTACCTGATCTGATGCAGC
iha-ICAGTTCAGTTTCGCATTCACC iha Schmidt et al. (2001)
iha-IIGTATGGCTCTGATGCGATG
EP1AATGGTGCTTGCGCTTGCTGC bfp Gunzburg et al. (1995)
EP2GCCGCTTTATCCAACCTGGTA
LH0147-BamHICCCGGATCCGGAAACTCCAAGAGTATTGC sab Herold et al. (2009)
LH0147n-EcoRICCCGAATTCCCTTGCTTTTCCCTGTTACC
VSAAFACTCGCATAATTGGTGGTGsaa variantsLucchesi et al. (2006)
VSAARATCATTGGTATTGCTGTCAT
EaeVFAGYATTACTGAGATTAAGeae variantsRamachandran et al. (2003)
EaeVRAAATTATTYTACACARAY
EaeZetaVRAGTTTATTTTACGCAAGT
EaeIotaVRTTAAATTATTTTATGCAAAC

Isolation and characterization of intimin-positive Escherichia coli

Samples positive for the intimin gene (eae) were serially diluted in MRD and plated onto Chromocult® Tryptone Bile X-Glucuronide agar (TBX; Merck, Dublin, Ireland) supplemented with sterile-filtered streptomycin sulphate (10 μg ml−1) (S6501; Sigma-Aldrich) and sulfamethazine (100 μg ml−1) (S6256; Sigma). After overnight incubation at 37°C, five colonies of differing colony morphology were taken from each sample and streaked onto nutrient agar (NA, CM0003; Oxoid) and eosin methylene blue agar (EMBA, CM0069; Oxoid). Genomic DNA was extracted from presumptive E. coli samples (those showing a green metallic sheen on EMB plates) by resuspending a single colony from the NA plate, resuspending in PrepMan® Ultra sample preparation reagent (Applied Biosciences, Foster City, CA, USA) and extracting DNA as per the manufacturer's instructions. All isolates were examined for the presence of the eae gene using 2 μl of the DNA sample and the PCR protocol as described above (Table 1). Positive isolates (eae +ve) were also examined for the presence of toxin genes (vt1 and vt2) by the method of Paton and Paton (1998) (Table 1), and reactions were run as per reaction mix A (previously described). All verotoxin-negative, intimin-positive isolates were preserved in a cryogenic bead storage system (Protect bacterial preservers; TSC Ltd, Heywood, UK) at −20°C and were routinely recultured.

The serotyping of the O (lipopolysaccharide) antigens of all the EPEC isolates was performed by the E. coli Reference Centre at the Pennsylvania State University, University Park, PA, USA. The O antigen was determined using antisera produced against all available serial groups O1-O181, with the exception of O31, O47, O72, O93, O94, O12 (Orskov et al. 1977).

To detect putative virulence and adherence genes, one cryogenic bead of each EPEC isolate was individually cultured in 10 ml of TSB overnight at 37°C. Genomic DNA was extracted from a 1-ml aliquot of culture using PrepMan® Ultra reagent. In addition to the eae gene, the template DNA of each EPEC isolate was analysed for the presence or absence of other putative virulence and adhesion genes using PCR.

These genes included (i) genes associated with LEE (tir, espA and espB), (ii) plasmid encoding virulence genes associated with the plasmid pO157 (katP, espP, etpD and hlyA) and (iii) genes encoding other attachment mechanisms (bfpA, saa, sab, toxB, iha, lpfAO157/OI-141, lpfAO113 and lpfAO157/OI-154). The primer sets and target genes are listed in Table 1. Reaction mix A (previously described) was used to amplify the katP, etpD, tir, bfpA, saa, toxB, iha, lpfAO157/OI-141, lpfAO113 and lpfAO157/OI-154 genes. Reaction mixture B was modified from the method of McNally et al. (2001) in which 1× Green GoTaq® reaction buffer was used to amplify espA, espB, espP and sab genes.

