Bacillus amyloliquefaciens ssp. plantarum strains as potential protective starter cultures for the production of Bikalga, an alkaline fermented food

Authors


Correspondence

Clarisse S. Compaoré, Département Technologie Alimentaire (DTA/IRSAT/CNRST), Ouagadougou 03 BP 7047, Burkina Faso.

E-mail: compaclara@yahoo.fr

Abstract

Aims

To identify and screen dominant Bacillus spp. strains isolated from Bikalga, fermented seeds of Hibiscus sabdariffa for their antimicrobial activities in brain heart infusion (BHI) medium and in a H. sabdariffa seed-based medium. Further, to characterize the antimicrobial substances produced.

Methods and Results

The strains were identified by gyrB gene sequencing and phenotypic tests as B. amyloliquefaciens ssp. plantarum. Their antimicrobial activity was determined by the agar spot and well assay, being inhibitory to a wide range of Gram-positive and Gram-negative pathogenic bacteria and fungi. Antimicrobial activity against Bacillus cereus was produced in H. sabdariffa seed-based medium. PCR results revealed that the isolates have potential for the lipopeptides iturin, fengycin, surfactin, the polyketides difficidin, macrolactin, bacillaene and the dipeptide bacilysin production. Ultra-high-performance liquid chromatography-time of flight mass spectrometry analysis of antimicrobial substance produced in BHI broth allowed identification of iturin, fengycin and surfactin.

Conclusions

The Bacillus amyloliquefaciens ssp. plantarum exhibited broad-spectrum antifungal and antibacterial properties. They produced several lipopeptide antibiotics and showed good potential for biological control of Bikalga.

Significance and Impact of the Study

Pathogenic bacteria often occur in spontaneous food fermentations. This is the first report to identify indigenous B. amyloliquefaciens ssp. plantarum strains as potential protective starter cultures for safeguarding Bikalga.

Introduction

There is an increased interest in searching for bacteria with new antimicrobial properties that can be used as: (i) protective starter cultures for foods; (ii) as new probiotics or as producers of alternatives to existing antibiotics; (iii) against antibiotic resistant pathogenic bacteria (Guo et al. 2012). Bikalga is a traditional food condiment obtained by a spontaneous and alkaline fermentation of the plant H. sabdariffa seeds. It is widely used in Burkina Faso as a flavouring agent in soups and sauces and constitutes an affordable source of proteins (22–30%), lipids, carbohydrates, essential amino, fatty acids and vitamins (Bengaly et al. 2006). Bacillus subtilis group species are the main micro-organisms involved in the fermentation of H. sabdariffa seeds into Bikalga (Ouoba et al. 2008a). The spontaneous nature of the fermentation processes sometimes results in the occurrence of pathogenic and spoilage micro-organisms, leading to products that are unsafe and of varying quality (Ouoba et al. 2008b; Agbobatinkpo et al. 2013). In order to control the fermentation process, starter cultures producing antimicrobial compounds active against relevant pathogens and spoilage organisms could be used (Holzapfel 2002; Ouoba et al. 2007). Currently, no suitable starter cultures for Bikalga production have been developed.

Many studies have reported that the predominant Bsubtilis group species isolated from African alkaline fermented food products such as Soumbala, Netetu and Maari could exhibit potent antimicrobial effects towards harmful bacteria and fungi (Ouoba et al. 2007; Savadogo et al. 2011; Kaboré et al. 2012), though only a few of the antimicrobial substances produced were further identified (Savadogo et al. 2011; Kaboré et al. 2012).

Bacillus subtilis group species can produce a wide variety of antimicrobial compounds with different chemical structures including bacteriocins, bacteriocin-like substances (BLIS), polyketides and lipopeptide antibiotics (Zimmerman et al. 1986; Patel et al. 1995; Stein 2005; Abriouel et al. 2010). The bacteriocins (and BLIS) including, for example subtilin (Stein 2005), subtilosin A (Sutyak et al. 2008), ericin (Stein et al. 2002) and sublancin (Paik et al. 1998) are ribosomally produced. The antimicrobial activity of subtilosin, subtilin, ericin and sublancin has been reported against various Gram-positive and Gram-negative pathogens such as Bacillus cereus, Escherichia coli, Listeria monocytogenes and Staphylococcus aureus (Paik et al. 1998; Sutyak et al. 2008). A variety of nonribosomally produced lipopeptides grouped into three main families: surfactins/lichenysins, iturins/bacillomycins/mycosubtilins and fengycins/plipastatins are also produced by Bacillus subtilis group species (Ongena and Jacques 2008). These lipopeptides have been reported to have antifungal and antibacterial activity (Huang et al. 2007; Ongena and Jacques 2008; Cao et al. 2009). The primary structure and gene organization of the operons encoding peptide synthetases for the Bacillus cyclic lipopeptides surfactin (srf), plipastatin (pps), fengycin (fen), bacillomycin (bmy), iturin (itu) and mycosubtilin (myc) have been described (Tosato et al. 1997; Tsuge et al. 2001; Koumoutsi et al. 2004). Recently, based on the alignment of nucleic sequences of Adenylation and Thiolation domains, specific degenerated primers which could detect non-ribosomal peptide synthetase genes particularly involved in lipopeptide biosynthesis in Bacillus strains were designed (Tapi et al. 2010). Compared to chemical agents, lipopeptides are safer for the environment and several reports have described their valuable role in the use of Bacillus spp. strains as biocontrol agents of plant diseases (Ongena and Jacques 2008; Chen et al. 2009).

The aim of the present work was to investigate the antimicrobial activity against various fungi and food-borne bacterial pathogens of Bacillus spp. isolates belonging to the predominant Bacillus subtilis group spp. isolated from Bikalga; to biochemically characterize the antimicrobial compounds produced and to identify these compounds by using PCR and UHPLC-TOFMS techniques. Further, to test the antimicrobial activity production in a H. sabdariffa seed-based broth medium.

