Development of multiplex real-time PCR for simultaneous detection of three Potyviruses in tobacco plants

Authors

  • J. Dai,

    1. State Key Laboratory of Crop Stress Biology in Arid Areas and Key Laboratory of Crop Pest Integrated Pest Management on the Loess Plateau of Ministry of Agriculture, College of Plant Protection, Northwest A&F University, Yangling, China
    Search for more papers by this author
  • H. Peng,

    1. College of Animal Science and Technology, Northwest A&F University, Yangling, China
    Search for more papers by this author
  • W. Chen,

    1. College of Animal Science and Technology, Northwest A&F University, Yangling, China
    Search for more papers by this author
  • J. Cheng,

    1. Shaanxi Tobacco Research Institute, Xi'an, China
    Search for more papers by this author
  • Y. Wu

    Corresponding author
    • State Key Laboratory of Crop Stress Biology in Arid Areas and Key Laboratory of Crop Pest Integrated Pest Management on the Loess Plateau of Ministry of Agriculture, College of Plant Protection, Northwest A&F University, Yangling, China
    Search for more papers by this author

Correspondence

Yunfeng Wu, State Key Laboratory of Crop Stress Biology in Arid Areas and Key Laboratory of Crop Pest Integrated Pest Management on the Loess Plateau of Ministry of Agriculture, College of Plant Protection, Northwest A&F University, Yangling 712100, China. E-mail: wuyf@nwsuaf.edu.cn

Abstract

Aims

To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and quantification of Tobacco etch virus (TEV), Potato virus Y (PVY) and Tobacco vein banding mosaic virus (TVBMV).

Methods and Results

Specific primer and probe combinations for TEV and TVBMV were developed from the coat protein region of the viral genome. To detect PVY, a primer and probe combination PVY-Univ F, PVY-Univ R and PVY-Univ P for amplifying the coat protein region of the virus genome was employed. The detection limit of multiplex real-time PCR for these viruses was 10 copies μl−1 of the standard plasmid. The multiplex reaction was successful in the detection of these three pathogens, with no non-specific amplification and cross-reaction.

Conclusions

This multiplex real-time PCR provides a rapid, effective, specific and sensitive method for the simultaneous detection and quantification of the three pathogens on infected tobacco plants.

Significance and Impact of the Study

This multiplex real-time PCR will be useful not only for diagnostic, ecological, epidemiological and pathogenesis studies, but also for investigating host/virus or virus/virus interactions, in particular during mix infection.

Introduction

Based on the development of new serological and molecular techniques, numerous detection methods have been developed for the detection of Tobacco etch virus (TEV), Potato virus Y (PVY) and Tobacco vein banding mosaic virus (TVBMV) in the recent years. Current detection methods for TEV include serological diagnosis by enzyme-linked immunosorbent assay (ELISA) (Legnani et al. 1996), and molecular diagnosis by reverse transcription-polymerase chain reaction (RT-PCR) (Lockhart et al. 2010). For PVY detection, ELISA (Crosslin et al. 2005), MIA (Bergervoet et al. 2008), RT-LAMP (Nie 2005), non-radioactive nucleic acid hybridization (NASH) (Janczur et al. 2006), RT-PCR (Xu and Nie 2005; Hogue et al. 2006), real-time RT-PCR (Kogovsek et al. 2008) and hybridization (Hataya et al. 1994; Maoka et al. 2010) were developed. Colloidal gold strip (Ji et al. 2009) and RT-PCR (Tian et al. 2007) were developed for TVBMV detection. However, none of the described detection procedures allowed a simultaneous detection and quantification of all these three viruses.

Multiplex real-time RT-PCR (MRT-PCR) assay is an alternative method to conventional PCR, which is capable of providing a concise quantitative measure of the number of viral copies in a tissue sample (La Fauce et al. 2007). Compared to single real-time RT-PCR, MRT-PCR has the advantage of amplifying several different targets in a single reaction tube and therefore is able to detect and discriminate among multiple viral strains/species simultaneously by measuring spectrally distinguished fluorescent signals. It has been broadly used for the detection and quantification of a variety of pathogens (Balme-Sinibaldi et al. 2006; Liu et al. 2008; Huang et al. 2009; Hyeon et al. 2010; Price et al. 2010; Qu et al. 2011).