Reaction mixtures, including 2 μl of DNA, were made up to a final volume of 25 μl, and PCR product (10 μl) was separated by electrophoresis on a 1·5% (w/v) agarose gel and visualized under UV light by ethidium bromide staining. Products size was determined using a BenchTop 100-bp DNA ladder.

Molecular characterization of intimin variants

All isolates were further characterized using intimin typing methods as described by Ramachandran et al. (2003). Briefly, a single forward primer (EaeVF) and three reverse primers (EaeVR, EaeZetaVR and EaelotaVR) (Eurofins MWG Operon, Ebersberg, Germany) (Table 1) were used to amplify a 834–876 bp fragment (the size of which differ among variants) representing the 3′ variable regions of all reported intimin variants. The resulting PCR products (10 μl) were incubated along with three restriction endonucleases, AluI, RsaI and CfoI (New England Biosciences) following the manufacturer's instructions. The restriction fragments were separated by agarose gel electrophoresis and visualized using ethidium bromide staining. Intimin subtypes were determined by comparing resultant RFLP patterns with published RFLP profiles (Ramachandran et al. 2003).

Sequence analysis

A representative section of intimin variant PCR products was purified using the QIAquick PCR Purification Kit (28106; Qiagen), following the manufacturer's guidelines, and subsequently commercially sequenced (Eurofins MWG Operon). Sequences were analysed using the BlastN programme to search nucleotide databases (Altschul et al. 1997), and sequences were aligned with the sequence of published intimin variants.

Results

Of the 2700 samples analysed, 91 yielded isolates, 3·9% (47 of 1200) of faecal, 2% (12 of 600) of soil, 6·4% (29 of 450) of hide and 0·7% (3 of 450) of carcass samples were EPEC positive by PCR (eaeA positive-vt negative). Furthermore, 26 samples yielded multiple isolates (2–4 isolates). As some of the farms were mixed, it was not possible to distinguish between dairy and beef animal EPEC prevalence.

One hundred and forty isolates were obtained, 88 faecal, 15 soil, 33 hide and four carcass. Of the 140 farm (beef and dairy) and abattoir isolates, the serogroups O145, O26, O25, O98, O103, O15, O108 and O2 were found on the farm, while O145, O26, O2, O15 and O29 were detected in the abattoir samples (Table 2); forty-six isolates were serologically O nontypable.

Table 2. Sources and serogroups of aEPEC isolates obtained from farm and abattoir sampling
SerogroupFaecalSoilHideCarcassTotal
  1. aEPEC, atypical EPEC.

O2293234
O157213123
O2511
O26313218
O2911
O98639
O10311
O10811
O1453126
ONT3762146
Total8815334140

The distribution of virulence genes within the farm (faecal and soil) EPEC isolates is summarized in Table 3. The lpfAO113 gene was the most commonly identified virulence gene and was present in 51 of 103 isolates (50% of farm isolates) in serogroups O25, O26, O98 and untypables. The espP and the hlyA genes were also frequently detected, 29 of 103 (28%) and 25 of 103 (24%), respectively. The former was present in O15, O25, O26, O98 and O145. The hlyA gene was present in O25, O26, O98, O103, O145 and O nontypable. The tir, iha and toxB genes were detected in 17 of 103 (17%), 14 of 103 (14%) and 7 of 103 (7%) isolates, respectively.

Table 3. Serogroups, source and virulence gene profiles of aEPEC isolates
Serogroup (source and number)eaeAhlyA tir lpfAO157/OI141lpfAO157/OI154lpfAO113 saa espAespBespPtoxB iha
  1. F, faeces; S, soil; H, hide; C, carcass; ND, variant negative for current PCR methods; aEPEC, atypical EPEC.

