Optimal place of a foreign gene in the genome of viral haemorrhagic septicaemia virus (VHSV) for development of VHSV-based viral-vectored vaccines

Authors


Correspondence

Ki Hong Kim, Department of Aquatic Life Medicine, Pukyong National University, Nam-gu 599-1, Busan 608-737, Korea. E-mail: khkim@pknu.ac.kr

Abstract

Aim

As the strength and duration of immune responses can be regulated by the antigen dose, higher expression of foreign antigens in the viral-vectored vaccines would be an important factor for inducing effective immune responses. The aim of this study was to determine the optimal insertion place of a foreign antigen gene in the genome of viral haemorrhagic septicaemia virus (VHSV) for development of VHSV-based viral-vectored vaccines.

Methods and Results

Recombinant VHSVs (rVHSVs) harbouring the red fluorescent protein (RFP) gene between N and P (rVHSV-A-RFP), P and M (rVHSV-B-RFP), or M and G genes (rVHSV-C-RFP) in the genome were rescued by reverse genetics. Their replication ability and expression level of RFP were compared according to the inserted locations. The viral titres of each rVHSV were not significantly different. However, Epithelioma papulosum cyprini (EPC) cells infected with rVHSV-A-RFP or rVHSV-B-RFP showed clearly higher fluorescence than cells infected with rVHSV-C-RFP. There was no significant difference in RFP expression between cells infected with rVHSV-A-RFP and rVHSV-B-RFP.

Conclusions

The present results indicate that insertion of a foreign gene between N and P, or P and M genes of VHSV genome would be advantageous for development of VHSV-based viral-vectored vaccines.

Significance and Impact of the study

The present work is the first report on the optimal location of a foreign gene in VHSV genome for high expression, and the locations identified in this study would be suitable for the development of VHSV-based viral-vectored vaccines.

Introduction

Viral haemorrhagic septicaemia virus (VHSV) is an enveloped, negative-stranded RNA virus belonging to the family Rhabdoviridae and the genus Novirhabdovirus (Tordo et al. 2004). VHSV infection is associated with a highly contagious and fatal disease in farm-reared freshwater and marine fish worldwide (Schlotfeldt and Ahne 1988; Schlotfeldt et al. 1991; Mortensen et al. 1999; Isshiki et al. 2003; Skall et al. 2005). Various prophylactic vaccines against VHSV have been reported to induce protective immune responses, including subunit vaccine (Lorenzen et al. 1993; Lecocq-Xhonneux et al. 1994), naturally attenuated vaccine (Vestergaard-Jorgensen 1976; de Kinkelin and Bearzotti-Le Berre 1981; Adelmann et al. 2008) and genetic vaccine (Heppell et al. 1998; Lorenzen et al. 1998, 1999, 2002; Byon et al. 2005, 2006; Chico et al. 2009). In recent years, recombinant RNA viruses generated by reverse genetics have been exploited to investigate the function of viral genes and to develop attenuated viral vaccines (Schnell et al. 1994; Palese et al. 1996; Neumann et al. 2002; von Messling and Cattaneo 2004; Neumann and Kawaoka 2004). In fish, reverse genetics was used to produce recombinant viruses of the following three novirhabdoviruses and their potential as effective prophylactic vaccines has been demonstrated – snakehead rhabdovirus (SHRV) (Johnson et al. 2000), infectious haematopoietic necrosis virus (IHNV) (Biacchesi et al. 2000, 2002; Romero et al. 2005, 2011; Ammayappan et al. 2010a) and VHSV (Ammayappan et al. 2010b; Biacchesi et al. 2010; Kim and Kim 2011; Kim et al. 2011a,b).

In mammals, the reverse genetic technology has also been utilized to generate viral-vectored vaccines that contain protective antigens of other pathogens (Mebatsion et al. 1996; Schnell et al. 1996; Draper and Heeney 2010). The use of attenuated viruses for delivery of a foreign antigen has advantages that the heterologous antigen is expressed in the host cell's cytoplasm using host's translational tools and the newly generated attenuated viruses including the foreign protein can be exposed to extracellular environment if the antigen is on the viral surface, thereby efficiently inducing the class I major histocompatibility complex (MHC-I)-mediated cellular immune response that is essential for clearance of intracellular pathogens (Ahmed and Gray 1996), as well as MHC-II-mediated humoral immune response. Previously, we demonstrated that immunization of fish with a recombinant VHSV that had another hirame rhabdovirus (HIRRV) G gene in front of the VHSV G gene in the genome results in the induction of serum neutralization activity against both HIRRV and VHSV (Kim and Kim 2012), suggesting a high availability of the recombinant VHSVs as viral-vectored vaccines.

