Potential probiotic thermophiles isolated from mice after compost ingestion

Authors


Correspondence

Hirokuni Miyamoto, Japan Eco-science (Nikkan Kagaku) Co. Ltd, Shiomigaoka-chou 11-1-2F, Chuuou-ku, Chiba 260-0034, Japan. E-mail: hirokuni@je-s.com, h-miyamoto@faculty.chiba-u.jp

Abstract

Aims

The oral administration of a compost produced by the fermentation of marine animals with thermophiles confers health benefits for fish and pigs. This study aimed to isolate the beneficial bacteria from this compost that would modulate the physiological conditions of host animals.

Methods and Results

The compost extract was orally administrated to germ-free mice for 21 days, and thereafter, the culturable bacterial population within the caeca was surveyed. Sequence analyses of the 16S rRNA gene from the two predominant thermophilic isolates revealed organisms that were closely related to Bacillus thermoamylovorans and Bacillus coagulans. These bacteria could grow at 37°C, but more abundantly at 50–55°C, and they were minor components of the original compost extract. When an individual bacterial strain or a mixture of strains was administered to the conventionally maintained mice, their levels of faecal immunoglobulin A, an indicator of the gut immune response, were markedly raised. In addition, their feeding efficiency also changed among the tested mouse groups.

Conclusions

These two kinds of thermophilic bacterial species, isolated from the caeca after compost ingestion to the germ-free mice, are candidate probiotics that could function in the mammalian gut.

Significance and Impact of the Study

This study revealed that the compost used in agriculture can contain potential probiotic thermophiles.

Introduction

The mammalian gastrointestinal tract is germ free at birth. Subsequently, a consortium of approximately 100 trillion microbes is established by the introduction of bacteria from the environment (Xu and Gordon 2003; Ley et al. 2006). The role of various symbiotic microbes in postnatal gut development has been investigated (Xu and Gordon 2003; Ley et al. 2006), and many mesophilic bacteria that participate in mutually beneficial host–bacteria relationships have been identified and used as probiotics. In addition to extreme conditions, extremophilic bacteria inhabit a variety of common niches, including soil and sediments (e.g. Wiegel and Kevbrin 2004), which provides the animals with ample opportunities to ingest extremophiles while eating, drinking and even breathing. Little is known, however, about the host–bacterial relationships of extremophilic bacteria.

Probiotics are live micro-organisms which, when ingested in sufficient amounts, confer a health benefit on the host (which is the world-wide accepted consensus FAO/WHO definition of probiotics). Two genera, Lactobacillus and Bifidobacterium, have been used as probiotics in both human and farm animal diets (Kligler and Cohrssen 2008). Probiotic bacteria digest dietary polysaccharides to produce short-chain fatty acids (Sakata et al. 2003), exert anti-inflammatory effects (O'Mahony et al. 2005), inhibit the colonization of pathogenic bacteria (Stecher and Hardt 2008) and modulate the mucosal immune response (Petrof 2009). By way of example, although probiotics improve clinical outcomes in gastrointestinal disorders, the effects seem to be strain specific (Petrof 2009). Not all probiotic bacteria exert the same action within the host, nor do they all use the same strategies to surpass competing microbes in the gastrointestinal tract. To date, few extremophilic bacteria have been suggested for use as probiotics because they are rarely found in the gastrointestinal tract. We hypothesized that ingesta enriched with extremophilic bacteria would provide an opportunity to isolate novel probiotics.

Recently we surveyed the microbial population of a compost made from fermented marine animals that are not suitable for human consumption (such as small shrimp, small crabs and small fishes). The temperature during composting reached approximately 75°C due to fermentation-associated self-heating. The final product of fermentation contained many thermophilic bacteria, most of which were Bacillaceae (Niisawa et al. 2008). Notably, Bacillus sp. NP-1 produces an antifungal cyclic lipopeptide (Niisawa et al. 2008) and thermophilic bacteria produce exo- and endochitinases (Sakai et al. 1994, 1998), suggesting that the compost plays a role similar to that of plant growth-promoting rhizobacteria (PGPR). In addition, the compost improved the quality of the plants and the soil conditions (Ishikawa et al. 2013). These findings could be evaluated as to why the compost has been well used as an organic fertilizer or soil conditioner. Furthermore, we reported that the compost could be utilized as a feed additive to animals (Tanaka et al. 2010; Miyamoto et al. 2012). In swine and poultry farms where the compost was used as a feed additive, accelerated fermentation decreased the volume of faecal matter. Retrospective studies showed a reduction in stillbirths and an increase in the growth of piglets after compost administration (Miyamoto et al. 2012). In addition, we reported the effects of ingestion of compost or compost extract on physiological parameters in the flatfish Paralichthys olivaceus. Specifically, the oral administration of compost increased the total free amino acids in flatfish muscle and decreased the number of fish deaths per day (Tanaka et al. 2010). Furthermore, we reported that oral administration of the extract of thermophile-fermented compost could influence gene expression in the gastrointestinal tract of rats and stimulated immunoglobulin A (IgA) production there (Satoh et al. 2012). These effects were slightly weakened under the presence of a compost extract sterilized by filtration. These results suggest that the compost contains probiotic bacteria involved in these beneficial effects.

