Shiga toxin-producing Escherichia coli in drinking water supplies of north Paraná State, Brazil

Authors


Correspondence

Jacinta S. Pelayo, Department of Microbiology, State University of Londrina, PO Box 6001, Highway Celso Garcia Cid, Post Code 86051-980, Londrina, PR, Brazil. E-mail: jspelayo@gmail.com

Abstract

Aim

To determine the occurrence and characteristics of Shiga toxin-producing Escherichia coli (STEC) in drinking water supplies treated and untreated.

Methods and Results

Drinking water samples (n = 1850) were collected from 41 municipalities in the north of Paraná State between February 2005 and January 2006. Escherichia coli isolates (n = 300) were recovered from water and investigated for the presence of virulence markers related to STEC by PCR. STEC isolates recovered were then characterized for both phenotypic and genotypic traits. A total of 12 isolates (11 from untreated water and one from treated water) were positive for stx, including five positive for both stx1 and stx2, two positive for stx1 and five positive for stx2. None of the STEC isolates contained eae, but other virulence genes were observed such as ehxA (100%), saa (100%), lpfAO113 (75%), iha (42%), subAB (25%) and cdtV (8%). Multidrug resistance was identified in 25% of the STEC isolates. The 12 STEC isolates belonged to seven distinct serotypes and pulsed-field gel electrophoresis typing revealed the presence of two clusters and two clones in this region.

Conclusion

Drinking water, especially from untreated water supplies, can be source of STEC strains potentially pathogenic for humans.

Significance and Impact of the Study

The investigation of the drinking water supplies for pathogenic E. coli, as STEC, may be useful to prevent waterborne outbreaks.

Introduction

Waterborne diseases have a negative impact on public health in developing countries, where many people do not have access to a safe drinking water supply and, consequently, many die of waterborne bacterial infections (Cabral 2010). The presence of Escherichia coli in drinking water is a significant concern for public health (Hunter 2003), especially due to the emergence of some diarrhoeagenic E. coli pathotypes, as Shiga toxin-producing E. coli (STEC).

Shiga toxin-producing E. coli are important zoonotic pathogens associated with a vast spectrum of infection in humans, from asymptomatic or moderate diarrhoea to haemorrhagic colitis (HC) and haemolytic uraemic syndrome (HUS) (Nataro and Kaper 1998). This pathogen can survive in the soil, corrals, pastures and also in water (Fremaux et al. 2008). The transmission of STEC occurs through poorly cooked meat, nonpasteurized milk, contaminated vegetables and water (Nataro and Kaper 1998). In several countries, O157:H7 is the main serotype associated with most cases of disease and outbreaks. However, more than 400 serotypes of STEC have been described, and over 150 implicated in human disease (WHO/CSR/APH/98.8 1998; http://www.usc.es/ecoli/SEROTIPOSHUM.htm). In Brazil, several studies conducted in recent years have demonstrated the occurrence of important STEC strains as cause of human disease (Guth et al. 2005; Irino et al. 2007; Souza et al. 2011), as well as the prevalence of STEC strains in the animal reservoir (Oliveira et al. 2008) and foods (Bergamini et al. 2007).

The ability of STEC to cause severe diseases in humans is mainly associated with the production of Shiga toxin (Stx) and two distinct groups, Stx1 and Stx2, with similar biological activity but different immunogenicity are well known (Paton and Paton 1998a). Members of the Stx1 group are antigenically similar, whereas Stx2 toxins are quite heterogeneous and comprise several variants or subtypes (Scheutz et al. 2005). Human pathogenic STEC strains can carry the chromosomal gene eae, which encodes an adhesin called intimin (Paton and Paton 1998a). Moreover, additional virulence factors have also been described in STEC strains, including enterohaemolysin (Ehly), which is encoded by ehxA gene (Schmidt et al. 1995); some adhesins such as Saa – STEC autoagglutinating adhesin (Paton et al. 2001), Lpf – long polar fimbriae (Doughty et al. 2002) and Iha – adhesin similar to Vibrio cholera IrgA (Tarr et al. 2000); and other toxins, such as SubAB – subtilase cytotoxin (Paton et al. 2004), CDT-V – cytolethal distending toxin-V (Cergole-Novella et al. 2007) and EAST1 – Enteroaggregative E. coli heat-stable enterotoxin (Girardeau et al. 2005).