As the strength and duration of immune responses can be regulated by the antigen dose (Zinkernagel et al. 1997; Rollenhagen et al. 2004), higher expression of foreign antigens in the viral-vectored vaccines would be an important factor for inducing effective immune responses. Although there have been some reports on the expression of heterologous genes in the recombinant VHSVs (Ammayappan et al. 2010b; Biacchesi et al. 2010), no information is available on the differences in expression level of the heterologous gene according to its inserted location in the viral genome. Therefore, in this study, we have generated recombinant VHSVs harbouring the red fluorescent protein (RFP) gene between N and P, P and M, or M and G genes and compared their replication ability and the expression level of RFP according to the inserted location.

Materials and methods

Cells and viruses

The wild-type virus used in this study was VHSV KJ2008 isolated in 2008 from moribund olive flounder in a natural outbreak of VHS disease on a commercial farm in Korea. Viruses including wild-type VHSV and the following recombinant VHSVs were propagated on Epithelioma papulosum cyprini (EPC) cells that were cultured in Leibovitz medium (L-15; Sigma, St Louis, MO, USA) supplemented with penicillin (100 U ml−1), streptomycin (100 μg ml−1) and 2% foetal bovine serum (FBS; Gibco, Carisbad, CA, USA). Cultures displaying extensive cytopathic effect (CPE) were harvested and centrifuged 4000 g for 10 min at 4°C, and the supernatants were filtered with a 0·45 μm syringe filter (Advantec, Dublin, CA, USA) and stored at −80°C.

Construction of rVHSV cDNA vectors harbouring RFP gene

First, to generate a recombinant VHSV-carrying RFP gene between N and P genes, (i) the 5′ and 3′ ends of the P gene ORF in the vector containing the fragment 1 corresponding to T7 promoter, N, P, M genes (pT7-NPM) were changed to have NdeI and SalI sites (pT7-NPM-1), respectively, by site-directed mutagenesis kit (SDM; Stratagene, La Jolla, CA, USA). The primers used for the mutagenesis were described in Table 1. The RFP gene ORF was PCR amplified using primers that have NdeI (forward) and SalI (reverse) sites, respectively. The VHSV P gene ORF in the vector pT7-NPM-1 was excised by digestion with NdeI and SalI. And then, the RFP gene ORF was inserted into the digested plasmid, resulting in pT7-N-RFP-M. (ii) The 3′ end of N gene ORF in the pT7-NPM was mutated to have SalI site by SDM, and named the vector as pT7-NPM-2. The pT7-NPM-2 vector was digested with SalI and AgeI, and then the digested fragment encoding P and M genes was ligated to the pT7-N-RFP-M vector that was digested with the same enzymes, resulting in pT7-N-RFP-PM. (iii) The pT7-N-RFP-M was digested with NaeI and AgeI, and the resulting fragment was ligated to the previously constructed pVHSV-wild vector (Kim et al. 2011a) that was predigested with the same enzymes, resulting in pVHSV-A-RFP.

Table 1. Summary of primers used in this study
Name of primerSequence (5′ to 3′)
  1. SDM, site-directed mutagenesis; RFP, red fluorescent protein; VHSV, viral haemorrhagic septicaemia virus.