To date, the bacteria colonizing the gastrointestinal tract after compost ingestion have not been evaluated. In this study, we isolated some Bacillus species from the caeca of the gnotobiotic mice established by thermophilic bacteria in the compost. Furthermore, the growth rates and some physiological markers of mice fed the compost extract or thermophilic bacterial isolates were investigated. Our results suggest that the compost, as used in agriculture, could potentially contain probiotic thermophiles.

Materials and methods

Administration of compost extract to germ-free mice

For the identification of possible probiotic bacteria from the compost, a method preparing gnotobiotic animals harbouring a limited bacterial flora was performed (Gérard et al. 2004; Momose et al. 2009). BALB/c germ-free male mice were used in accordance with the guidelines for the care and use of laboratory animals at The University of Tokyo. The 10-week-old, germ-free mice (n = 5) received either autoclaved water or water containing 0·5% (v/v) compost extract (see the following paragraph) for 21 days ad libitum. The mice were fed a pelleted commercial diet (CMF; Oriental Yeast Co. Ltd, Tokyo, Japan) sterilized using γ irradiation at 50 kGy. The mice were housed in a room on a 12 h:12 h light: dark cycle at 24 ± 1°C and a relative humidity of 55 ± 5% (Momose et al. 2009).

Compost was produced using an aerobic repeated fed-batch fermentation system (Niisawa et al. 2008). This compost has been marketed as both an organic fertilizer and a fermented feed for pigs and chickens (Miroku Co. Ltd, Oita and Keiyo Plant Engineering Co. Ltd, Chiba, Japan). The compost was diluted 1 : 100 (v/v) with potable water and incubated under aerobic conditions at 60°C for at least 10 h. The compost suspension was filtered through a nylon mesh (100-μm pore size) and frozen at −20°C until use (Miyamoto et al., 2011). The solved extract was used as the compost extract. Water containing 0·5% (v/v) compost extract was administered to the germ-free mice.

Isolation of bacteria from the caeca of gnotobiotic mice and the compost extract

Caecal contents were collected from the germ-free mice that had received the compost extract for 21 days. These samples were stored at −20°C until use. To isolate the bacteria, serial dilutions of the caecal contents were performed in a 0·9% w/v NaCl solution, and 100 μl of the 10−1 to 10−6 dilutions was plated on both nutrient agar plates (Eiken Chemical Co. Ltd, Tokyo, Japan) and heart infusion agar plates (Eiken Chemical). The plates were incubated at 37°C for 2 days under aerobic conditions. When bacteria in the caecal contents were isolated under anaerobic conditions, serial dilutions were plated on a General Anaerobic Medium (GAM) agar medium (Nissui Pharmaceutical, Co. Ltd, Tokyo, Japan). The plates were anaerobically incubated at 37°C for 2 days.

To isolate the bacteria from the compost extract, 100 μl of a 10−2 dilution in autoclaved water was plated on heart infusion agar plates (Eiken Chemical). The plates were incubated at 37°C for 2 days under aerobic conditions.

Gram staining was performed according to the method of Hucker (1921). Spore staining was performed using the method of Schaeffer and Fulton (1933). Cell morphology was observed using a light microscope (Olympus Co. Ltd, Tokyo, Japan).