Currently, molecular biology–based methods are used for epidemiological investigations of outbreaks and for the control and monitoring of the spread of potential pathogens. Pulsed-field gel electrophoresis (PFGE) is the most common molecular biology–based method used for the subtyping of STEC strains (Gerner-Smidt et al. 2006).

Although primarily associated with foodborne outbreaks, STEC has also become an important public health concern as a waterborne pathogen (Cabral 2010). Escherichia coli O157:H7 and possibly other STEC, such as O26:H11, have a low infectious dose (Nataro and Kaper 1998), which allows water to act as an efficient vehicle. It has been demonstrated that insufficient treatment or processing of surface waters for the drinking water supply, malfunctioning of sewage collection systems, and defective water distribution pipelines have led to contamination of potable drinking water by STEC (Ram et al. 2008). In Brazil as in some other countries, surface waters from rivers, lakes and ponds are processed by treatment, filtration and chlorination to be used as drinking water (BRASIL 2011). However, despite the high incidence of waterborne diseases in this country (about 600 cases/100 000 inhabitants/year) (http://portal.saude.gov.br/portal/arquivos/pdf/surtos_agua_10.pdf), there are no published data on the monitoring of STEC in Brazilian drinking water sources. Thus, the aim of this study was to determine the presence and characteristics of STEC in untreated and treated water supplies of north Paraná State. Altogether, our results will help to determine the role of water in the emergence of STEC and to estimate the significance of these organisms for public health.

Materials and methods

Sample collection

During the period of February 2005–January 2006, a total of 1850 drinking water samples (1200 treated and 650 untreated) used for direct human consumption were collected in 41 municipalities of north of Paraná State, Brazil. The water supplies were located in both rural and urban areas. Water samples (250 ml) were collected into sterile glass bottles, stored on ice and transported to the laboratory for analyses within 6 h (APHA 2005).

Isolation and identification of E. coli

The Colilert (Quanti-Tray/2002™) method (IDEXX Laboratories, represented by SOVEREIGN-BR) was used for the detection of viable E. coli cells from water. Escherichia coli were recovered and streaked onto MacConkey agar (MC) (Biobras, MG, Brazil). About three colonies were picked randomly from each MC plate and identified using conventional biochemical tests, such as acid and gas production from d-glucose fermentation, motility, lysine decarboxylation, indole production and citrate (Toledo et al. 1982a,b). In total, 300 isolates were identified as E. coli and were stored in Brain Heart Infusion broth (BHI) (Difco, Michigan, USA) with 20% glycerine at −70°C until use.

Extraction of bacterial DNA

Escherichia coli isolates were grown in Luria-Bertani (LB) broth at 37°C overnight. Bacteria from 1·5 ml of growth medium were pelleted by centrifugation at 1200 g for 10 min. The bacterial pellet was suspended in 200 μl of sterile ultrapure water. The bacteria were lysed by boiling for 10 min in a water bath (100°C). The lysate was centrifuged again as before, and the supernatant was used directly as template for PCR.

Detection of stx1, stx2, eae and ehxA genes by multiplex PCR

All E. coli isolates were subjected to multiplex polymerase chain reaction (m-PCR) for the detection of stx1, stx2, eae and ehxA genes as previously described (Paton and Paton 1998b). The m-PCR was performed with Gene Amp PCR System 9700 thermal cycler (Applied Biosystems, Foster City, CA, USA). The products were visualized under UV light in a transilluminator (ECX-20.M, Vilbert Lourmat, France). All primers used in this study are listed in Table 1.