For Site-directed mutagenesis
N-3′-SalI SDMFCCAGGGGACTCTGATTAAGTCGACCAAGCCTTTCCGTCTCATAA
RTTATGAGACGGAAAGGCTTGGTCGACTTAATCAGAGTCCCCTGG
P-5′-NdeI SDMFGCAAGACAAACACTGAGATCATATGATGACTGATATTGAGATGA
RTCATCTCAATATCAGTCATCATATGATCTCAGTGTTTGTCTTGC
P-3′-SalI SDMFGTTGGACAAGTTGGAGTAGGTCGACCACAACACATCGTACAGAT
RATCTGTACGATGTGTTGTGGTCGACCTACTCCAACTTGTCCAAC
M-5′-NdeI SDMFCCTCAGACAATCAACCACACATATGATGGCTCTATTCAAAAGAA
RTTCTTTTGAATAGAGCCATCATATGTGTGGTTGATTGTCTGAGG
M-3′-SalI SDMFCTCTGTCCGACCCCGGTAGGTCGACAAGGACTGACCCAGAGCCG
RCGGCTCTGGGTCAGTCCTTGTCGACCTACCGGGGTCGGACAGAG
M-3′-SacII SDMFCCTCTGTCCGACCCCGGTAGCCGCGGAAGGACTGACCCAGAGCC
RGGCTCTGGGTCAGTCCTTCCGCGGCTACCGGGGTCGGACAGAGG
G-5′-SacII SDMFCCAGAAGCCAGATGGTCTGAGCACACCCGCCTAAACCACCATAGTTTC
RGAAACTATGGTGGTTTAGGCGGGTGTGCTCAGACCATCTGGCTTCTGG
For RFP ORF amplification
RFP-F-NdeICATATGATGGCCTCCTCCGAGAACGTC
RFP-R-SalIGTCGACCTACAGGAACAGGTGGTGGCGG
RFP-F-AgeIACCGGTATGGCCTCCTCCGAGAACGTC
RFP-R-SacIICCGCGGCTACAGGAACAGGTGGTGGCGG
For confirmation of recombinant VHSVs
Seq-801F-NCCATGGGGGCGTTGAGGCTCAATG
Seq-1601F-PTCCTCAGGGTCCTCCAAACAGAAG
Seq-2401F-MCCAGGTCGATAAGATCTGCATGG
RFP-RCTACAGGAACAGGTGGTGGCGG

Second, to generate a recombinant VHSV-carrying RFP gene between P and M genes, the 5′ and 3′ ends of M gene ORF in the pT7-NPM vector were changed to have NdeI and SalI sites, respectively, and then the M gene ORF was substituted with the RFP ORF, resulting in pT7-NP-RFP-3. The same procedure used in the above pVHSV-A-RFP vector construction was exploited to construct pVHSV-B-RFP vector that contains RFP gene between P and M genes.

Third, to generate a recombinant VHSV-carrying RFP gene between M and G genes, (i) RFP gene ORF was PCR amplified using primers with AgeI (forward) and SacII (reverse) sites. The VHSV G gene ORF in the cDNA vector (pVHSV-wild) was excised by digestion with AgeI and SacII. And then, the RFP gene ORF was inserted into the digested plasmid, resulting in pVHSV-ΔG-RFP. (ii) By SDMs, nucleotides at the 3′ end of the G gene in the pVHSV-wild were changed not to digested with SacII, and a new SacII site was inserted into the 3′ end of the M gene ORF, and then digested with SacII and NarI. This digested fragment that contains G and NV genes was inserted into the pVHSV-ΔG-RFP that was predigested with the same enzymes, resulting in pVHSV-C-RFP.

Production of RFP-expressing recombinant VHSVs

EPC cells expressing T7 RNA polymerase (RNAP) were grown to about 80% confluence and transfected with a mixture of pVHSV-A-RFP (2 μg), pVHSV-B-RFP (2 μg), or pVHSV-C-RFP (2 μg) plus pCMV-N (500 ng), pCMV-P (300 ng) and pCMV-L (200 ng) using FuGENE HD (Promega, Madison, WI, USA) according to manufacturer's instructions. Transfected cells were incubated for 12 h at 28°C and shifted to 15°C. When total cytopathic effect (CPE) was observed, the cells were suspended by scratching the plates with a rubber policeman submitted to two cycles of freeze-thawing and centrifuged at 4000 g for 10 min. The resulting supernatant (named P0) was used to inoculate fresh EPC cells monolayer in a T25 flask at 15°C. At 7–10 days postinoculation, the supernatant (P1) was harvested, filtered with a 0·45 μm syringe filter, aliquoted and stored at −80°C.