Sequence analysis of the 16S rRNA genes

The 16S rRNA genes from caecal isolates selected at random were amplified by colony PCR with the following universal primers: 27F and 1492R (for Brevundimonas- and Sphingomonas-related bacteria) and 27F and 1525R (for Bacillus-related bacteria) (Lane 1991). The PCR mixture contained 25 μl 2 × GoTaq Hot Start Colorless Master Mix (Promega Co., WI, USA), 2 pmol of each primer, an aliquot of bacterial cells and distilled water to make up a final volume of 50 μl. Amplification was performed using an initial cycle at 94°C for 15 min, 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 90 s, and one final cycle at 72°C for 7 min. The approximately 1·5-kb PCR fragments were purified with a QIAquick PCR Purification Kit (Qiagen GmbH, Germany). Sequence analysis was carried out with a BigDye Terminator Cycle Sequencing Kit and an automated DNA analyser system (Applied Biosystems Inc., CA, USA).

The 16S rRNA regions of the bacteria isolated from the compost extract were amplified using colony PCR with the universal primers 27F and 1492R, following the protocol described in the previous paragraph.

The 16S rRNA fragments from one of the strains (N-11, which is related to Bacillus thermoamylovorans) were amplified using the 27F and 1525R primers. The resulting 1·5-kb PCR products were cloned into the pGEM-T Easy vector (Promega), and the inserts from 14 independent clones were sequenced.

Operational taxonomic units (OTUs) were defined as groups of strains whose 16S rDNA sequences shared 97% or greater similarity (McGarvey et al. 2004). Multiple alignments of the sequences were performed using the software package Genetyx-MAC ver. 15. Phylogenetic dendrograms were constructed using the neighbour-joining method (Saitou and Nei 1987), and evolutionary distances were calculated using the Kimura two-parameter model (Kimura 1983). The tree topology was evaluated using bootstrap analysis (Felsenstein 1985) based on 1000 replicates. The nucleotide sequences for the representative isolates (shown in Tables 1 and 3) have been deposited in the GenBank database.

Cultivation of two bacterial isolates

Two strains (N-11 and N-16) were cultured in heart infusion broth (Eiken Chemical) overnight at 37°C. The bacteria were washed three times with 0·9% NaCl, resuspended in 0·9% NaCl with 10% (v/v) glycerol and stored at −80°C until use. Serial dilutions of the thawed bacterial suspension were spread onto heart infusion agar plates and cultured at 37–55°C overnight, and the number of colony-forming units (CFU) was counted.

Administration of isolated bacteria to conventional mice

Male, 3-week-old, BALB/c mice were purchased from Kyudo Co. Ltd (Saga, Japan) and fed a pelleted commercial diet (CMF; Oriental Yeast Co. Ltd) for 5 days. The mice were housed in a room on a 12 h:12 h light: dark cycle at 24 ± 2°C and with a relative humidity of 50 ± 10%. All animal treatments followed the guidelines for the care and use of laboratory animals at National Fisheries University. After acclimatization, these conventional mice were divided into five groups. The control group of six mice received potable water, and another group of six mice received potable water containing 1·0% (v/v) compost extract. Three other groups, each consisting of four mice, received potable water containing isolated bacteria (N-11, N-16 and a 1 : 1 mixture of N-11 and N-16). The concentration of bacteria was adjusted to 102–103 CFU ml−1 of potable water. The mice received water ad libitum for 84 days.

Analysis of serum components and faeces

Blood was collected from individual mice at the end of the feeding test, and the serum was divided and stored at −80°C. Aspartate amino transferase (AST or GOT), alanine aminotransferase (ALT or GPT) and alkaline phosphatase (ALP) in the serum were analysed with a BioMajesty JCA-BM6050 (JEOL Ltd, Tokyo, Japan) according to the manufacturer's instructions (Mitsubishi Chemical Medience, Co. Ltd, Tokyo, Japan). The moisture content of the faeces was calculated by a comparison of weights of the freeze-dried and fresh samples. In addition, the hidden blood in the faeces was observed.

Analysis of faecal immunoglobulins

Fresh faeces in the small intestine, caecum and colon were collected from individual mice at the end of the feeding test and stored at −80°C. Frozen fresh faeces were quickly dissolved in phosphate-buffered saline (PBS) containing 0·01% sodium azide and centrifuged at 2500 g for 10 min. The faecal immunoglobulins in the resulting supernatants were determined using an enzyme-linked immunosorbent assay (ELISA) kit for IgA, IgG and IgM according to the manufacturer's instructions (Bethyl Laboratories, Inc., Montgomery, TX, USA). The concentrations of immunoglobulins per fresh weight of faeces were determined.