Materials and methods

Bacterial strains and growth conditions

Three aerobic spore formers previously identified by 16S rRNA gene sequencing as Bacillus subtilis (A4, I8, G3) (Ouoba et al. 2008a) were investigated. Target micro-organisms for the analysis of antimicrobial activities by the agar spot and agar well diffusion test described below were obtained from different sources (Table 1). One of the sensitive target organisms, Bacillus cereus NVH391-98 was used as indicator (highlighted in bold in Table 1), when analysing physical and chemical properties, and kinetics of antimicrobial substance production. Bacteria were maintained as stock cultures at −80°C in appropriate broth medium (brain heart infusion (BHI), Oxoid CM1135, Basingstoke, UK), or nutrient broth (Oxoid CM0001) supplemented with 20% (v/v) glycerol. The yeast were maintained in yeast glucose peptone broth made of 1% (w/v) bactopeptone (211677; Becton, Dickinson, Sparks, MD, USA), 1% (w/v) glucose (Merck 38291142, Darmstadt, Germany), 0·5% (w/v) yeast extract (Oxoid LP0021), pH 5·6 ± 2, while the moulds were maintained in malt extract broth (Oxoid CM0057) supplemented with 20% (v/v) glycerol. The Bacillus spp. isolates were grown in BHI broth at 37°C before use. Indicator organisms were propagated in appropriate media and temperature as indicated in Table 1.

Table 1. Inhibitory spectrum of Bacillus amyloliquefaciens ssp. plantarum A4, I8 and G3 in BHI medium as determined by agar spot test (*) and agar well diffusion test (**)
Target organismsMedia/Temp (°C)Inhibition zone (mm)
A4I8G3
*********
  1. –, no inhibition; +, 1 ≤ inhibition < 3 mm; ++, 3 ≤ inhibition < 5 mm; +++, 5 ≤ inhibition < 7 mm; ++++, inhibition ≥ 7; (p), partial, i.e inhibition zone was not totally clear; ND, not determined.

  2. †Origin and/or reference: (1): Culture collection of Copenhagen University; (2): Culture collection of London Metroplitan University; (3): Isolated from Fura; (4): Emetic food poisoning; (5): Stew (food poisoning); (6): Food poisoning, kindly provided by INRA, France; (7): Cooked chicken (food poisoning), Brazil; (8): Birthday cake (food poisoning), Brazil; (9): Cereulide producer isolated from Sonru; (10): Animal; (11): Cocoa beans; (12): Human; (13): Blood sample. a, b, c, d, e = references, a: Lund et al. 2000; b: Stenfors and Granum 2001; c:Agata et al. 1994; d: Thorsen et al. 2010; eLindegaard Pedersen et al. 2012.

  3. ‡BHI, brain heart infusion; NA, nutrient agar; YGP, yeast glucose peptone; PDA, potato dextrose agar.

Gram-positive
Bacillus cereus MADM 1291 (8)BHI/37++++++
Bacillus cereus MADM 1561 (7)BHI/37++++++
Bacillus cereus NVH391-98 (6)aBHI/37++++++++++++++
Bacillus cereus 007525 (5)bBHI/37+++++++
Bacillus cereus F4810-72 (4)BHI/37++++++
Bacillus cereus NC 7401 (4)cBHI/37++++++
Bacillus cereus Ba18H2 (9)dBHI/37++++++
Bacillus cereus F3752A/86 (2)BHI/37++++++
Bacillus cereus LMG13569 (2)BHI/37++++++++++
Listeria monocytogenes 057 (1)BHI/37++++++++
Listeria monocytogenes L028 (1)BHI/37+++++++++++
Listeria monocytogenes Scott A (1)BHI/37++++++++++++
Listeria monocytogenes NCTC 9863 (2)BHI/37+++++++++++++++++
Micrococcus luteus SKN 624 (1)NA/30+++++++++
Micrococcus luteus AT49732 (2)NA/30+++++++++
Staphylococcus aureus NCTC 10656 (2)BHI/37
Gram-negative
Salmonella Typhimurium SKN 1155 (10)BHI/37++++++++++++
Salmonella Typhimurium SKN 533 (1)BHI/37++++++++++++
Salmonella Typhimurium O:1036340P/t49 (2)BHI/37+
Salmonella Nigeria SKN 1160 (11)BHI/37+++(p)+++(p)+++(p)+
Salmonella Thompson SKN 565 (1)BHI/37++++++
Salmonella Oranienburg SKN 1157 (12)BHI/37+++++++
Salmonella Infantis SKN 557 (1)BHI/37++++++++
Salmonella Enteridis P 167807 (2)BHI/37+++
Yersinia enterocolitica 6A28 SKN 599 (1)BHI/37+++++++++++++++
Yersinia enterocolitica 8A30 SKN 601 (1)BHI/37++++++++
Yersinia enterocolitica BT3ST5,27 (2)BHI/37+++++++++++++++
Escherichia coli 81 nr.149 SKN 541 (1)BHI/37+++
Shigella dysenteria 370 (2)BHI/37+++++++++
Shigella flexneri USCC 2007 (2)BHI/37++++++
Fungi
Candida tropicalis (3)eYGP/30
Candida kefyr (3)eYGP/30
Candida krusei (3)eYGP/30
Candida albicans (13)YGP/30
Saccharomyces cerevisiae var. boulardii (1)YGP/30
Saccharomyces cerevisiae KVL 013 (1)YGP/30
Penicillium nordicum 101763 (1)PDA/25++ND+++ND++ND
Penicillium camenberti 112362 (1)PDA/25++ND++ND++ND
Penicillium commune 311.48 (1)PDA/25++ND+++ND++ND
Penicillium commune 341.59 (1)PDA/25++ND++ND++ND

DNA extraction

DNA for PCR was extracted by boiling 1 loopful of bacterial colony mass, obtained from an overnight culture grown at 30°C on Luria Bertani agar (5 g l−1 yeast extract, 10 g l−1 tryptone (Becton, Dickinson), 10 g l−1NaCl, 15 g l−1 Bacto Agar (Becton, Dickinson) in 250 μl Tris-EDTA-buffer pH 7·5 for 10 min. The cell debris was pelleted by centrifugation at 15 000 g for 10 min. The supernatant containing the DNA was transferred to a fresh Eppendorf tube and stored at 4°C.