Table 1. Primer sequences used
PrimerSequence (5′–3′)Target geneAnnealing temp. (°C)Amplicon size (bp)References
Stx1-FATAAATCGCCATTCGTTGACTAC stx1 60180Paton and Paton (1998b)
Stx1-RAGAACGCCCACTGAGATCATC
Stx2-FGGCACTGTCTGAAACTGCTCC stx2 60255Paton and Paton (1998b)
Stx2-RTCGCCAGTTATCTGACATTCTG
eaeA-FGACCCGGCACAAGCATAAGC eae 60384Paton and Paton (1998b)
eaeA-RCCACCTGCAGCAACAAGAGG
hlyA-FGCATCATCAAGCGTAGCTTCC ehx 60534Paton and Paton (1998b)
hlyA-RAATGAGCCAAGCTGGTTAAGCT
SAADFCCTCACATCTTCTGCAAATACC saa 60119Paton and Paton (2002)
SAADRGTTGTCCTGCAGATTTTACCAATGGA
lpfA-FATGAAGCGTTAATATTATAG lpfA O113 50573Doughty et al. (2002)
lpfA-RTTATTTCTTATATTCGAC
Iha-FCTGGCGGAGGCTCTGAGATCA Iha 57827Tarr et al. (2000)
Iha-RTCCTTAAGCTCCCGCGGCTGA
SubAFGTACGGACTAACAGGGAACTG subAB 621823Paton and Paton (2005)
SubBRGCAAAAGCCTTCGTGTAGTC
cdtV-FTTCATTGTTCGCCTCCTG cdtV 52755Cergole-Novella et al. (2007)
cdtV-RTTTATAAAGCTGGTATCCTG 
EAST11aCCATCAACACAGTATATCCGA astA 58111Yamamoto and Echeverria (1996)
EAST11bGGTCGCGAGTGACGGCTTTGT
VT2-cAAGAAGATGTTTATGGCGGTstx2 and stx2c55285Tyler et al. (1991)
VT2-dCACGAATCAGGTTATGCCTC
Stx2d-activatableCTTTATATACAACGGGTG stx2d act 54359Zheng et al. (2008)
CKS2CTGAATTGTGACACAGATTAC
VT2-cmCCCGAATTCGGCACAAGCATAAGC stx2d 55256Piérard et al. (1998)
VT2-fCCCGTGATACCAGTACCAATTACGGTC
ChuA.1GACGAACCAACGGTCAGGAT chuA 55279Clermont et al. (2000)
ChuA.2TGCCGCCAGTACCAAAGACA
YjaA.1TGAAGTGTCAGGAGACGCTG yjaA 55211Clermont et al. (2000)
YjaA.2ATGGAGAATGCGTTCCTCAAC
TspE4C2·1GAGTAATGTCGGGGCATTCATSPE4.C255152Clermont et al. (2000)
TspE4C2·2CGCGCCAACAAAGTATTACG

Phenotypic assays

Vero cell cytotoxicity assay

The cytotoxicity of the STEC isolates was determined using Vero cells as described previously by Roberts et al. (2001) with some modifications. Vero cells were exposed to the bacterial filtrate diluted 1 : 4, 1 : 40, 1 : 400 and 1 : 4000 in DMEM for 72 h and, after this period, the metabolically active cells were determined using an MTT diagnostic kit (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Roche Diagnostics, Indianapolis). The level of cytotoxicity was calculated using the following formula: (1−absorbance of the sample/absorbance of the control) × 100 (Murakami et al. 2000). A percentage ≥50% was considered a high cytotoxic effect and <50% represented a low cytotoxic effect.

Enterohaemolysin activity

Production of enterohaemolysin was determined by the method described by Beutin et al. (1988). Escherichia coli O4:K3:H5 (strain U4-41) and E. coli O26:H- (strain C3888) were used as positive controls to α-haemolysin and Ehly, respectively.

Adherence test

Bacterial adherence to HEp-2 cells was performed for 6 h at 37°C as described by Cravioto et al. (1979).