Statistics

All data are shown as mean ± SEM. Statistical analyses were performed by anova, and significant differences among individual groups were compared by Fisher's PLSD.

Results

Establishment of gnotobiotic mice

To prepare gnotobiotic mice, germ-free mice were fed autoclaved water or water containing 0·5% (v/v) compost extract for 21 days; thus, a compost group harboured a limited bacterial population, which was enriched with thermophilic bacteria. The germ-free mice had enlarged caeca, as frequently reported in other studies (e.g. Reikvam et al. 2011). Ingestion of compost extract caused visible changes to the internal organs, such as caecum size reduction and changes in the colour of the organs and caecal contents (Fig. 1). The moisture contents of material in the caeca and intestines were similar in the germ-free and gnotobiotic mice, and none of the tested mice showed hidden blood (see Table S1). Macroscopically, the sizes of Payer's patches in the gut of the gnotobiotic mice much more developed than those of control germ-free mice. Most IgA-producing plasma cells are derived from precursor B cells in the Payer's patches (Mestecky and Elson 2008), and commensal bacteria stimulate IgA production (Macpherson and Uhr 2004). Faecal IgA acts as the gut immunological barrier against ingested pathogens (Holmgren 1991; Brandtzaeg 2007). In addition, oral administration of the compost extract to the rodents increased faecal IgA concentrations (Satoh et al. 2012). Therefore, the levels of faecal IgA in the germ-free and gnotobiotic mice (Fig. 1a,b) were determined. The concentrations of faecal IgA from the gnotobiotic mice were significantly higher than those of germ-free control mice (< 0·05) (Fig.1c). These observations suggested that some bacterial habitants in the compost extract stimulated the intestinal IgA secretion in the gut.

Figure 1.

The germ-free and the gnotobiotic mice administered with the compost extract. Abdominal photographs of germ-free (a) and limited-flora mice (administered with compost extract) (b) are shown. Faecal IgA levels in the colon (c) of the germ-free or the gnotobiotic mice are shown. The ‘GF’ in the x-axis indicates the data in the germ-free mice, while ‘Compost’ in the x-axis indicates those in the gnotobiotic mouse, which had been orally administered with the compost extract. All data are expressed as mean ± SE (n = 5). *< 0·05 (vs GF).

Bacterial isolates from the caeca

To isolate potential probiotic bacteria from the gastrointestinal tracts of compost-fed mice, the diluted caecal contents of two gnotobiotic mice and two control mice were cultured on nutrient agar plates or heart infusion agar plates at 37°C under aerobic conditions. The number of culturable bacteria in the caeca of the compost-treated mice was 1·5 × 107 CFU g−1 for mouse no. 1 (FW of caecal contents) and 5 × 106 CFU g−1 for mouse no. 2. No bacterial colonies were isolated from the caecal contents of the control mice.

Thirty bacterial isolates were used for colony PCR amplification of a 1·5-kb 16S rRNA gene fragment. The resulting sequences were classified into four OTUs. Representative strains for each of the four OTUs were designated N-11 (OTU-1), N-16 (OTU-2), N-24 (OTU-3) and H-14 (OTU-4) (Table 1). OTU-1 consisted of 16 isolates with <0·1% nucleotide variation in the 16S rRNA sequences. The closest relative to OTU-1 was a moderately thermophilic bacterium, B. thermoamylovorans LMG 18084T (Fig. 2). The eight strains in OTU-2 shared a common 16S rRNA sequence and were closely related to Bacillus coagulans ATCC 7050T (Fig. 2). The OTU-3 and OTU-4 isolates were most closely related to Brevundimonas vesicularis LMG 2350T and Sphingomonas mucosissima CP173-2T, respectively (Table 1).

Table 1. Phylogenetic affiliation of a total of 30 isolates from the cecal contents of the limited-flora mice
OTUNumber of isolates

Representative straina

(deposit number)

Closest relative
 Accession no.Identity (%)Phylogenetic tree
  1. The mark of superscript ‘T’ means the type culture.

  2. a

    A total of 30 cecal isolates were classified into four OTU groups based on their 16S rRNA sequences, and each representative strain was compared with the closest relative.

  3. b

    The 16S rRNA sequences of the 16 isolates showed 99·9–100·0% identity with an isolate, N-11.