Re-identification of the isolates

Re-identification of the Bacillus isolates was performed by gyrB gene sequencing (Wang et al. 2007) and by phenotypic tests, including growth in 4, 7 and 10% (w/v) NaCl in nutrient broth (Merck 1.05443.0500) at 30 and 37°C, and at 50°C on nutrient agar (Merck 1.05450.0500) to discriminate between B. amyloliquefaciens and B. methylotrophicus (Madhaiyan et al. 2010).

Screening for antimicrobial activity by agar spot and agar well diffusion assays

Antimicrobial activity as determined by agar spot assay

Inocula of the Bacillus spp. isolates A4, I8, G3 were prepared as follows: from BHI agar plates incubated for 24 h at 37°C, the isolates were subcultured under agitation for 18 h at 37°C in 10 ml of BHI broth, pH 7. The cultures were centrifuged at 5000 g for 10 min and the pellet re-suspended in 5 ml of sterile saline solution containing 8·5 g l−1 NaCl and 1·5 g l−1 bactopeptone, pH 7·0. The number of cells was estimated by microscopy using a counting chamber (Neubauer, Wertheim, Germany) and dilutions were made in sterile saline to obtain a rate of inoculation of 105 cells ml−1.

The target organisms were grown overnight (bacteria), 48 h (yeasts) or 10 days (moulds) in appropriate media and temperature as described in Table 1. For antimicrobial activity testing, 100 μl (about 107 CFU ml−1) of indicator was spread-plated on potato dextrose agar plates (213400; Becton, Dickinson) (only when testing for moulds inhibition) or mixed with 10 ml BHI agar (Oxoid CM1136) or nutrient agar or yeast glucose peptone agar [made of 1% (w/v) bactopeptone, 1% (w/v) glucose, 0·5% (w/v) yeast extract, 2% (w/v) agar (Oxoid LP0013), pH 5·6 ± 2] poured in a Petri dish and then allowed to solidify. Three microlitre of the Bacillus spp. inoculum (approximately 105 CFU ml−1) or 20 μl (for inhibition test against moulds) was spotted on the surface and the dish was incubated at the optimal temperature (as described in Table 1) of the indicator organism for 24 h (BHI agar and nutrient agar), 48 h (YGP agar) or 7 days (PDA). The presence of a clear zone around the spot was measured and the results reported in mm. The experiment was performed in duplicate on three or two (for moulds inhibition test) separate occasions.

Antimicrobial activity as determined by agar well diffusion method

Cell-free supernatants (CFS) were obtained by cultivating strains A4, I8 and G3 overnight (18 h) in 50 ml of BHI broth at 37°C in a rotary shaker at 120 cycles per min. Cells were pelleted by centrifugation at 10 000 g for 30 min at 4°C. The pH of the supernatants was adjusted to 7 with 1 mol l−1 NaOH, and the supernatants were sterile filtered through a 0·45 μm pore-size filter (Tabbene et al. 2009).

The agar well diffusion method used was a modified version of a previously published protocol (Bizani and Brandelli 2002). Briefly, 100 μl of indicator (approximately 107 CFU ml−1) was mixed with 10 ml BHI agar or nutrient agar or YGP agar in a Petri dish. After cooling, 6 mm diameter wells were cut into the agar plates and filled with 20 μl of CFS. The plates were incubated at the optimal temperature of the indicator organism (Table 1) and inhibition zone diameters were measured after appropriate time as described above. Un-inoculated BHI broth or nutrient broth or YGP broth was used as negative controls. The experiment was conducted in duplicate on three separate occasions.

Physical and chemical properties of antimicrobial substances

Effect of heat, pH and enzymes on antimicrobial activity

To analyse the thermal stability of the antimicrobial substance produced by isolates A4, I8 and G3, aliquots of CFS obtained as described above were exposed to temperatures of 30, 40, 50, 60, 70, 80, 90 and 100°C for 30 min, autoclaving at 121°C for 15 min, 4°C for 30 days and −20°C for 30 days. The effect of pH on the antimicrobial activity was tested by adjusting CFS to pH's between 3 and 11 (with an increment of one pH unit) using 1 mol l−1 NaOH or HCl. The CFS with adjusted pH were then incubated for 2 h at 37°C before being neutralized to pH 7. After each treatment, residual activity was determined using the agar well diffusion method with Bcereus NVH391-98 as indicator organism. All experiments were done in duplicate on two separate occasions. An untreated CFS served as controls in each test.

The stability of the antimicrobial substance was also tested against a range of enzymes (all obtained from Sigma-Aldrich, Brøndby, Denmark): Trypsin from bovine pancreas (T8003), papain lyophilized (P4762), protease from Streptomyces griseus (P6911) and proteinase K from Tritirachium album (P6556) (all proteolytic); catalase from bovine liver (C1345), lipase II from porcine pancreas (L3126) and α-amylase from porcine pancreas (A3176) (nonproteolytic enzymes). All enzymes were dissolved in buffers as recommended by the supplier. Samples of CFS obtained as described above were treated with each enzyme at 37°C for 2 h at a final concentration of 1 and 2 mg ml−1 and assayed for antimicrobial activity against B. cereus NVH391-98. Untreated CFS plus buffer, buffer alone, and enzyme solutions served as controls. The experiments were conducted in duplicate on two separate occasions.

Direct detection of antimicrobial activity on SDS-PAGE gels

Proteins from 20 ml CFS of isolates A4, I8 and G3 (grown in BHI broth) were precipitated on ice with 11% (w/v) tricloroacetic acid (TCA). The protein precipitates were pelleted by centrifugation at 15 000 g for 30 min at 4°C and washed twice in 1/3 volume ice-cold acetone. Supernatants were collected after each centrifugation step to test their antimicrobial activity. Protein pellets were solubilized in 200 μl Tris-buffer (20 mmol l−1 Tris, 1 mmol l−1 EDTA, pH 7). The activity of the supernatants (TCA and acetone) and the dissolved protein pellets was tested by the well diffusion test against the indicator organism B. cereus NVH391-98. Tris-buffer was used as negative control.

