Subinhibitory concentrations of pinocembrin exert anti-Staphylococcus aureus activity by reducing α-toxin expression

Authors

  • L.W. Soromou,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    2. Département de Médecine Vétérinaire, Institut Supérieur des Sciences et de Médecine Vétérinaire (ISSMV) de Dalaba, Dalaba, République de Guinée
    Search for more papers by this author
    • These authors contributed equally to this work.
  • Y. Zhang,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
    • These authors contributed equally to this work.
  • Y. Cui,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
  • M. Wei,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
  • N. Chen,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
  • X. Yang,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
  • M. Huo,

    1. Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
  • A. Baldé,

    1. Département de Médecine Vétérinaire, Institut Supérieur des Sciences et de Médecine Vétérinaire (ISSMV) de Dalaba, Dalaba, République de Guinée
    Search for more papers by this author
  • S. Guan,

    1. Department of Food Quality and Safety, College of Light Industry Economics and Management, Jilin University, Changchun, China
    Search for more papers by this author
  • X. Deng,

    Corresponding author
    • Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author
  • D. Wang

    Corresponding author
    • Key Laboratory of Zoonosis, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun, China
    Search for more papers by this author

Correspondence

Xuming Deng, Dacheng Wang, Department of veterinary pharmacology, Jilin University, Changchun 130062, China. E-mails: xumingdeng@jluhp.edu.cn; wdc9928@yahoo.com.cn

Abstract

Aims

Natural products have been used as potentially important sources of novel antibacterials in combating pathogenic Staphylococcus aureus isolates, a major problem around the world. In this study, we aimed to investigate the antibacterial effects of pinocembrin (PNCB) against Staph. aureus pneumonia in a murine model and its influence on the production of Staph. aureus α-haemolysin (Hla).

Methods and Results

The in vitro activities of PNCB on α-haemolysin production were determined using haemolysis, Western blot and real-time RT-PCR assays. The viability and cytotoxicity assays were performed to evaluate the influence of PNCB on α-toxin-mediated injury of human alveolar epithelial cells. Moreover, through histopathologic analysis, we further determined the in vivo effects of PNCB on Staph. aureus pneumonia in a mouse model. In vitro, PNCB at low concentrations exhibited inhibitory activity against α-haemolysin production and attenuated α-haemolysin-mediated cell injury. Furthermore, the in vivo findings demonstrated that PNCB protected mice from Staph. aureus pneumonia.

Conclusions

We have provided new evidence of the effects of PNCB, which suggest that PNCB attenuated α-haemolysin-mediated cell injury and protected mice from Staph. aureus pneumonia.

Significance and Impact of the Study

The findings indicate that PNCB may be used as a basis for anti-Staphylococcus agent.

Introduction

Staphylococcus aureus is one of the most important causes of nosocomial- and community-associated infections (Kuehnert et al. 2005). It can colonize several niches of the human body and cause life-threatening diseases, such as pneumonia, osteomyelitis, septicaemia and endocarditis (Capparelli et al. 2011). Of the many infections and toxinoses mediated by Staph. aureus, pneumonia is among the most prominent, and Staph. aureus is now increasingly recognized as an important cause of community-associated pneumonia, displaying the capacity to infect a population of otherwise healthy adults and children. Clinical observations have documented that mortality from Staph. aureus pneumonia can exceed 50% defining the severity of disease caused by this organism (Ragle et al. 2010).