  4. c

    All isolates shared a common 16S rRNA sequence.

116bN-11 (AB618491)Bacillus thermoamylovorans LMG 18084T L27478 99·5Figure 1
28cN-16 (AB618492)Bacillus coagulans ATCC 7050T DQ297928 99·5Figure 1
33cN-24 (AB618493)Brevundimonas vesicularis LMG 2350T AJ227780 99·7
43cH-14 (AB618494)Sphingomonas mucosissima CP173-2T AM229669 98·4
Figure 2.

Neighbour-joining phylogenetic tree comparing isolates with species of the genus Bacillus. Bootstrap values (percentages of 1000 replications) >50% are shown at nodes. Bar = 0·01 nucleotide substitutions per site. The sequence of Brevibacillus brevis JCM 2503T was used as the outgroup.

PCR primer sets specific for these four OTUs were designed to identify the bacteria isolated from the caecal contents of the gnotobiotic mice (Table 2). These primer sets amplified partial fragments of the 16S rRNA genes from each of the representative strains, but not from unrelated strains (Fig. S1). A total of 213 colonies from limited-flora mouse no. 1 and 92 colonies from limited-flora mouse no. 2 were screened by PCR with the specific primer sets (Fig. 3a). Interestingly, bacteria belonging to these four OTUs accounted for almost all of the culturable bacteria present in the caeca of both mice.

Table 2. PCR primers specific to several strains found in this study
Target strainClosest relativePrimerSequence (5′ to 3′)
N-11 Bacillus thermoamylovorans AmyFGGTGCTAATACCGGATAGATTATCTT
AmyRTACCGGCATTTCCTCCGAT
N-16 Bacillus coagulans CoaFGGCTAATACCGGATAGTTTTTTCC
CoaRCGCCGCCCTGTTCGAACGGC
N-24 Brevundimonas vesicularis BreFCCGGATGTGCCCTTCGGGGG
BreRGATCTCTCTGGCGGTCCGGG
H-14 Sphingomonas mucosissima SphFCCGGATGATGACGTAAGTCC
SphRATCTCTGGAAGCCGTCCTAC
IP-95 Bacillus ruris RurFCTAAAGGGAGCTTGCTCCCG
RurRCGCCCTATCTCTAGGGTTG
Figure 3.

Identification of the culturable bacteria in the caecal contents of two independent gnotobiotic mice. (a) Identification of bacteria cultured under aerobic condition. (b) Identification of bacteria cultured under anaerobic conditions. The graph shows the percentage of colonies for which PCR products were obtained using specific primer sets for Bacillus thermoamylovorans (A), Bacillus coagulans (B), Brevundimonas vesicularis (C) and Sphingomonas mucosissima (D). (E) Bacteria from which any amplified fragments with any of the primer sets were not obtained. The total number of colonies tested for each limited-flora mouse is also shown.

We also investigated the culturable anaerobic bacteria in caeca. In the gnotobiotic mice, there were 8 × 105–1·1 × 10CFU g−1 FW of caecal contents. A total of 98 colonies from the gnotobiotic mouse no. 1 and 67 colonies from limited-flora mouse no. 2 were screened using the specific primer sets for OTUs 1–4 (Table 2). The predominant bacteria grown under anaerobic conditions were relatives of B. thermoamylovorans and B. coagulans (Fig. 3b). No bacteria related to OTU-3 or OTU-4 were detected by PCR, and these two bacteria did not grow under anaerobic conditions (data not shown). The six other colonies in Fig. 3b did not produce PCR-amplified fragments.

Growth of the isolates at high temperature

It was expected that most bacteria in the compost extract would be thermophilic (Niisawa et al. 2008). The N-11 (related to B. thermoamylovorans) and N-16 strains (related to B. coagulans) grew abundantly at 50–55°C rather than at 37°C, while the other two strains, N-24 (related to B. vesicularis) and H-14 (related to S. mucosissima), did not grow at 46°C. Therefore, we concluded that strains N-24 (OTU-3) and H-14 (OTU-4) were mesophilic. In fact, these mesophilic bacteria were absent from several samples of compost extract, suggesting that they were environmental contaminants (data not shown).