SDS-PAGE analysis was performed by separating proteins on a 20% RunBlue SDS-page gel. Ten microlitres of sample (from each strain) was loaded on the gel together with a Sharp Novex marker, range 3·5–260 kDa (LC5801; Invitrogen). Following electrophoresis (180 V, 90 mA, 50 min), the gel was stained with coomassie brillant blue (0·1% Coomassie R-250, 40% ethanol, 10% acetic acid) for 1 h, destained for 1 h (7·5% acetic acid, 10% ethanol) and washed for 4 h in sterile distilled water to replace separation SDS and separation buffer in the gel. The gel was overlaid with 5 ml of soft BHI agar (0·7% w/v) inoculated with 105 cells ml−1 of the indicator strain B. cereus NVH391-98. The overlaid gel was incubated at 37°C for 24 h and observed for the presence of an inhibition zone (Motta et al. 2007a).

UHPLC-TOFMS analysis of antimicrobial substances

The isolate I8 was randomly chosen for this experiment. The strain was grown in BHI broth and two different methods were used for the extraction of antimicrobial substance(s).

Method 1

Duplicate samples of I8 CFS were prepared as previously described and precipitated with 11% (w/v) TCA. The suspensions were subjected to centrifugation at 15 000 g for 30 min at 4°C. Ice–cold acetone (10 ml) was added to each precipitate and samples were centrifuged at 15 000 g for 30 min at 4°C. The resulting supernatant was evaporated to dryness with N2. One set of the samples was dissolved in 30% (v/v) ethanol in 1 ml of water before being used to test the antimicrobial activity against the target micro-organisms (Table 1); the other sample set was kept at −20°C for chemical analysis. TCA collected after CFS precipitation and solution of 30% ethanol in water were used as negative controls in the antimicrobial activity assay.

Method 2

Duplicate samples were prepared, 5 ml of the test strain CFS was precipitated with 5 ml ethyl-acetate while stirring overnight. The upper phase was transferred to a new vial and evaporated to dryness using N2. One of the samples was dissolved in 30% (v/v) ethanol in 1 ml water before being used to test for antimicrobial activity against the target micro-organisms (Table 1) while the other was kept at −20°C for UHPLC-TOFMS analysis. Solutions of 30% (v/v) ethanol in water and ethyl-acetate were used as negative controls.

UHPLC-TOFMS was conducted on an Ultimate 3000 UHPLC system (Dionex, Sunnyvale, CA, USA) coupled with a maXis G3 quadruple time of flight mass spectrometer (Bruker Daltonics, Bremen, Germany) equipped with an electrospray (ESI) source. Separation of 1–5 μl samples was performed at 40°C on a 150 mm × 2·1 mm ID, 1·7 μm BEH C18 column (Waters, Milford, MA, USA) using a linear water-acetonitrile gradient (both buffered with 20 mM formic acid) at a flow of 0·4 ml min−1 starting from 10% acetonitrile and increased to 100% in 9 min, keeping this for 2 min. HRMS was performed in ESI+ with a data acquisition range of 10 scans per sec at m/z 100–1500 and a resolution of 40 000 FMWH. The MS was calibrated using sodium formate automatically infused prior to each analytical run, providing a mass accuracy of <1·5 ppm in MS mode. Peaks only observed in the base peak chromatograms of the bioactive samples were assessed for adduct formation of [M+H]+, [M+2H]2+, [M+NH4]+, [M+H+NH4]2+, [M+Na]+, [M+H+Na]2+ and the accurate mass (±0·005 m/z) searched in Antibase2010 (37 185 microbial secondary metabolites) (Wiley & Sons, Hoboken, NJ, USA). Reference standards of iturins and surfactins (Sigma-Aldrich) were co-analysed.

Detection of bacteriocin, lipopeptide and polyketide synthesis genes by PCR

Polymerase chain reactions were performed to determine the presence of subtilin, subtilosin, ericin, sublancin, iturin, mycosubtilin/iturin, surfactin/lichenysin, fengycin, plipastatin, bacillomycin, difficidin, bacillaene, macrolactin and bacilycin biosynthesis genes in the DNA of isolates A4, I8 and G3. Genomic DNA of B. amyloliquefaciens DSM7 (ituC, ituD, ituA, bacA/B, bmyA, baeA), B. subtilis subsp. subtilis DSM 10 (srfA, sfp, ywiB, spoA, albA) and B. subtilis subsp. spizizenii DSM 15029 (etnS) were used as positive controls. PCR-amplifications were carried out in a 25-μl reaction mixture containing 2 × PCR Master Mix/Dream Taq Green (12·5 μl) (Fermentas GmbH, St Leon-Rot, Germany), sterile high purity water (9·5 μl), 1 μl of each forward and reverse primer (10 pmol μl−1) (Table 2) and 1 μl of template DNA. The amplifications were performed in a thermocycler (Applied Biosystems, 2720, Singapore) using the PCR conditions as previously described in the indicated references (Table 2). Primers for the detection of genes involved in the synthesis of the polyketide antibiotics macrolactin (mlnA), bacillaene (baeA) and difficidin (dfnA), the dipeptide bacilysin (bacA/B) and bacillomycin (bmyA) of the iturin family were designed based on the genome sequence of B. amyloliquefaciens ssp. amyloliquefaciens FZB42 (NC_009725) using primer blast 3 (Ye et al. 2012). PCR conditions were as follows: 94°C for 4 min, 30 cycles of 94°C for 30 s, 57°C for 30 s, 72°C for 75 s. Final elongation was at 72°C for 7 min. The amplified products were detected by agarose gel electrophoresis (1·5% (w/v) agarose, 120 V, 2 h) followed by ethidium bromide staining and documented under UV light visualization. PCR was scored positive when a band of the appropriate size was visualized.

Table 2. PCR detection of bacteriocin, lipopeptide and polyketide biosynthesis genes from B. amyloliquefaciens ssp. plantarum strains A4, G3 and I8
Bacteriocins/Lipopeptides/PolyketidesGenesPrimersPrimer sequence (5′–3′)PCR product size expected/ detectedaReference
  1. a

    PCR product detected for all B. amyloliquefaciens (A4, I8, G3) and for B. amyloliquefaciens ssp. amyloliquefaciens DSM7 (except for with the primers Ap1-F/Tp1-R, mlnA_F/R, bmy_F/R and dfnA_F/R) type strain.