In this study, an MRT-PCR system was developed that can detect simultaneously three tobacco viruses TEV, PVY and TVBMV. The effects of various reaction components on the specificity, sensitivity and stability of virus detection were evaluated. This multiplex technique not only will be useful for diagnostic evaluations, but can also be used as a valuable tool for ecological and epidemiological studies and investigations of host/pathogen interactions.

Materials and methods

Plant materials and RNA extraction

The tobacco viruses used in this study were TEV, PVY and TVBMV. Leaf tissue infected by these three viruses was collected in the field around Shaanxi, Shandong, Heilongjiang and Yunnan, China, and was identified by multiplex reverse transcription-PCR (Dai et al. 2012), and most of these field samples showed different combinations of these three tobacco viruses. Total RNA was extracted from healthy and infected leaf samples using the Universal Plant Total RNA Extraction Kit (BioTeke, Beijing, China). cDNA was synthesized using PrimeScript RT Reagent Kit (TaKaRa, Japan), according to the manufacturer's instructions.

Design of virus-specific primer/probe combinations

Specific primer and probe combinations for TEV and TVBMV were designed for MRT-PCR amplification of areas within the coat protein gene of different strains. The nucleotide sequence search program provided by the National Centre for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/blast) was used to obtain 20 coat protein gene sequences of each virus. Specific nucleotide regions that were used for primer design were selected from sequence alignments generated by DNAMAN (Lynnon Biosoft, Quebec, CA, USA). To detect PVY, a primer and probe combination PVY-Univ F, PVY-Univ R and PVY-Univ P for amplifying the coat protein region of the virus genome, generating a 73 bp PCR product, was employed (Kogovsek et al. 2008). The sequences and details of primers and probes were listed in Table 1.

Table 1. Primers and TaqMan probe sequences of Tobacco etch virus (TEV), Potato virus Y (PVY) and Tobacco vein banding mosaic virus (TVBMV)
Target virusPrimerSequence 5′-3′PositionsAmplicon size (bp)
TEVTEV-FCTAGGTTATTTGGTCTTGATG9196–9216104
TEV-RGACCCCTAATAGTGTGTG9282–9299
TEV-PROX-AGGAAGACACTGAACGGCACAC-Eclipse9235–9256
PVYPVY-Univ FCATAGGAGAAACTGAGATGCCAACT8873–889773
PVY-Univ RTGGCGAGGTTCCATTTTCA8927–8945
PVY-Univ PFAM-TGATGAATGGGCTTATGGTTTGGTGCA-Eclipse8899–8925
TVBMVTVBMV-FGTGTGAAAGATAAGGACAAA8659–8678135
TVBMV-RGTAGGTGTTGTAAGTTCA8776–8793
TVBMV-PHEX-CCAGCGGCACATTCTCAATACC-Eclipse8695–8716

Multiplex real-time RT-PCR

A mixture containing the cDNA of TEV, PVY and TVBMV was used to optimize the concentrations of primers and probes. The MRT-PCR was carried out in a final volume of 25 μl containing 2 μl of cDNA reaction mixture, 12·5 μl 2 × Premix Ex Taq, 400 nmol l−1 of each primer (TEV-F, TEV-R, PVY-Univ F, PVY-Univ R, TVBMV-F and TVBMV-R), 150 nmol l−1 of each probe (TEV-P, PVY-Univ P and TVBMV-P). The MRT-PCR was carried out in the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Reaction parameters were set at 42°C for 5 min, 95°C 10 s and 40 cycles of 95°C for 5 s and 60°C for 30 s.

The specificity of multiplex real-time PCR

The following four viruses were used to determine the specificity of the MRT-PCR assay: Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Potato virus X (PVX), Tobacco necrosis virus (TNV). All tobacco leaf tissue infected by these viruses was stored in our laboratory.

Diagnostic sensitivity and standard curve

The MRT-PCR products of TEV, PVY and TVBMV were purified from the agarose gels using Gel Extraction Kit (BioTeke). These fragments were ligated into the pMD18-T simple vector and cloned into Escherichia coli JM109. Plasmids were quantified by measuring OD260 with spectrophotometer ND1000 (NanoDrop, USA). The viral copy of the extracted plasmids was calculated using the formula:

display math

Each plasmid was optimized to 3 × 109 viral copy μl−1. Following optimization of concentration, the standard plasmid was equally mixed with plasmids of TEV, PVY and TVBMV. To evaluate the sensitivity of the MRT-PCR and singleplex real-time PCR assay, 10-fold serial dilutions of the standard plasmid from 106 to 1 viral copy μl−1 of each virus were tested. The serially diluted plasmid was also used to establish a standard curve for TEV, PVY and TVBMV by plotting the threshold cycle value against the viral copy logarithm via linear regression.