Bacterial communities in the compost extract

Two thermophilic bacterial species (OTU-1 and OTU-2) were major constituents of the caecum microbiota; therefore, we asked whether these two strains were the predominant bacteria in the ingested compost extract. In preliminary studies, partial 16S rRNA PCR fragments were amplified from 20 colonies cultured from the compost extract. Of these isolates, 15 were classified into one group (OTU-5 in Table 3). Strain IP-95, a representative of OTU-5, demonstrated a strong similarity to Bacillus ruris LMG 22866T (99·9% identity; Fig. 2). A primer set was designed to distinguish this predominant bacterium from other bacteria (Table 2, Fig. S1).

Table 3. Phylogenetic affiliation of isolates from the compost extract
OTUNumber of isolates

Representative strain

(deposit number)

Closest relative
 Accession no.Identity (%)Phylogenetic tree
  1. The mark of superscript ‘T’ means the type culture.

  2. a

    The 16S rRNA sequences of a total of 20 isolates were preliminarily determined, and 15 of them shared a common sequence.

  3. b

    A total of 104 colonies were subjected to species-specific PCR analyses; 77 colonies were related to B. ruris, two colonies were related B. thermoamylovorans and B. coagulans, respectively, and remaining 25 colonies were further analyzed. The 16S rRNA sequences were successfully amplified from 15 of 25 colonies and then classified into the OTUs 6 to 12.

  4. c

    The 16S rRNAs showed 98·3–100% similarity to a representative strain, IP-95.

  5. d

    The 16S rRNAs shared a common sequence.

  6. e

    The 16S rRNAs showed 97·5–100% similarity to a representative strain, IP-23.

5a15a,cIP-95 (AB618495)Bacillus ruris LMG 22866T AJ535639 99·9Figure 1
6b2dIP-2 (AB618496)Bacillus badius NBRC 15713T AB271748 97·3Figure 1
7b2dIP-14 (AB618497)Bacillus fortis LMG 22079T AY443038 99·7Figure 1
8b6eIP-23 (AB618498)Lysinibacillus xylanilyticus KCTC 13423T FJ477040 97·4Figure S2
9b2dIP-9 (AB618499)Virgibacillus pantothenticus IAM 11061T D16275 99·5Figure S3
10b1IP-3 (AB618500)Anoxybacillus kamchatkensis DSM 14988T AF510985 99·5Figure S4
11b1IP-60 (AB618501)Paenibacillus timonensis CIP 108005T AY323610 96·9Figure S5
12b1IP-75 (AB618502)Paenibacillus curdlanolyticus IFO 15724T D78466 94·6Figure S5

A total of 104 colonies from the compost extract that grew in aerobic conditions were randomly selected and subjected to species-specific PCR analyses. Bacteria related to B. thermoamylovorans, B. coagulans and B. ruris were discriminated from other bacteria. While only one B. thermoamylovorans relative and one B. coagulans relative were found, 77 colonies were related to B. ruris. These results indicate that B. coagulans- and B. thermoamylovorans-related bacteria comprise approximately 1% of the culturable bacteria in the compost extract. Similar results were obtained from another lot of the compost extract (data not shown).

The remaining 25 isolates were further analysed by PCR amplification of the 16S rRNA sequences. Amplified fragments were obtained from 15 isolates, while PCR of the remaining 10 isolates produced no fragments. The 15 PCR-positive isolates were classified into the seven OTUs, and their closest relatives are listed in Table 3. All bacteria were classified into the Bacillus or Bacillus-related genera, namely Lysinibacillus, Virgibacillus, Anoxybacillus or Paenibacillus. The phylogenetic position of each representative for Bacillus sp. is shown in Fig. 2, and the positions for bacteria from Bacillus-related genera are shown in Figs S2–S5.

Administration of N-11 and N-16 bacteria to the conventionally maintained mice

We determined the effects of long-term administration of two bacterial strains, N-11 and N-16, on the growth of conventional mice. These bacteria were minor constituents of the compost extract. We hypothesized that if they acted as probiotics, health benefits would be observed in the mice that received very small doses of these bacteria. Mice received water containing these bacteria at relatively low concentrations (100 to 1000 CFU ml−1) or water supplemented with 1% (v/v) compost extract for 84 days. At the end of breeding period, the moisture contents of caecal and intestinal materials indicated that diarrhoea had not occurred in any tested group, and faecal hidden blood was not observed (Table S2). The mice fed N-11 and/or N-16 bacteria weighed nearly the same as the control group, although the mice fed N-11 had a slight increase in body weight compared with the other groups (Fig. S6). This slight increase in body weight was associated with better feeding efficiency in the N-11 mouse group (Table S3). During the first 21 days of the test, the feeding efficiency of mice administrated with N-11 and mice with a mixture of N-11 and N-16 (1:1) was higher than that of the control mice. The final feeding efficiency calculated at 84 days was higher in the N-11 group than in the groups fed N-16 or the N-11/N-16 mixture. Such a tendency was reproducibly observed in the other experiments (data not shown).