  2. b

    The spaS primers target both spaS and etnS a spaS-like gene in DSM15029. Targeting of etnS (also 152 bp) of DSM15029 has been confirmed by sequencing (Line Thorsen, unpublished results).

  3. c

    PCR product detected for only isolate I8.

  4. d

    The primer pair As1-F, Ts2-R may anneal to both surfactin and lichenycin sythesis genes, Am1-F, Tm1-R may anneal to both mycosubtilin and iturin synthesis genes, while Af2-F, Tf1-R may anneal to fengycin, plipastatin synthesis genes.

Subtilosin

ywiB

sboA

albA

Osbo P1NCCTCATGACCAGGACTTCGCCTT1200 bp/noKaboré et al. (2012)
Osbo P2NCGGTGCCGAGCGCTTCAGGT
Subtilinb spaS SpaS_FwdCAAAGTTCGATGATTTCGATTTGGATGT152 bp/noSutyak et al. (2008)
SpaS_RevGCAGTTACAAGTTAGTGTTTGAAGGAA
Ericin

eriC

eriSa

eriSb

Eric_FTCAACTGACCGGGCAGGAGC1440 bp/noKaboré et al. (2012)
Eric_RAAGTATTTGGCCTACAGCGACTCG
Sublancin sunT SUNT-F1GCTTTGTTAGAAGGGGAGGAAT974 bp/noChung et al. (2008)
SUNT-R1CTTGTCCCAACCCATAGGATAA
Iturin ituD ITUD-F1TTGAAYGTCAGYGCSCCTTT482 bp/yesChung et al. (2008)
ITUD-R1TGCGMAAATAATGGSGTCGT
ituC ITUC-F1CCCCCTCGGTCAAGTGAATA594 bp/yesChung et al. (2008)
ITUC-R1TTGGTTAAGCCCTGATGCTC
Iturin A ituA ITUD1FGATGCGATCTCCTTGGATGT647 bp/yesSarangi et al. (2009)
ITUD1RATCGTCATGTGCTGCTTGAG
Surfactin srfA SRFA-F1AGAGCACATTGAGCGTTACAAA626 bp/noChung et al. (2008)
SRFA-R1CAGCATCTCGTTCAACTTTCAC
sfP SFP-F1ATGAAGATTTACGGAATTTA675 bp/noChung et al. (2008)
SFP-R1TTATAAAAGCTCTTCGTACG
srf/lchAs1-FCGCGGMTACCGVATYGAGC419, 422, 425, 431/yesTapi et al. (2010)**
Ts2-RATBCCTTTBTWDGAATGTCCGCC
Mycosubtilinmyc/ituAm1-FCAKCARGTSAAAATYCGMGG416, 419/yesTapi et al. (2010)
Tm1-RCCDASATCAAARAADTTATC
Fengycin fen Af2-FGAATAYMTCGGMCGTMTKGA443, 452/yesTapi et al. (2010)
Tf1-RGCTTTWADKGAATSBCCGCC
Plipastatin pps Ap1-FAGMCAGCKSGCMASATCMCC893, 959, 929/yescTapi et al. (2010)
Tp1-RGCKATWWTGAARRCCGGCGG
Bacillaene baeA baeR_FATG TCA GCT CAG TTT CCG CA688 bp/yesThis study
baeR_RGAT CGC CGT CTT CAA TTG CC
Macrolactin mnlA mlnA_FCCG TGA TCG GAC TGG ATG AG668 bp/yesThis study
mlnA_RCAT CGC ACC TGC CAA ATA CG
Bacilysin bacA/B bacA/B_FTGC TCT GTT ATA GCG CGG AG910 bp/yesThis study
bac B bacA/B_RGTC ATC GTA TCC CAC CCG TC
Bacillomycin bmyA bmyA_FCTC ATT GCT GCC GCT CAA TC853 bp/yesThis study
bmyA_RCCG AAT CTA CGA GGG GAA CG
Difficidin dfnA dfnA_FGGA TTC AGG AGG GCA TAC CG653 bp/yesThis study
dfnA_RATT GAT TAA ACG CGC CGA GC

Kinetics of antimicrobial substance production in BHI broth

To study the kinetics of the antimicrobial substance production, each strain (A4, I8 and G3) was inoculated into 50 ml of BHI medium, in 250 ml Erlenmeyer flasks, at a concentration of 102–103 CFU ml−1. The cultures were incubated at 37°C in a water bath (GFL 1083; Bie and Berntsen, Rødovre, Denmark) under shaking conditions (120 cycles per min). Samples were aseptically taken at 2 h intervals over 24 h. Growth was monitored by determining the optical density using a spectrophotometer (O.D; Shimadzu, Kyoto, Japan) and by plate counting on BHI agar (CFU ml−1), and the pH of each sample was recorded (PHM 250; Radiometer Analytical, Brønshøj, Denmark). Antimicrobial activity of CFS was evaluated by the agar well diffusion method as described above with B. cereus NVH391-98 as indicator strain.

Antimicrobial activity in H. sabdariffa seed-based broth

The Bacillus spp. isolates A4, I8 and G3 were tested for their ability to produce antimicrobial substance(s) during growth in H. sabdariffa seed-based broth, prepared as described in the following: H. sabdariffa seeds purchased at a market in Ouagadougou, Burkina Faso, were ground into flour using a crusher (Bosch MKM 6003). The flour was cooked in distilled water for 3–4 h (5 g flour per 50 ml MQ water in a 250 ml Erlenmeyer flask); the pH was adjusted to 7·4 ± 0·2 and the broth was autoclaved at 121°C for 15 min. The Bacillus spp. isolates were inoculated into the broth at an initial concentration of 105 CFU ml−1, and incubated in a water bath (GFL 1083; Bie and Berntsen) overnight (18 h) at 37°C under shaking conditions (120 cycles per min). Samples were collected to determine viable counts (CFU ml−1), pH and antimicrobial activity of CFS against B. cereus NVH391-98 by the agar well diffusion assay as described above. CFS of the isolates A4, I8 and G3 cultivated in BHI broth were used as positive controls. The experiment was conducted in duplicate on two separate occasions.