Serotyping

The determination of O:H serotypes was carried out by the method described by Ewing (1986) using O (O1–O185) and H (H1–H56) antisera prepared at the Adolfo Lutz Institute, São Paulo, Brazil.

Determination of susceptibility to antimicrobials

The antimicrobial susceptibility to amikacin (30 μg), ampicillin (10 μg), cefepime (30 μg), cefotriaxone (30 μg), cefoxitin (30 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), gentamicin (10 μg), imipenem (10 μg), streptomycin (10 μg), sulfazotrin (25 μg), tetracycline (30 μg) and tobramycin (10 μg) was determined by the standard disk diffusion method (CLSI 2009).

Search for additional virulence genes

All STEC isolates were further analysed by PCR for the presence of gene sequences related to saa, lpfAO113, iha, subAB, cdtV and astA. Cycling conditions and the specific primers employed in the PCR assays were as previously reported (Yamamoto and Echeverria 1996; Tarr et al. 2000; Doughty et al. 2002; Paton and Paton 2002; Paton et al. 2004; Cergole-Novella et al. 2007).

stx2 subtyping

PCR assays using specific primer sequences were employed for stx2 subtyping as previously described (Tyler et al. 1991; Piérard et al. 1998; Zheng et al. 2008).

Phylogenetic grouping

The phylogenetic group (A, B1, B2 and D) was determined by a triplex PCR assay with three DNA markers (chuA, yjaA and the DNA fragment TSPE4.C2) as described by Clermont et al. (2000).

PFGE typing

The macrorestriction analysis of genomic DNA with XbaI described by Gautom (1997) was used with some modifications for PFGE. The digestion time was extended to 16 h, and PFGE was performed on a CHEF-DRIII PFGE apparatus (Bio-Rad, Hercules, CA, USA). The pulse time was increased from 5 to 50 s over a 20-h period. The band patterns were analysed by using the GelCompar II program, and the similarity between PFGE patterns was evaluated by using the Dice coefficient similarity (tolerance, 1%). Isolates were considered to have the same PFGE patterns, when all bands were identical, and isolates that showed ≥80% similarity were considered closely related and grouped together.

Results

The presence of STEC in drinking water

The presence of E. coli was detected in 204 (11%) of 1850 water samples tested and among them 198 were from untreated water and six were from treated samples. A total of 300 E. coli isolates were recovered, of which 12 (4%) were positive for the presence of stx gene(s) and thus considered STEC. Eleven STEC strains were isolated from untreated drinking water samples and one was recovered from treated water. The 12 STEC isolates were recovered from water samples of nine different municipalities. Isolates EC-2 and EC-3 were recovered from the same municipality and isolates EC-10, EC-109 and EC-167 were isolated from another. The other seven isolates were obtained from a different municipality each (Table 2).

Table 2. Origin, serotypes and virulence characteristics of the STEC strains isolated from water in Brazil
IsolateOriginMunicipalitySerotypePCR: virulence genesPhenotypic assaysPhylogenetic group
stx1 stx2 eae ehxA saa subAB iha cdtV lpfA O113 astA EhlyaStxbHEp-2cAntimicrobial Resistance
  1. TW, treated water; UNTW, untreated water; NT, not-typable; R, rough; ABA, Abatiá; CBE, Cambé; CPC, Cornélio Procópio; LON, Londrina; NAC, Nova América da Colina; SCP, Santa Cecília do Pavão; SER, Sertaneja; SJS, São Jerônimo da Serra; stx2dact, stx2dactivatable (mucus-activatable stx2d); AA, aggregative adhesion; SLA, semi-localized adherence; CLA, chain-like adherence; AMP, ampicilin; CHL, chloramphenicol; CIP, ciprofloxacin; STR, streptomycin; SUT, sulfazotrin; TET, tetracyclin.

  2. a

    Expression of enterohaemolysin on washed sheep blood agar.

  3. b

    Production of Shiga toxin (cytotoxic effect in Vero cells).

  4. c

    Adherence pattern to HEp-2 cells.