Under these conditions, the faecal immunoglobulin levels of these mice were analysed. As seen in Fig. 4, the faecal IgA concentrations in the colon of the mice group administrated with the compost extract had a tendency to be greater than those of untreated control mice (< 0·1). Increases in faecal IgA level in the colon were also observed in the mice administrated with N-11 and/or N-16 (< 0·1). In particular, mice administered a mixture of N-11 and N-16 (1:1) showed significant differences (< 0·05). Thus, the isolated thermophilic bacteria in the compost extract influenced the feeding behaviours of their mammalian hosts and stimulated IgA production in the gut.

Figure 4.

Faecal IgA levels in the conventionalized mice. The faecal IgA concentrations in the colon are shown. The ‘Conv’ in the x-axis indicates the data in the conventional mice not administered with the following materials. The ‘Compost’ in the x-axis indicates the data in the mice administered with the compost extract. The ‘N11’, ‘N16’ and ‘N11 + N16’ in the x-axis indicate the data in the mice administered with the isolated N11, N16 and the mixture of N11 and N16, respectively. All data are expressed as mean ± SE (n = 4). *< 0·05 (vs Conv).

Discussion

Bacillaceae bacteria are abundant in the compost during the thermophilic fermentation stage, but they disappear during the maturation stage of most composting processes (Ishii and Takii 2003; Takaku et al. 2006). The compost used here was enriched with thermophilic Bacillaceae (Niisawa et al. 2008). In this report, several strains of thermophilic bacteria were isolated from compost, and these bacteria colonized the gastrointestinal tract and regulated the production of intestinal IgA in the host and/or feeding efficiency.

Bacillus thermoamylovorans was first isolated from palm wine (Combet-Blanc et al. 1995a), and its description was recently amended (Coorevits et al. 2011). The N-11 strain shares similar characteristics to the updated description of a spore-forming, moderately thermophilic, Gram-positive, rod-shaped facultative anaerobe. Bacillus thermoamylovorans is frequently found in high-temperature environments such as dairy farms (Scheldeman et al. 2005; Coorevits et al. 2008), commercial gelatin products (De Clerck et al. 2004) and recycled water from a paper mill (Öqvist et al. 2008). This bacterium has been detected in several composting products, especially during the thermophilic stage (Wang et al. 2003; Nakamura et al. 2004). Previously, 16S rRNA sequences similar to B. thermoamylovorans were detected in a library prepared from the same compost used in this report (Niisawa et al. 2008). This report is the first description of a bacterial species closely related to B. thermoamylovorans growing in the mammalian gastrointestinal tract. Interestingly, B. thermoamylovorans isolated from palm wine produces glucose fermentation products similar to those of the lactobacilli (Combet-Blanc et al. 1995a,b), suggesting an important common function of probiotics.

First described as Bacillus thermoacidurans (Berry 1933), B. coagulans was subsequently renamed (Becker and Pederson 1950). This bacterium, like strain N-16, is a spore-forming, moderately thermophilic, Gram-positive, rod-shaped cell (Jung et al. 2009). Bacillus coagulans has been isolated from milk products (Chopra and Mathur 1984), gelatin (De Clerck et al. 2004), a paper mill factory (Öqvist et al. 2008), hot spring water (Alkan et al. 2007) and sewage sludge (Kotay and Das 2007). This bacterium is active in the intestine, and it has been investigated for its effects on irritable bowel syndrome (Dolin 2009; Hun 2009). As a dietary additive, B. coagulans improves the feed conversion ratio of chickens and pigs (Cavazzoni et al. 1998; Adami and Cavazzoni 1999).