Confirmation of recombinant VHSVs by RT-PCR

Total RNA was extracted from the supernatant P1 using RNAiso plus (Takara, Shiga, Japan) reagent. To synthesize first-strand cDNA, 1 μg of total RNA was incubated with 0·5 μl of random primer (0·5 μg ml−1, Promega) at 80°C for 5 min and further incubated at 42°C for 60 min in reaction mixture containing 2 μl of each 10 mmol l−1 dNTP mix (Takara), 0·5 μl of M-MLV reverse transcriptase (Promega) and 0·25 μl of RNase inhibitor (Promega) in a final reaction volume of 10 μl. The insertion of the RFP gene between N and P, P and M, M and G was confirmed by RT-PCR using three kinds of forward primers for N, P, M genes and a reverse primer for RFP (Table 1). The PCR products were analysed on a 1% agarose gel containing Midori Green Advanced DNA stain (NIPPON Genetics, Dueren, Germany) for visualization.

Plaque assay

To determine the titre of the RFP-expressing recombinant VHSVs, plaque assay was performed (Burke and Mulcahy 1980). Briefly, EPC cells were infected with serial dilutions (10−5 to 10−7) of the respective recombinant viruses for 1 h at 15°C. Thereafter, the inoculum was removed and the cells were overlaid with plaquing medium (0·7% agarose in L-15 containing 10% FBS and antibiotics). After 7–10 days of incubation to allow plaque formation, the cells were fixed by 10% formalin and stained with 3% crystal violet for 30 min at room temperature. After rinsing of the cells with distilled water, the plaque-forming units (PFU) were counted.

Measurement of RFP fluorescence of recombinant VHSVs

EPC cells (1 × 106cell/35 mm dish) were infected at a moi of 0·1 with the recombinant VHSVs and incubated at 15°C. At 4 days postinfection, cells were lysed in 0·1% Triton X-100 buffered with 0·1 mol l−1 Tris-HCl (pH 7·4), centrifuged at 8000 g for 10 min and then the supernatant containing soluble fraction was collected. RFP fluorescence was measured using Polarion fluorescent plate reader (Tecan, Männedorf, Switzerland). For each sample, the amount of total soluble protein was measured by BCA method to normalize the RFP expression across samples as fluorescent reading per mg soluble protein. Furthermore, the RFP expression was confirmed by AZ100 fluorescence microscope (NIKON, Tokyo, Japan).

To know the viral titre at the time of fluorescence measurement, another EPC cells were prepared and infected with the rVHSVs at the same moi, and then plaque assay was conducted at 4 days postinfection.

Statistical analysis

Data on fluorescent intensity and plaque number were analysed by the Student's t-test. Significant differences were determined at < 0·05.

Results

Generation of recombinant VHSVs harbouring RFP gene

To rescue recombinant VHSVs that are expressing RFP gene, mutant cDNA clones in which RFP gene was inserted between N and P (pVHSV-A-RFP), P and M (pVHSV-B-RFP), and M and G genes (pVHSV-C-RFP) were constructed (Fig. 1). EPC cells transfected with the vectors showed evident CPE. Production of each recombinant virus was confirmed by RT-PCR and plaque assay. In RT-PCR analysis, the bands corresponding to the N-RFP region in rVHSV-A-RFP, the P-RFP region in rVHSV-B-RFP and the M-RFP region in rVHSV-C-RFP were amplified (Fig. 2). In plaque assay to confirm the presence of infectious recombinant viruses, 5·6 × 106 PFU ml−1 for rVHSV-A-RFP, 9·5 × 106 PFU ml−1 for rVHSV-B-RFP and 5·2 × 107 PFU ml−1 for rVHSV-C-RFP were counted in cells inoculated with each P1 stock supernatant.

Figure 1.

Construction of the cDNA vectors harbouring red fluorescent protein (RFP) gene. The RFP gene ORF was inserted between N/P, P/M and M/G genes, thereby pVHSV-A-RFP (a), pVHSV-B-RFP (b) and pVHSV-C-RFP (c) vectors were constructed. The N gene is flanked upstream by the T7 RNA polymerase promoter (PT7), and the L gene is flanked downstream by hepatitis delta ribozyme (HdvRz) and T7 transcription termination sequence (T7Φ).

Figure 2.