EC-2UNTWLONOR:H2+++++AAAMP, CIP, CHL, STR, SUT, TET D
EC-3UNTWLONOR:H2+-++++SLAAMP, CHL, STR, SUT, TETD
EC-10UNTWSCPONT:H18++ (2dact)+++++AASTRB2
EC-22UNTWCBEONT:H19+ (2dact)++++++SLASTRB2
EC-63TWSEROR:H21++ (2dact)+++++AASTR, TETB2
EC-89UNTWCPCONT:H18++ (2dact)++++++CLASTRB2
EC-109UNTWSCPONT:H18++ (2dact)++++++AACHL, STR, SUT, TETB2
EC-134UNTWABAOR:H10++ (2dact)++++++AASTRB2
EC-167UNTWSCPOR:H19+ (2dact)+++++++AASTRD
EC-204UNTWCSUO141:H8+ (2dact)+++++SLASTRA
EC-258UNTWSJSONT:H19+ (2dact)++++++AASTR, TETA
EC-281UNTWNACONT:H19+ (2dact)++++++AASTRD

Serotypes of STEC isolates

Serotyping results showed that at least seven different serotypes were identified among the STEC strains (Table 2), although the O antigen of six isolates were not-typable (ONT) and five were rough (OR). A diversity of H antigens was identified, being H18 and H19 the most prevalent flagellar types.

STEC virulence genes

Genotype stx2 was found in five (42%) isolates and stx1/stx2 combination in five other isolates, while the remaining two had only stx1 (Table 2). None of the STEC isolates were positive for eae and astA genes, but all carried ehxA. The occurrence and distribution of virulence markers related to putative adhesins and toxins are also shown in Table 2. The most prevalent adhesins identified among all STEC isolates were those encoded by saa (100%) and lpfAO113 (75%); iha gene was present in 42% of the isolates. Three isolates were positive for subAB gene, all of which belonged to ONT:H19 serotype, while cdtV was present in only one isolate.

Based on the distribution of the genes investigated, several distinct virulence profiles were identified, but stx1 stx2 ehxA saa lpfAO113 iha was the most frequently observed. Analysis of stx-specific PCR products showed that all stx2-positive isolates presented stx2dactivatable subtype. STEC ONT:H18 isolates carried both stx1 and stx2dact genes, while all ONT:H19 isolates presented stx2dact only.

Phenotypic characteristics of isolates

All STEC isolates exhibited a narrow zone of haemolysis on washed sheep blood agar after incubation for 24 h, indicating enterohaemolytic activity. The cytotoxicity assay revealed that all STEC isolates displayed a cytotoxic effect in Vero cells. However, MTT assay results showed that the degree of toxicity of the isolates varied. In 1 : 4 and 1 : 40 dilutions, the percentual of isolates that demonstrated a high cytotoxic effect was 100 and 66.6%, respectively. The degree of toxicity ranged from 22 to 38% in 1 : 400, and only four isolates (EC-2, EC-3, EC-89 and EC-167) showed a considerable cytotoxic effect (more than 10%) in 1 : 4000 dilution.

The 12 STEC isolates were adherent to HEp-2 cells, and distinct adherence patterns were observed. Eight isolates showed aggregative (AA) pattern; three isolates showed semi-localized adherence (SLA) pattern, described as large clusters of adherent bacteria on the epithelial cell surface (Paton et al. 2001); and one isolate showed chain-like adhesion (CLA), described as a distinct pattern of adherence characterized by bacteria attaching on both coverslip and HEp-2 cell surfaces forming long-chain aggregates (Gioppo et al. 2000).

According to the results of antibiotic susceptibility test, all of the STEC isolates showed resistance to at least one of the selected antimicrobial agents. Three (25%) isolates were resistant to three or more classes of antimicrobials (multidrug-resistant). The highest resistant rates were identified for streptomycin (100%) and tetracyclin (42%). However, resistant to sulfazotrin (25%), chloramphenicol (25%), ampicillin (16%) and ciprofloxacin (8%) were also identified (Table 2).