Interference test of multiplex real-time PCR

To carry out the interference test of MRT-PCR, two dilutions (3 × 106 and 3 × 103 viral copy μl−1) containing the plasmids of TEV, PVY and TVBMV were prepared. Four combinations were tested: (i) the mixture containing 106 viral copy μl−1 of TEV plasmid, 103 viral copy μl−1 of PVY and TVBMV plasmids; (ii) the mixture containing 106 viral copy μl−1 of PVY plasmid, 103 viral copy μl−1 of TEV and TVBMV plasmids; (iii) the mixture containing 106 viral copy μl−1 of TVBMV plasmid, 103 viral copy μl−1 of TEV and PVY plasmids; and (iv) the mixture containing 103 viral copy μl−1 of TEV, PVY and TVBMV plasmids.

Reproducibility assay

To evaluate the reproducibility of the assay, inter-assay and intra-assay tests were performed in triplicate by testing the standard plasmids including 101, 103 or 106 copies number μl−1 in each virus by MRT-PCR. The threshold cycle of each concentration was obtained and calculated.

Clinical detection of TEV, PVY and TVBMV

Tobacco leaf samples with symptoms collected from fields in China were detected by MRT-PCR. The same samples were also test by RT-PCR and ELISA to confirm the results of MRT-PCR. In ELISA assay, three kinds of antiserum (Neogen Corporation, Lansing, MI, USA) were used to determine TEV, PVY and TVBMV, respectively.

Results

Optimization of multiplex real-time PCR

MRT-PCR was carried out in the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The following concentrations were assayed: 200, 300, 400 and 500 nmol l−1 of primers; 100, 150, 200 and 250 nmol l−1 of probes. The optimized reaction conditions for MRT-PCR were obtained by 400 nmol l−1 of each primer (TEV-F, TEV-R, PVY-Univ F, PVY-Univ R, TVBMV-F and TVBMV-R) and 150 nmol l−1 of each probe (TEV-P, PVY-Univ P and TVBMV-P). The optimized protocol was set at 42°C for 5 min, 95°C 10 s and 40 cycles of 95°C for 5 s and 60°C for 30 s.

Specificity of the multiplex real-time PCR

The specificity of the MRT-PCR assay was investigated by testing four viruses (TMV, CMV, PVX and TNV). No cross-reactivity was observed, and no fluorescence was detected in four additional reference viruses and the negative control, which suggests high specificity of the assay against other tobacco viruses.

Sensitivity and standard cures of multiplex real-time PCR

Using the optimized concentration of each reagent, the detection result of MRT-PCR and singleplex real-time PCR was the same, and the detection limit was determined to be 10 copies number μl−1 for each virus of the standard plasmid. The threshold cycles for standard plasmid tested by MRT-PCR, including 10 copies number μl−1 in each virus, were 34·06, 34·02 and 34·67 in the TEV, PVY and TVBMV samples, respectively (Fig. 1), and the threshold cycles for standard plasmid tested by singleplex real-time PCR, including 10 copies number μl−1 in each virus, were 34·29, 32·29 and 35·06 in the TEV, PVY and TVBMV samples, respectively (Fig. 2). The standard curves of MRT-PCR were established from 10 to 106 copies number μl−1. The linear correlations (R2) between the threshold cycle and the viral copy logarithm were 0·999, 0·998 and 0·999 with a slope of −3·264, −3·323 and −3·292 for TEV, PVY and TVBMV, respectively (Fig. 3), indicating a reproducible linear response in detection of the three viruses.

Figure 1.

Sensitivity of the multiplex real-time PCR assay for Tobacco etch virus, Potato virus Y and Tobacco vein banding mosaic virus.

Figure 2.

Sensitivity of the singleplex real-time PCR assay for Tobacco etch virus, Potato virus Y and Tobacco vein banding mosaic virus.

Figure 3.

The standard curve of multiplex real-time PCR based on a 10-fold serial dilution of standard plasmid, including plasmids of Tobacco etch virus, Potato virus Y and Tobacco vein banding mosaic virus.