Additionally, the kinetics of antimicrobial substance (s) production in H. sabdariffa seed-based broth was studied as described for the study in BHI broth using the isolate A4.

Sequence accession numbers

The gyrB sequences determined in the present study have been deposited under Genbank accession numbers JX843448JX843450.

Results

Re-identification of Bacillus isolates

The gyrB gene sequences of A4, I8 and G3 showed 99% identity to B. amyloliquefaciens ssp. plantarum strains CAU B946 (NC_016784), YAU B9601-Y2 (NC_017061), 98% to the B. amyloliquefaciens ssp. plantarum type strain FZB42 (CP000560) and 96% identity to the B. amyloliquefaciens ssp. amyloliquefaciens type strain DSM7 (FN597644) and Bacillus siamensis KCTC 13613 (AJVF01000039). Although the identity to the recently described species B. methylotrophicus was also 98%, the phenotypic traits of strains A4, I8 and G3 were typical of B. amyloliquefaciens (growth in 10% (w/v) NaCl and at 50°C). The studied Bacillus isolates previously identified by 16S rRNA gene sequencing as B. subtilis were therefore re-identified as B. amyloliquefaciens ssp. plantarum.

Antimicrobial activity in BHI medium

As seen in Table 1, B. amyloliquefaciens ssp. plantarum A4, I8 and G3 showed almost the same inhibitory capacity in the agar spot test as compared to in the agar well test. Antimicrobial activity was observed towards Penicillium spp. and a wide range of Gram-positive and Gram-negative bacteria, including the pathogens B. cereus, L. monocytogenes, Escherichia coli, Salmonella spp., Shigella spp., and Yersinia enterocolitica. The differences observed between the two methods used resided in the fact that most of the Salmonella spp. were strongly inhibited in agar spot test, but not in the agar well diffusion assay. By contrast, most of the B. cereus strains were not inhibited in the agar spot test, but their growth was strongly inhibited by the CFS of the studied B. amyloliquefaciens ssp. plantarum isolates.

Effect of enzymes, heat and pH on antimicrobial activity

The antimicrobial substance(s) produced by the studied isolates was resistant (100% activity against B. cereus NVH391-98) to the proteolytic enzymes trypsin, papain, protease and proteinase K, and to catalase, lipase II and α-amylase. The antimicrobial substance was also shown to retain 100% of its initial activity within the pH range of 3 to11 and following exposure to temperatures of up to 80°C for 30 min, storage for up to 30 days at refrigerated temperature (4°C) and at freezing temperature (−20°C) for 30 days. However, the inhibitory activity decreased to 75% and 50% when exposed for 30 min to 90°C and 100°C, respectively and was completely lost after autoclaving at 121°C for 15 min.

Direct detection of antimicrobial activity on gels

The protein profiles obtained by SDS gel electrophoresis of TCA precipitates of CFS of isolates G3, I8 and A4 were highly similar, showing several bands of between approximately 160 and 3 kDa (results not shown). No inhibition zones were observed in the part of the gel overlaid by the indicator B. cereus NVH391-98 (results not shown). When TCA precipitates were washed with ice–cold acetone, a yellow pigmented supernatant was obtained showing 80–90% antimicrobial activity (compared to antimicrobial activity of crude CFS, results not shown) against B. cereus NVH391-98.

UHPLC-TOFMS analysis of antimicrobial compounds

The antimicrobial substances produced in BHI broth by B. amyloliquefaciens ssp. plantarum I8 and which were extracted using acetone (from TCA precipitated proteins) and ethyl-acetate (directly from CFS) were tested for antimicrobial activity against the target micro-organisms before being analysed by UHPLC-TOFMS. The acetone extract was active against most of the Gram-positive pathogenic bacteria and all the yeasts, while the ethyl-acetate extract was active against both Gram-positive and Gram-negative pathogenic bacteria (results not shown). UHPLC-TOFMS analysis of acetone and ethyl-acetate extracts revealed the presence of iturins, fengycins, surfactins and their derivatives in addition to other compounds (Figs 1 and 2).

Figure 1.

(a) base peak chromatogram of the ethyl-acetate extract of strain I8 and (b) extracted ion chromatograms of [M+2H]++ (±0·005 m/z) of iturins with the major ones marked. (c) shows the mass spectrum of Iturin A4, A3, A5 or C2 from the major iturin peak in the chromatogram, a peak at least consisting of two components as judged by the preshoulder seen in (a).

Figure 2.

Extracted ion chromatograms of [M+2H]++ (±0·005 m/z) of the detected lipopeptides found in the ethyl-acetate extract of strain I8.

PCR detection of bacteriocin, lipopeptide and polyketides biosynthesis genes

As seen in Table 2, all the B. amyloliquefaciens ssp. plantarum isolates A4, G3 and I8 were found to be negative for the genes involved in the biosynthesis of the bacteriocins subtilin and entianin (spaS, etnS), sublancin (sunT), ericin (eriC, eriSa and eriSb) and subtilosin (yiwB, sboA, albA). However, they harboured genes involved in the biosynthesis of the lipopeptides iturins (ituA, ituD, ituC), mycosubtilin/iturin (myc), bacillomycin (bmyA), surfactin (srf) and fengycin (fen), the polyketides macrolactin (mlnA), bacillaene (baeA) and difficidin (dfnA) and the dipeptide bacilysin (bacA/B).

Production of antimicrobial compound(s) during growth in BHI broth

Results for the kinetics of antimicrobial substance production by isolate I8 are shown in Fig. 3. Growth reached the stationary phase after 12 h of incubation. When using B. cereus NVH391-98 as indicator strain, antibacterial activity could be detected from the middle of the exponential growth phase and maximum activity was observed in the stationary growth phase. The same kinetics of antimicrobial substance production was observed for the isolates A4 and G3 (results not shown). It was observed that the pH initially decreased slightly to 7 and had increased to about 9 by the end of the incubation (Fig. 3, results not shown for A4 and G3).

Figure 3.