Phylogenetic classification and PFGE analysis

Phylogenetic analysis revealed that the majority of STEC isolates belonged to B2 (50%) and D (33·3%) groups. The other two isolates were designated as group A, and none of the isolates belonged to group B1 (Fig. 1). All ONT:H18 isolates were classified as B2. Furthermore, except for one, the B2 isolates did have the stx1/stx2dact genes (Table 2).

Figure 1.

Dendogram showing the clonal relationships among STEC isolates from drinking water based on macrorestriction analysis of genomic DNA with XbaI.

Seven distinct PFGE profiles with 10–13 discernible fragments, ranging from approximately <40 to 500 kb in size were identified. PFGE profiles were arranged in two clusters (A and B) based on a genetic relatedness criterion of ≥80% similarity (Fig. 1). Two pairs of STEC isolates (EC-2 and EC-3, EC-109 and EC-167) and one quartet (EC-10, EC-22, EC-63 and EC-204) showed identical PFGE profiles (II, IV and I, respectively). The isolates EC-2 and EC-3 also showed the same serotype as well as identical genotypic characteristics. In addition, these isolates were recovered from different places at the same municipality, in a time interval of 7 days, suggesting a common origin and persistence of a specific STEC clone in this location. Genetic heterogeneity was observed among other isolates of the same serotype, according to different PFGE profiles, indicating a nonclonal spread.

Discussion

The occurrence of STEC in drinking water sources has been reported worldwide (Halabi et al. 2008; Ram et al. 2008), as well as waterborne outbreaks of disease caused by this pathotype (Hrudey et al. 2003; Mccall et al. 2010; Lienemann et al. 2011). However, STEC has not been commonly detected in drinking water samples in Brazil (Ribeiro et al. 2011). The recovery of an E. coli O157:H7 strain from a private well located on rural area of São Paulo State (Katsuya et al. 1998) was so far the only report of isolation of this pathogen from water sources in this country. Thus, the present study represents, to our knowledge, the first report of the presence of STEC in diverse drinking water sources in Brazil.

The great majority of STEC strains isolated herein (91·6%) were recovered from untreated water, located in rural zones (data not shown). Small water systems that supply rural townships or camps have commonly been associated with waterborne outbreaks (Olsen et al. 2002). Interestingly, one of the STEC isolates studied was recovered from a public treated water system. This water sample showed a chlorine concentration of 0·6 mg l−1 (data not shown), a level significantly higher than the minimal detectable disinfectant residual level mandated for drinking water distribution systems in Brazil (BRASIL 2011). Although chlorination appears to adequately inactive this pathogen in water, chlorine-tolerant STEC strains have been reported (Lisle et al. 1998). The attachment of STEC to abiotic surfaces, such as pipes, and the formation of biofilms may enhance persistence within water distribution systems (Ryu and Beuchat 2005), as these organisms in biofilms also tend to become more resistant to treatment or disinfection (Williams and Braun-Howland 2003). All the STEC strains isolated from water in this study were able to adhere to Hep-2 cells, and 67% of them showed an aggregative adherence pattern. One may suggest that this characteristic may have influenced the ability of STEC to persist in the environment.

Overall, a relative high phenotypic and genotypic diversity was observed among the STEC isolates recovered from drinking water samples (Table 2). In total, seven serotypes were identified, all of which have been previously reported in STEC isolated from humans (WHO/CSR/APH/98.8 1998, http://www.usc.es/ecoli/SEROTIPOSHUM.htm). To our knowledge, this is the first report of the O141:H8 serotype in STEC in this country. The failure to determine the O type has been commonly observed among STEC strains isolated from environmental sources (Oliveira et al. 2008), suggesting the complexity of this pathotype. However, the fact that STEC strains belonged to ONT or OR-serotypes have already been implicated in severe disease demonstrates that these isolates can also to be a threat to human health (Cho et al. 2011).