Interference test and reproducibility of multiplex real-time PCR assay

To investigate the effects of different amounts of target pathogens to the sensitivity of MRT-PCR assay, a mixture of different concentrations of the three viruses was co-amplified in a MRT-PCR assay. As shown in Table 2, when the concentrations of TEV, PVY and TVBMV were 103 copies number μl−1, the Cq values of PVY and TVBMV were 28·63 and 25·60, respectively, but (i) when the concentration of TEV increased to 106 copies number μl−1, the Cq value of PVY and TVBMV increased to 29·24 and 28·45, respectively; (ii) when the concentration of PVY increased to 106 copies number μl−1, the Cq value of TEV and TVBMV increased to 28·31 and 27·23, respectively; (iii) when the concentration of TVBMV increased to 106 copies number μl−1, the Cq value of TEV and PVY increased to 29·65 and 30·14, respectively. The results showed that the detection of the three viruses was influenced if the concentration of one of the viruses was high (106 copies number μl−1).

Table 2. Interference test of the multiplex real-time PCR
Pathogen (viral copy μl−1)Ct valuea
TEVPVYTVBMVTEVPVYTVBMV
  1. PVY, Potato virus Y; TEV, Tobacco etch virus; TVBMV, tobacco vein banding mosaic virus.

  2. a

    All samples were run in triplicate; data are presented as mean Ct ± SD.

10610310317·79 ± 0·2229·24 ± 0·1828·45 ± 0·44
10310610328·31 ± 0·2019·09 ± 0·0627·23 ± 0·16
10310310629·65 ± 0·2230·14 ± 0·2116·26 ± 0·47
10310310327·33 ± 0·3328·63 ± 0·1725·60 ± 0·69

Reproducibility of multiplex real-time PCR assay

The intra-assay and inter-assay reproducibility tests indicated that the triplex real-time RT-PCR was reproducible. As shown in Table 3, the coefficient of variation (CV) of TEV for the mean Cq values was in the range of 0·43–1·27% for the intra-assay and 0·97–1·24% for inter-assay. The CVs for both intra-assay and inter-assay of PVY were in the range of 0·28–3·06 and 0·29–2·55%, respectively. The CVs for both intra-assay and inter-assay of TVBMV were in the range of 1·52–2·61 and 0·85–2·06%, respectively.

Table 3. Reproducibility assay of threshold cycle value quantified by multiplex real-time RT-PCR (MRT-PCR) from the standard plasmid
PlasmidConcentration (viral copy μl−1)aIntra-assayInter-assay
Mean Ct + SDCV (%)Mean Ct + SDCV (%)
  1. CV, coefficient of variation; PVY, Potato virus Y; TEV, Tobacco etch virus; TVBMV, tobacco vein banding mosaic virus.

  2. a

    Each concentration of standard plasmid contained plasmids of TEV, PVY and TVBMV and simultaneously detected three viruses by MRT-PCR. Each standard plasmid was detected in triplicate by MRT-PCR in the intra-assay and inter-assay.

TEV10134·60 ± 0·441·2734·31 ± 0·330·97
10327·58 ± 0·120·4327·44 ± 0·291·06
10617·85 ± 0·191·0617·79 ± 0·221·24
PVY10134·86 ± 1·073·0634·31 ± 0·882·55
10328·59 ± 0·170·5928·82 ± 0·311·07
10619·06 ± 0·050·2819·10 ± 0·060·29
TVBMV10132·08 ± 0·491·5232·39 ± 0·270·85
10325·61 ± 0·672·6125·35 ± 0·451·76
10616·13 ± 0·382·3216·94 ± 0·352·06

Clinical detection of target viruses in field samples

From fields in China, 119 tobacco leaf samples with symptoms were collected and detected by MRT-PCR, RT-PCR and ELISA. The results of comparisons between MRT-PCR, RT-PCR and ELISA indicated that the assays give equivalent results in all but six samples, which were positive for TEV and TVBMV using MRT-PCR and RT-PCR but negative by ELISA (Table 4). These three viruses were found as multiple infections of the same plant.

Table 4. Clinical detection results by multiplex real-time RT-PCR (MRT-PCR), reverse transcription-polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA)
SamplesMRT-PCRRT-PCRELISA
LocationNumberTEVPVYTVBMVTEVPVYTVBMVTEVPVYTVBMV
  1. PVY, Potato virus Y; TEV, Tobacco etch virus; TVBMV, tobacco vein banding mosaic virus.

Shaanxi37152291522913226
Shandong33629862986298
Heilongjiang27112451124510245
Yunnan22516651665166
Total119379128379128349125

Discussion

In this study, a MRT-PCR assay using TaqMan probes was developed for the simultaneous detection and quantification of TEV, PVY and TVBMV. The MRT-PCR assay is a rapid, cost-effective, specific and sensitive tool that can simultaneously detect and quantify several pathogens by amplifying more than one target gene in a single reaction.