Confirmation of the rescue of recombinant viruses by RT-PCR. Each of viral genomic RNA extracted from supernatants of cells infected with rVHSV-A-RFP (A), rVHSV-B-RFP (B) and rVHSV-C-RFP (C) was amplified by RT-PCR with forward primers specific for N, P, M and a reverse primer for RFP. PCR products were analysed on a 1% agarose gel containing Midori Green Advanced DNA stain. The marker is a l kb DNA ladder (Bioneer, Korea).

Comparison of replication ability and RFP expression level among recombinant VHSVs

There are no significant differences in PFU numbers among the three kinds of rVHSVs, when the plaque number was counted at 4 days postinfection (Fig. 3a). However, the fluorescence intensity of cells infected with rVHSV-A-RFP or rVHSV-B-RFP at 4 days p.i. was significantly higher than cells infected with rVHSV-C-RFP (Fig. 3b). The notably higher expression of RFP in cells infected with rVHSV-A-RFP or rVHSV-B-RFP was also confirmed by fluorescence microscopy (Fig. 3c).

Figure 3.

(a) Viral titres measured by plaque assay. Epithelioma papulosum cyprini (EPC) cells were infected with rVHSV-A-RFP, rVHSV-B-RFP or rVHSV-C-RFP at a moi 0·1. Plaque assay was conducted at 4 days after the infection. Values are mean ± standard deviation. (b) At 4 days postinfection, soluble protein was collected from EPC cells infected with rVHSV-A-RFP (A-RFP), rVHSV-B-RFP (B-RFP) or rVHSV-C-RFP (C-RFP) at a moi 0·1, and fluorescence intensity was measured using Polarion fluorescent plate reader (Tecan). Values are mean ± standard deviation. Different large and small letters on the bars represent significantly different at < 0·05. (c) The red fluorescence expressed from the EPC cells infected with rVHSV-A-RFP, rVHSV-B-RFP or rVHSV-C-RFP at a moi 0·1 was photographed under fluorescent microscopy.

Discussion

Viral haemorrhagic septicaemia virus genome contains six genes encoding the nucleocapsid protein (N), the phosphoprotein (P), the matrix protein (M), the glycoprotein (G), the nonvirion protein (NV) and the RNA-dependent RNA polymerase (L), which order is 3′-N-P-M-G-NV-L-5′ (Schütze et al. 1999). The present work sought to determine the optimal place of a foreign antigen gene in the VHSV genome for development of VHSV-based viral-vectored vaccines. We focused on two properties, replication ability of the recombinant VHSVs and expression level of a foreign antigen according to the inserted location of the foreign gene. In this study, we successfully rescued three kinds of recombinant VHSVs that contained a heterologous gene, RFP, between N and P, P and M, or M and G genes of the VHSV genome. Previously, Biacchesi et al. (2010) and Ammayappan et al. (2010b) generated rVHSVs-containing tdTomato reporter gene between N and P genes and EGFP reporter gene between P and M genes, respectively. However, little is known on the comparative expression level of the foreign gene and replication ability of the rVHSVs according to the location of the foreign gene. The plaque assay data presented here showed that the inserted location of the foreign gene did not significantly affect on the replication ability of the three rVHSVs, suggesting that VHSV genome may not be sensitive to the inserted location of a foreign gene in relation to viral replication.

To be more easily recognized by host's immune cells, the foreign antigen produced by viral vectors should be abundant in amount. Generally, in RNA viruses, transcriptional polarity of viral RNA polymerase results in a gradually less transcription of downstream genes (Wertz et al. 1998). This has been well corroborated from the mammalian rhabdovirus, viral vesicular stomatitis virus (VSV), in which the expression level of individual genes in the genome was gradually diminished in the order of the position of genes from 3′ end to 5′ end (Abraham and Banerjee 1976; Ball and White 1976; Iverson and Rose 1981). In this study, although the viral titres were not significantly different, rVHSVs-possessing RFP gene between N and P, and P and M genes showed clearly higher fluorescence than a rVHSV with RFP gene between M and G genes. Furthermore, the similar expression level between rVHSV-A-RFP and rVHSV-B-RFP in our results suggests that the promoter power of the M gene may be not inferior to that of the P gene of VHSV.

As far as we know, the present work is the first report on the optimal location of a foreign gene in VHSV genome for high expression, and the locations identified in this study might be suitable for the development of VHSV-based viral-vectored vaccines.

Acknowledgements

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 2011-0011027).

Ancillary