O2 (F1, S1)θ+
O2 (F28, S2)θ
O2 (H1)θ++
O2 (H1)θ+
O15 (F1)θ+++
O15 (F6, S2)β
O15 (H3)β++
O15 (H10, C1)β+
O25 (F1)ND+++++
O26 (F3)β++++++
O26 (H1)β+++
O26 (H12, C2)β++
O29 (H1)β+
O98 (F6, S3)ND+++
O103 (F1)ε++
O108 (F1)β+++
O145 (S1, F1)γ++++++++
O145 (F2)γ+++++++
O145 (H1)γ+++++++
O145 (H1)γ++++++
ONT (F1)θ+++++
ONT (F1)θ++++
ONT (F1)β 
ONT (F7)β++++
ONT (F2, S1)θ+++
ONT (F26, S4)θ+
ONT (C1)β+++
ONT (H2)β++

The most common intimin type detected was θ, 68 of 103 (66%) isolates and serogroups O2, O15 and O nontypable. Intimin type β was present in 20 of 103 (19·4%) isolates and serogroups O15, O26, O108 and O nontypable. Intimin type γ was present in O145 isolates only (4 of 103, 4%), and intimin type ε was detected in one isolate of O103 (1%). The intimin type of a number of isolates (O25 and O98) could not be identified using currently available methodologies.

The distribution of virulence genes among the abattoir EPEC isolates (hide and carcass) is also summarized in Table 3. The tir gene was present in 36 of 37 (97%) abattoir isolates and serogroups O2, O15, O26, O29, O145 and O nontypable, and lpfAO157/OI-154 gene in 21 of 37 (57%) isolate and serogroups O2, O15, O26 and O nontypable. Other virulence genes lpfAO157/OI-141, lpfAO113, espA, espB, espP, toxB and iha genes were all detected in two of 37 isolates (5%), and the hlyA gene was found in one isolate of O26 (3% of isolates). The genes katP, bfpA, and sab were not detected in any of the isolates.

Intimin type β was most common, present in 33 of 37 isolates (89%) and serogroups O26, O15, O29 and O nontypable. Intimin type γ and θ were both detected in 2 isolates (5%), γ in O145 isolates and θ in O2 isolates. BlastN analysis of a representative selection of intimin variants confirmed RFLP results, showing 99% homology with known variants.

Discussion

This study presents data on the prevalence of EPEC serogroups in bovine faecal, hide and carcass samples as well as in farm soils sampled at bovine farms. All EPEC isolates were found to be aEPEC as they lacked the pEAF plasmid (absence of the bfpA gene), which is consistent with the generally accepted view that typical EPEC serogroups are only found in humans, while aEPEC are predominantly isolated from animal sources (Trabulsi et al. 2002). However, of the nine serogroups (O145, O2, O26, O25, O29, O98, O103, O15 and O108) reported in this article, to the best of our knowledge, only O145 (Aidar-Ugrinovich et al. 2007) and O26 (Gyles 1995) have been previously reported in cattle. O2, O15, O26, O103 and O145 aEPEC have been previously isolated from patients suffering diarrhoeal diseases (Blanco et al. 2006a; Nataro 2006; Estrada-Garcia et al. 2009) suggesting cross-contamination of food or water with animal faeces.

The most frequently occurring serotypes isolated in this study were O2 (34 isolates), O15 (23 isolates) and O26 (19 isolates). Interestingly, strains of O15 and O26 with the same virulence profile were isolated from both hide and carcass samples. Of the 14 abattoir O15 isolates, 11 have the same virulence profile (10 hide and one carcass). However, the carcass isolate and the hide isolates were obtained from different abattoirs. In contrast, nine of the O26 abattoir isolates were obtained from the same abattoir (seven hide and two carcass) and have the same virulence profile, suggesting hide to carcass cross-contamination.

One-third of our aEPEC isolates were O nontypable. The limitation of currently available antisera for serotyping aEPEC has been previously highlighted by Hernandes et al. (2009), who reported that 26·6% of aEPEC isolates from preschool children with diarrhoea were also O nontypable. With such high frequencies of aEPEC falling outside of the classical O antigen typing methods, discrimination of aEPEC based on serogroup is questionable, and more effective typing methods are required for this heterogeneous group of pathogens.