The presence of the stx2 in 10 of the 12 STEC isolates studied is an interesting finding, because Stx2 has been epidemiologically more associated with severe disease in humans than Stx1 (Friedrich et al. 2002). Similarly, other studies indicated that the stx2 genes were more prevalent than stx1 genes among STEC strains isolated from cattle in Paraná State (Farah et al. 2007; Pigatto et al. 2008). Moreover, all carried the stx2dactivatable subtype, which has been associated with high virulence and the ability to cause HUS (Bielaszewska et al. 2006). Thus, the large number of stx2dact genes found in STEC isolates recovered from drinking water deserves attention of general public.

All STEC isolates carried ehxA gene and showed enterohaemolytic activity on washed blood agar. Enterohaemolysin has been frequently found in STEC strains responsible for severe human disease (Beutin et al. 2004). In addition, it has been previously demonstrated that human vascular endothelial cells also suffer damage due to Ehly (Aldick et al. 2007), suggesting that this toxin may contribute to serious complications of STEC infection.

The fact that all STEC isolates were negative for the gene eae does not necessary indicate that these are nonpathogenic for humans, because LEE-negative STEC strains have been responsible for sporadic cases of HUS and small outbreaks (Cantarelli et al. 2000; Beutin et al. 2004) as well as the recent outbreak associated with intimin-negative O104:H4 in Germany (Bielaszewska et al. 2011). Previous data suggested that the production of an activatable toxin might compensate for the lack of LEE pathogenicity island (Bielaszewska et al. 2006). Furthermore, it was postulated that STEC strains lacking eae could have putative adhesins mediating attachment to the host cells, such as Saa, Lpf and Iha (Toma et al. 2004), found in 100, 75 and 42% of the isolates in the present study, respectively. Apart from adhesins, new types of toxins have been described in STEC isolated from HUS patients, such as SubAB and CDT-V (Galli et al. 2010), found in 25 and 8% of the isolates studied.

Multiantimicrobial-resistant STEC strains have been isolated from surface waters used to supply drinking water (Ram et al. 2008). In this study, STEC isolates were found to be resistant to at least one antimicrobial agent and three isolates were multidrug-resistant. High rates of resistance to streptomycin and tetracycline have also been previously reported in STEC strains isolated from humans, cattle and food (Cergole-Novella et al. 2011). The recent 2011 HUS outbreak in Germany was caused by a new strain of E. coli with a distinct set of virulence and antibiotic-resistant factors (Bielaszewska et al. 2011). Hence, the possibility exists that combinations of virulence factors and resistance determinants may occur over time, especially in E. coli, as its genome has such a high degree of plasticity (Denamur 2011). Although antimicrobial therapy is generally not recommended for treatment of STEC infections in humans, an increased surveillance to susceptibility of this pathotype to antimicrobial agents is needed to prevent the emergence of new hypervirulent strains.

Previous studies have reported that STEC strains fall principally into phylogenetic groups A, B1 and D and rarely into B2 group (Ziebell et al. 2008; Contreras et al. 2011). In contrast, 50% of the STEC isolates of this study segregated mainly in B2 group. It is important to point out that the great majority of the virulence markers are maintained on mobile genetic elements, and this may facilitate the spread of virulence within phylogenetic groups (Girardeau et al. 2005). Thus, regardless of phylogenetic group, the virulence factor profile of an E. coli isolate predicts its virulence potential.

Pulsed-field gel electrophoresis analyses revealed that STEC isolates recovered from the same geographic location or from different municipalities showed identical banding profiles or were closely related, suggesting the presence of some clones in this region.

In summary, the occurrence of potentially pathogenic STEC on various drinking water supplies was for the first time described in Brazil, thus suggesting that drinking water may serve as a potential source of transmission of STEC to humans in our setting. The recovery of STEC from a treated water sample also can be considered an important concern. In addition, these results emphasize that the presence of STEC in water for human consumption can pose risks to the health of the population. Furthermore, the identification of potential sources of STEC strains could help to establish control and prevention strategies.

Acknowledgements

This manuscript was supported by grants from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq-Brazil).

Ancillary