Production of antimicrobial activity during growth of Bacillus amyloliquefaciens I8 in BHI broth at 37°C for 24 h. Bacterial growth (Log10 CFU ml−1), Inhibition zone (IZ) in mm against B. cereus NVH-391-98 and pH were recorded each 2 h. Each point represents the mean of two repeated measurements from two independently replicated experiments. (image) IZ; (image) log 10 CFU ml−1 and (image) pH.

Antimicrobial activity in H. sabdariffa seed-based broth

When using a H. sabdariffa seed-based broth as only substrate for their growth, the isolates A4, I8 and G3 were able to produce antimicrobial activity against B. cereus NVH391-98 (results not shown). The study of the kinetics of antimicrobial compounds production in H. sabdariffa seed-based broth by isolate A4 showed that antimicrobial activity could be detected in the late stationary phase (10 h of growth) with maximum antimicrobial activity in the stationary phase from 18 to 24 h of incubation (Fig. 4). The number of cells increased from 2 (log 10 CFU ml−1) to more than 8 (log 10 CFU ml−1) while the pH increased from 6·7 to more than 8 (Fig. 4).

Figure 4.

Production of antimicrobial activity during growth of Bacillus amyloliquefaciens A4 in Hibiscus sabdariffa seed-based broth at 37°C for 24 h. Bacterial growth (Log10 CFU ml−1), Inhibition zone (IZ) in mm against B. cereus NVH-391-98 and pH were recorded each 2 h. Each point represents the mean of 2 repeated measurements from 2 independently replicated experiments. (image_n/jam12214-gra-0004.png) IZ (mm); (image_n/jam12214-gra-0002.png) log 10 CFU ml−1 and (image) pH.

Discussion

Recently, it was shown that in order to discriminate between the newly described species B. methylotrophicus (Madhaiyan et al. 2010) and B. amyloliquefaciens ssp. plantarum, phenotypic tests are needed in addition to gyrB gene sequencing (Agbobatinkpo et al. 2013). Thus, based on the gyrB gene sequence analysis and due to the ability to grow at 50°C and in 10% (w/v) NaCl, the isolates A4, G3 and I8 were identified as B. amyloliquefaciens ssp. plantarum.

In the present study, the strains A4, I8 and G3 showed a broad-spectrum antimicrobial activity towards Gram-positive as well as Gram-negative food-borne pathogenic bacteria in addition to some Penicillium spp. However, the activity was in some instances dependent on the assay used. Thus, the studied Bacillus spp. isolates exhibited antimicrobial activity against most of the Salmonella spp. but not against most of the B. cereus strains in the agar spot assay, whereas the opposite was observed with the well diffusion assay. It is possible that the different target micro-organisms were inhibited by different antimicrobial compounds and that the regulation of their productions by the B. amyloliquefaciens ssp. plantarum strains could be influenced by both the target organism and/or the growth conditions (solid vs liquid medium). The ability to inhibit the Salmonella spp. in the agar spot assay but not in the agar well assay could perhaps also be explained by instability of the particular antimicrobial compound targeting this genus, or that the compound with the activity had not yet been produced at the time of harvesting the CFS used for the test. For example, the polyketide bacillaene produced by B. subtilis has previously been reported to be quickly decomposed upon exposure to light and room temperature (Butcher et al. 2007). The gene involved in bacillaene production was detected in the isolates A4, G3 and I8.

The broad-spectrum antimicrobial activity exhibited by the studied isolates is in agreement with results reported for another B. amyloliquefaciens strain, LBM 5006 which produced inhibitory activity against both Gram-positive and Gram-negative bacteria (Lisboa et al. 2006), phytopathogenic fungi (Benitez et al. 2010) and the amoebae Acanthamoeba polyphaga (Benitez et al. 2011). However, contrary to the present study, the antibacterial compound produced by strain LBM 5006 was attributed to a bacteriocin-like substance (BLS) of 5 kDA (Lisboa et al. 2006), and the activity against the amoebae Acanthamoeba polyphaga was due to the production of another BLIS (Benitez et al. 2011).

Bacillus cereus was used as indicator organism when examining the physical and chemical properties of the produced antimicrobial compounds. The production of antimicrobial activity by isolates A4, I8 and G3 started at the middle of the exponential growth phase and reached maximum values during stationary phase in BHI broth. The antimicrobial substance(s) produced by A4, I8 and G3 was resistant to all proteolytic enzymes tested at 1 and 2 mg ml−1 suggesting that these compounds may be cyclic peptides (Bizani and Brandelli 2002). Furthermore, the inhibitory substance(s) was active in the pH range of 3 to 11 and showed thermal resistance because a total loss of activity was observed only after incubation at 121°C. It was also observed that the compound(s) under study retained full activity when stored at 4°C and −20°C for one month. These properties are similar to those reported for the antifungal lipopeptides produced by B. amyloliquefaciens LBM 5006 (Benitez et al. 2010). Bacillus amyloliquefaciens strains have been reported to produce BLIS (Lisboa et al. 2006) and bacteriocins including subtilosin A (Sutyak et al. 2008) and amylolysin (Halimi et al. 2010). However, regarding the results obtained by SDS-page overlaid with B. cereus NVH391-98, the non-detection of proteinaceous antimicrobial substances, as well as the non-detection of the bacteriocins subtilosin A or subtilin encoding genes by PCR, the strains A4, G3 and I8 did not seem to produce any of these compounds. The results are however in agreement with previous observations for B. amyloliquefaciens ssp. plantarum strains by Rückert et al. (2011).

In the present study, UHPLC-TOFMS analysis of acetone and ethyl-acetate extracts showed that strain I8 could produce a mixture of lipopeptides including iturins, surfactins and fengycins in BHI broth medium. These lipopeptides constitute a well-known class of amphiphilic membrane-active biosurfactant peptides with potent antimicrobial activities (Tapi et al. 2010). Indeed, surfactin and iturin compounds are cyclic lipoheptapeptides, which contain a β-hydroxy fatty acid and a β-amino fatty acid, respectively, as their lipophilic component (Ongena and Jacques 2008) while fengycin is a lipodecapeptide with a β-hydroxy fatty acid in its side chain. The amphiphilic nature of these compounds may explain the resistance of the antimicrobial substance (s) produced to proteolytic enzymes treatment. The fact that lipase and α-amylase did not cause any loss of activity suggests that a lipid moiety as well as sugar residues are not involved in the inhibitory activity (Motta et al. 2007b). Similar to the isolate I8, surfactin-producing B. subtilis group strains have recently been identified in Soumbala (fermented seeds of African locust bean) and Bikalga, fermented condiments from Burkina Faso using PCR and MALDI-TOF-MS analysis (Savadogo et al. 2011).