The virulence factors hlyA, tir, lpfA O113, lpfA O157/OI-154, and iha were detected in the majority our isolates, while lpfAO157/OI-141, saa, espA, espB and toxB were also present but to a lesser extent. The tir and esp genes are responsible for key components of the LEE-encoded attaching and effacing (A/E) system (Bolton 2011), the central mechanism of aEPEC pathogenesis, characterized by the destruction of gut epithelial microvilli and pedestal formation. As such, they may be present in all EPEC.

The same does not apply to other pathogenicity factors. In contrast to the typical EPEC, aEPEC are known to carry non-LEE virulence factors (Trabulsi et al. 2002) including putative adhesion genes saa (Paton et al. 2002), lpfA (Doughty et al. 2002), iha (Tarr et al. 2000) and toxB (Tatsuno et al. 2001), which may explain the variety of adherence patterns observed with these pathogens. Furthermore, some of these adhesins, such as the IrgA – homologous adhesion (Iha), may confer increased adherence (Schmidt et al. 2001). To the best of our knowledge, this is the first time the iha gene has been reported in aEPEC serogroups O145, O25 and O98.

Long polar fimbriae, encoded by the lpf genes, are also considered alternative adherence factors. 81 of 140 (58%) EPEC in this study carried one or more variants of this gene including lpfAO157/OI-141 and/or lpfAO157/OI-154. Previously considered to be exclusive to O157, it is now known that these lpf gene variants are widely distributed in diarrheagenic E. coli (Toma et al. 2004). Variant lpfAO113 has previously been reported in EPEC (Doughty et al. 2002). Their high prevalence in EPEC clinical isolates may suggest that long polar fimbriae are key determinants of disease in humans (Afset et al. 2006).

Four different intimin variants (β, ε, θ and γ) were detected, with β (38% of isolates) and θ (50%) being particularly common. The differentiation of the intimin alleles is an important diagnostic and epidemiological tool as different intimin variants may be responsible for different host tissue cell tropism (Torres et al. 2005; Abe et al. 2009). Int-β is widely reported in both human and animal EPEC (Trabulsi et al. 2002) and is particularly common in EPEC isolated from diarrhoeic calves (Goffaux et al. 2001; Orden et al. 2003). A significant number of intimin-positive isolates were found to possess a nontypable variant of the intimin gene using the restriction fragment length polymorphism assay described by Ramachandran et al. (2003). Scaletsky et al. (2009) reported 34% of EPEC carried untypable variants, and other authors have also highlighted the limitations of this method (Dulguer et al. 2003).

Conclusions

This study has demonstrated that cattle, their environments and derived carcasses are important sources of serologically and genetically diverse intimin-harbouring aEPEC strains, with different serogroups and different virulence gene profiles. Many of the EPEC isolates recovered in this study carried a numerous and diverse range of virulence related genes, confirming the pathogenic potential of these biotypes. Such differences may influence the relative risks posed to humans in contact with cattle, farm environments and bovine meat products. Effective surveillance across such higher risks activities may be currently constrained by the observed relatively high frequency of serologically nontypable (O-typing) aEPEC biotypes. The study also confirmed the relatively higher incidence of nontypable intimin variants, and more discriminatory methods for the examination of this particularly significant virulence factor may be required in the detection and differentiation of aEPEC from these high-risk environments. This study confirms that significantly pathogenic aEPECs occur frequently across a range of beef production and processing environments. Further research is required to quantify the public health risk associated with the presence of these pathogens and to provide the scientific basis for risk management activities if the risk is deemed to be of sufficient concern.

Acknowledgements

This project was funded by the Department of Agriculture, Fisheries and the Marine (DAFM), under the food and institutional research measure (FIRM), Ireland.

Ancillary