The specificity of the primers and probes used is a key part of the multiplex real-time PCR system. The specific primers and probe for TEV and TVBMV used in this study were designed to target coat protein gene of different strains. Specific nucleotide regions that were used for primer design were selected from sequence alignments generated by DNAMAN (Lynnon Biosoft). The primer and probe combination for PVY used in this study has been confirmed to have a high specificity in previous study (Kogovsek et al. 2008). The specificity of the MRT-PCR was investigated by testing other viruses (TMV, CMV, PVX and TNV) excluding TEV, PVY and TVBMV. No amplification was found in plant samples infected by TMV, CMV, PVX and TNV for the multiplex reaction. Therefore, the TEV, PVY and TVBMV primer/probes can be used as a diagnostic tool for detection of the specific pathogens under study.

It has been widely considered that real-time PCR is one of the most sensitive methods for pathogen detection and more sensitive than other methods such as ELISA, RT-PCR (Haegeman et al. 2006; Depner et al. 2007; Ay et al. 2008; Sharma and Dasgupta 2012). Using serial dilutions of standard plasmid, the detection limit of MRT-PCR and singleplex real-time PCR was the same, which determined to be 10 copies number μl−1 for each virus, and high correlation coefficients between the amount of viruses and Cq values for each pathogen were generated. The Cq values, reliable detection limits and correlation coefficients of the MRT-PCR showed that the presence of three sets of primer pairs and probes did not alter the sensitivity and efficiency of the multiplex PCR amplification. The detection results of field samples showed that two samples were positive for TEV and TVBMV using MRT-PCR and RT-PCR but negative by ELISA (Table 3). The reason of this situation may be that ELISA has the disadvantage of being less reliable for the detection of virus in plants with low virus titre (Canning et al. 1996). Serological testing has long been the standard for plant virus disease diagnostics. However, the application of molecular approaches has provided much greater sensitivity in detecting plant viral pathogens, when compared to serological testing (Ay et al. 2008).

In this study, an interference test was performed to investigate the ability of the MRT-PCR assay to amplify multiple targets present in different amounts in a single sample. The results showed that when one of the target pathogens was present at a high concentration (106 viral copy μl−1), the detection of other pathogens with low concentration (103 viral copy μl−1) was inhibited, leading to increased Cq values or, in other words, decreasing the sensitivity of detection. Previous studies have reported that the detection range of either pathogen was not influenced if the concentration (104 CFU ml−1) of one of the microbes was moderate (106 CFU ml−1) or low (104 CFU ml−1) but was affected if the concentration of one of the pathogens was high (Wang et al. 2007; Hyeon et al. 2010). Therefore, one target gene with high concentration could affect the amplification of other target genes with low concentration.

The symptomatic tobacco samples collected from four provinces of China were tested by MRT-PCR and found to have mixed infections of several viruses in the same tobacco plant. For the reason that China is a vast country, to some extent, the isolates collected from different provinces of large distance could demonstrate different origins and biological properties. Otherwise, collecting samples around the world is not easy to achieve for us, so the method was not used to test samples isolated from other regions. For confirming whether it is efficient for detecting samples out of China, we need much work to do for further validating. Previous studies have reported the interaction between two viruses. For instance, PVY is known to significantly enhance the replication and symptoms of PVX in mixed infections (Vance 1991). TVMV, TEV and pepper mottle virus (PepMoV) also give a synergistic reaction with PVX (Vance et al. 1995), and various other combinations of potyviruses and unrelated viruses have synergistic interactions (Pruss et al. 1997). Little is known about interactions among TEV, PVY and TVBMV, and adopting MRT-PCR methodology should be useful for studying interactions among these three viruses.

In conclusion, a new MRT-PCR assay was developed to detect TEV, PVY and TVBMV from infected tobacco plants. The MRT-PCR assay developed here is a rapid, specific and sensitive assay for the detection and quantification of TEV, PVY and TVBMV and can be used in studies of these three viruses in various areas, including distribution, characterization, epidemiology and pathogenesis. Additionally, MRT-PCR also will help shed light on virus/vector/host relations.

Acknowledgements

The study was supported by the Key Technology Program of China National Tobacco Corporation (110200902046) and the 111 Project from the Education Ministry of China, (No. B07049).

Ancillary