One of the most prominent and well-characterized virulence factors produced by Staph. aureus is α-haemolysin (Hla; also known as α-toxin), the founding member of a family of bacterial pore-forming β-barrel toxins. Its structural gene, Hla, is located on the chromosome of Staph. aureus strains, most of which secrete the 293-residue water-soluble monomer. Hla is known to play a role in the pathogenesis of sepsis, pneumonia, septic arthritis, brain abscess, corneal infections and severe skin infection, as Staph. aureus mutants lacking Hla display reduced virulence in invasive disease models (Wardenburg and Schneewind 2008; Wilke and Wardenburg 2010). Multiple lines of evidence confirm that this 33k-Da pore-forming toxin induces the release of cytokines and chemokines such as IL-6, IL-1β, IL-1α, IL-8, TNF-α, KC and MIP-2. Immunization with inactive α-toxin was recently shown to protect mice against lethal Staph. aureus pneumonia (Burnside et al. 2010). Considering the role of α-toxin in disease, new antimicrobial agents are urgently needed to improve outcomes and to expand the limited repertoire of available agents approved for the treatment of pneumonia.

Flavonoids display a variety of pharmacological properties of interest in the therapy of several diseases, including cancer, as cytotoxic, antiangiogenic or antivascular agents (Touil et al. 2009). Due to a wide range of pharmacological activities of flavonoids consumed by humans and animals (Hanasaki et al. 1994), more research is needed on the in vitro and in vivo effects of flavonoids on α-haemolysin expression. Honey, a natural substance produced by bees from nectar (Erejuwa et al. 2012), is one of the earliest sweeteners used by humans. Pinocembrin (PNCB; 5, 7-dihydroxyflavanone, C15H12O4) is one of the most abundant flavanones in honey and has been proved to have anti-oxidant, anti-inflammatory and endothelium-relaxation effects (Liu et al. 2008). Like many other flavonoids, PNCB has been shown to relax the contraction evoked by KCl in rat thoracic aortic rings (Calderone et al. 2004). Previous studies showed that PNCB reduced glutamate-induced SH-SY5Y cell injury and primary cultured cortical neurone damage in oxygen–glucose deprivation/reoxygenation (OGD/R) (Gao et al. 2008) and improved cognition by protecting cerebral mitochondria structure and function against chronic cerebral hypoperfusion in rats (Guang and Du 2006). Previously, we reported that PNCB provided in vitro and in vivo protection against lipopolysaccharide-induced inflammatory responses (Soromou et al. 2012). Although previous studies have shown the beneficial effects of PNCB, less is known about its antimicrobial effects. Therefore, in this study, we aimed to investigate the anti-Staph. aureus effects of PNCB against Staph. aureus pneumonia in a murine model and its influence on the production of Staph. aureus α-haemolysin.

Material and methods

Bacterial strains and culture

For haemolysis, Western blot and real-time RT-PCR assays, Staph. aureus strains producing high levels of α-toxin were grown at 37°C in tryptic soy broth (TSB) to an optical density at 600 nm (OD 600) of 2·5, 2·0, 2·0 and 2·5 for strains ATCC 29213, Wood 46, BAA-1717 and ATCC 8325-4, respectively). For cytotoxicity studies and mouse lung infections, Staph. aureus was grown at 37°C in TSB to an OD 600 nm of 0·6. Culture aliquots (50 ml) were centrifuged and washed in phosphate-buffered saline (PBS) prior to resuspension. For histopathology experiments, Staph. aureus 8325-4 and DU 1090 were resuspended in 1000 μl PBS (2 × 108 CFU per 30 μl). The bacterial strains used in the study are listed in Table 1.

Table 1. Bacterial strains used in the work and their minimum inhibitory concentrations (MICs) to pinocembrin (PNCB)
Staphylococcus aureus strainsPropertiesSourceMIC (μg ml−1)
OxacillinPNCB
ATCC 29213MSSA, α-haemolysin-producing strain, β-lactamase-producing strainATCC0·25>128
ATCC 10832Wood 46, a natural isolate with high-level production of α-haemolysinATCC0·125>64
BAA 1717USA 300, isolated from adolescent patient with severe sepsis syndrome in Texas Children's Hospital, α-haemolysin-producing strainATCC128>128
8325-4A high-level α-haemolysin-producing strain derived from NCTC 8325Timothy J. Foster0·125>64
DU 10908325-4 defective in α-haemolysin, prepared by insertion of a transposon in the hla geneTimothy J. Foster0·125>128

Chemicals

PNCB (purity >99·7%) was purchased from National Institute for Food and Drug Control (Beijing, China); for in vitro studies, PNCB stock solutions of various concentrations were prepared in dimethyl sulfoxide (DMSO) (Sigma-Aldrich, St Louis, MO, USA). For in vivo assays, PNCB was suspended in sterile PBS.