The compost extract contained 105–106 CFU ml−1 of culturable bacteria. This extract was diluted to a final concentration of 0·5% (v/v) before its administration to germ-free mice. Assuming their daily water intake was approximately 6 ml (according to the ), the total number of bacteria ingested per day was between 3 × 103 and 3 × 10CFU per mouse. Because 1% of the compost bacteria were related to B. thermoamylovorans and B. coagulans, mice ingested approximately 30–300 cells of these two species daily. Notably, one gram of caecal contents contained 5 × 106 (mouse no. 2) and 1·5 × 107 (mouse no. 1) of culturable bacterial cells. As illustrated in Fig. 3, B. thermoamylovorans- and B. coagulans-related bacteria represented 52% and 15%, respectively, of the culturable bacteria in the caecum of mouse no. 2. Because mice excrete an average of 1·4 to 2·3 g of faeces per day (Gibbons and Kapsimalis 1967), we estimate that mouse no. 2 shed 3·6 × 106 bacteria related to B. thermoamylovorans and 1·1 × 106 bacteria related to B. coagulans daily. The similar approximation for mouse no. 1 is 2·5 × 106 bacteria related to B. thermoamylovorans and 1·5 × 107 bacteria related to B. coagulans per day. Such a tendency was also observed in the other germ-free mice after the ingestion of compost (data not shown). These estimates suggest that the two strains flourished in the gastrointestinal tracts of gnotobiotic mice.

We have shown that the culturable microbes in compost extracts are mostly Bacillus and Bacillus-related genera. Although most of the bacterial species listed in Table 3 can form endospores, the bacteria that thrive in the gastrointestinal tract are markedly limited. Traits other than sporulation, such as tolerance for a low pH, bile and pancreatic enzymes, may be characteristic of probiotics. The two thermophilic bacterial species related to B. thermoamylovorans and B. coagulans were highly adaptable to the gastrointestinal environment.

The physiological functions of the isolated bacteria were investigated here. The visible changes in Payer's patches in the gnotobiotic mice and their levels of faecal IgA suggested the activation of intestinal immune systems (Fig. 1). However, the concentrations of IgG and IgM in the faeces from the gnotobiotic mice remained at low levels, as was observed in the control mice (data not shown).

Moreover, in the conventionally maintained mice, an oral administration of the compost extract as well as the two isolated bacteria appeared to stimulate IgA production (Fig. 4), but not IgG and IgM (data not shown). These results indicated that the two bacterial species isolated from the compost extract can modulate a function of the gut, in particular stimulation of the intestinal IgA secretion, without gastrointestinal damage. These observations were consistent with data from rats orally administered with the compost extract (Satoh et al. 2012). The two isolated bacteria could be candidates from the compost extract that trigger the IgA production in the gastrointestinal tract. In addition, to investigate whether these bacteria negatively affected the host's health, blood levels of AST, ALT and ALP were determined as indices of hepatocellular injury (Table S4). These indices suggested that hepatocellular damage did not occur in the mice given the isolated bacteria.

Finally, it is interesting from the viewpoint of livestock management that a strain related to B. thermvoamylovorans, which can be included in the compost used as a feed additive (Tanaka et al. 2010; Miyamoto et al., 2011), possibly modulates nutrient utilization as described here. For example, in the management of swine farms, an improvement in the pigs' feeding efficiency is important. In large-scale farms, a slight improvement in feeding efficiency could drastically decrease the cost of breeding. Thus, as the isolated thermophilic bacteria, the N-11 strain, in the compost extract appeared to be improving the feeding behaviours of the mammalian hosts, the N-11 strain may be a novel type of probiotic bacterium that could increase the body weight of livestock animals. Current and future studies of the thermophile-fermented compost extract and the bacteria isolated in this study will elucidate the physiological mechanisms by which these microbes regulate the mammalian physiological response.

Acknowledgments

This research was supported by a Grant-in-Aid from the Chiba City Foundation for the Promotion of Industry. T.N. was a recipient of MEBIOS, the Medical Biologist Support programme in Keio University, and this programme is supported by the Ministry of Education, Culture, Sports, Science and Technology in Japan. We thank Mr Kazuo Ogawa and Mr Toshiyuki Itoh (Keio Plant Engineering Co. Ltd, Chiba, Japan) for sampling the compost extracts from the poultry and swine farms. We also thank the following farms for supplying of the compost extract: Chiba-egg Farm, Hirano Swine Farm, Pig fertilized Matsugaya, Yabe Swine Farm and Yamada Poultry Farm. We also thank Prof. Makoto Suematsu, MD, PhD (Keio University), for excellent advice.

Ancillary