Isolates A4, I8 and G3 were shown to harbour numerous genes involved in antimicrobial substance productions. Indeed, the genes involved in the biosynthesis of lipopeptides iturin, surfactin, fengycin, bacillomycin and mycosubtilin/iturin, as well as genes involved in the synthesis of the polyketides macrolactin, bacillaene and difficidin, and the dipeptide bacilysin were detected in the three isolates A4, I8 and G3. Isolate I8 possessed in addition genes involved in plipastatins biosynthesis. Interestingly, in this study the isolates I8, G3 and A4 were found to be more closely related to the plant-associated B. amyloliquefaciens ssp. plantarum strains FZB42, CAU B946 and YAU B9601-Y2 than to the type strain B. amyloliquefaciens ssp. amyloliquefaciens DSM7 by gyrB gene sequence analysis. Contrary to DSM7 which shows a reduced ability to produce lipopeptide antibiotics other than surfactin, the genome of the plant-associated B. amyloliquefaciens ssp. plantarum strains YAU B9601-Y2, CAU B946 and FZB42 harbour numerous gene clusters involved in the synthesis of lipopeptides and polyketides with antifungal, antibacterial and nematocidal activity (Borriss et al. 2011).

In the present study, the acetone extract (but not the ethyl-acetate extract) from I8 CFS was also active against all the yeasts (results not shown), and iturins were detected in this extract by UHPLC-TOFMS (results not shown). Furthermore, additional assays carried out with Iturin A from B. subtilis (I1774; Sigma-Aldrich) showed that all studied yeasts were sensitive to iturin A (results not shown). It is possible that higher levels of surfactin and iturin were obtained by acetone extraction as compared to the ethyl-acetate extraction, hence the activity against the yeasts.

The antimicrobial activities of lipopeptides have been described (Ongena and Jacques 2008). Iturins display a strong antifungal action against a large variety of yeast and fungi, while fengycins show antimicrobial activity against particularly filamentous fungi. The lipopeptide surfactins display antiviral, antimycoplasma, antifungal and antibacterial activity. Recently, a lipopeptide surfactant produced by B. subtilis natto was shown to exert antimicrobial activity towards Salmonella Thyphimurium, M. luteus and S. aureus (Cao et al. 2009). Surfactin has also been reported to sterilize Ecoli and to inactivate spores of B. cereus (Huang et al. 2007). In addition, inhibitory activity of surfactin and iturin against Salmonella enteridis has been described (Huang et al. 2009). These lipopeptides are known to act in a synergistic manner as suggested by several studies on surfactin with iturin (Maget-Dana et al. 1992), surfactin with fengycin (Ongena et al. 2007) and iturin with fengycin (Romero et al. 2007). Although it is possible that it is the synergistic effect of the iturins, surfactins and fengycins that caused the broad-spectrum antibacterial activities observed in the present study, the activity may also be due to the unknown compounds also observed in the ethyl-acetate and acetone extracts. Many compounds from these extracts seemed to be lipopeptides based on their retention time, TOFMS spectra and elemental composition of the ions (Nielsen et al. 2011), though more studies are needed to elucidate this. It is also possible that the broad-spectrum antibacterial activity observed was due to a production of the polyketides difficidin, bacillaene, macrolactin and/or the dipeptide bacilysin as the strains I8, A4 and G3 are potentially able to produce these compounds as detected by PCR. Indeed, the polyketide difficidin which is a macrocyclic polyene lactone phosphate ester was shown to have antibacterial effect against S. aureus, Clostridium perfringens, Clostridium difficile, S. Thyphimurium, E. coli and others (Zimmerman et al. 1986), while bacillaene has been reported to be bacteriostatic against, for example B. thuringiensis, E. coli and S. aureus (Patel et al. 1995).

The large spectrum of inhibition demonstrated by the isolates A4, I8 and G3 in the present work is of major interest since these micro-organisms could serve in safeguarding bikalga and other African fermented condiments against pathogens and spoilage organisms. Indeed, human pathogens including B. cereus, Salmonella spp., E. coli and S. aureus have been often isolated from fermented food condiments including Bikalga in Africa and might constitute a safety problem for the consumers (Ouoba et al. 2008b; Thorsen et al. 2010). In addition to the biopreservation, the lipopeptides produced could also play an important role in the functional properties of the products. Indeed, they surfactant properties could modify the consistence of the product as well as its organoleptic properties by the modification of the solubility of certain hydrophobic compounds (Savadogo et al. 2011).

The observed heat and pH stability of the antimicrobial compound(s) also indicates a great potential for food preservation. Furthermore, it was found in the present study that the investigated 3 B. amyloliquefaciens ssp. plantarum isolates produced antimicrobial activity against B. cereus NVH391-98 when grown in a H. sabdariffa seed-based broth, indicating a potential for antimicrobial compound(s) productions in real-life Bikalga fermentations.

To conclude, this study identified B. amyloliquefaciens ssp. plantarum strains isolated from traditional Bikalga showing significant activity against fungi, Gram-positive and Gram-negative food-borne pathogenic bacteria.The antimicrobial activity was also produced in H. sabdariffa seed-based broth. The strains produced the lipopeptides iturins, surfactins and fengycins in addition to nonidentified lipopeptidic compounds. The isolates further showed the potential for bacilycin, macrolactin, difficidin and bacillaene production as detected by PCR. These compounds could play an important role in the biopreservation and the functional properties of Bikalga, though more studies are needed to fully elucidate the potential.

Acknowledgement

This work was supported by DANIDA (Danish International Development Agency) through the project: ‘Capability Building for Research and Quality Assurance in Traditional Food Processing in West Africa’.

Ancillary