Animal

The 8-week-old male C57BL/6J mice were obtained from the Experimental Animal Centre of Jilin University (Changchun, China). The mice were kept in the animal house in a temperature-controlled room with a 12-h light–dark cycle; free access to standard laboratory chow and water was allowed. Laboratory temperature was 24 ± 1°C, and relative humidity was 40–80%. Animal experiments were approved by and conducted in accordance with the guidelines of the Animal Care and Use Committee of Jilin University.

Antimicrobial susceptibility testing

PNCB stock solutions of various concentrations were prepared in dimethyl sulfoxide (DMSO) (Sigma-Aldrich). A broth microdilution method was used to determine the minimum inhibitory concentrations (MICs). Serial two-fold dilutions of pinocembrin (PNCB) were prepared in sterile 96-well microplates. Following inoculation of 5 × 105 CFU/ml of overnight broth cultures in each well, the plates were incubated aerobically at 37°C for 24 h. The MICs of PNCB for Staph. aureus strains were assessed in triplicate using CLSI BMD method (CLSI 2005). The MIC is defined as the lowest concentration of drug at which the micro-organism does not demonstrate visible growth. Oxacillin was used as a positive control.

Haemolysis assay

Staphylococcus aureus strains were cultured in TSB at 37°C, with graded subinhibitory concentrations of PNCB, until the postexponential growth phase (OD 600 nm of 2·5) was reached. Culture supernatants were collected and were filter sterilized with a 0·22-μm (pore size) acetate syringe filter. A 0·1-ml volume of culture supernatant was mixed with 2·5% defibrinated rabbit blood in PBS buffer. After 15 min at 37°C, the unlysed blood cells were pelleted by centrifugation (5500 g, room temperature, 1 min). The haemolytic activity of the supernatant was detected by measuring the OD at 543 nm. Haemolytic activity in the control culture was regarded as 100%, and the per cent haemolysis was calculated by comparison with the control culture. Haemolytic activity was evaluated as described previously (Qiu et al. 2010a) using rabbit erythrocytes.

Western blot assay for α-haemolysin

Supernatants were collected in the same fashion as for the haemolysis assay. After boiling in Laemmli sample buffer, samples (20 μl) of the supernatant fluid were loaded onto a 12% sodium dodecyl sulfate–polyacrylamide gel and transferred to polyvinylidene fluoride (PVDF) membranes (Roche, Basel, Switzerland). The membranes were incubated for 2 h with 5% skimmed milk in TBST to block free protein-binding sites, and then, proteins were stained overnight with rabbit polyclonal antibody to α-haemolysin (diluted 1 : 6000). Horseradish peroxidase-conjugated anti-rabbit antiserum (Sigma-Aldrich) diluted 1 : 8000 was used as the secondary antibody. The blots were developed using Amersham ECL Western blotting detection reagents (GE Healthcare, Buckinghamshire, UK).

Real-time RT-PCR

Briefly, cells were harvested using centrifugation (5000 g for 5 min at 4°C) and resuspended in TES buffer containing 100 mg ml−1 lysostaphin (Sigma-Aldrich). The samples were incubated at 37°C for 10 min and applied to a Qiagen RNeasy Maxi column to isolate the total bacterial RNA according to the manufacturer's directions. The RNase-free DNase I (Qiagen, Hilden, Germany) was applied to remove contaminating DNA. The quality, integrity and concentration of the RNAs were determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA.) according to the manufacturer's instructions. The primer pairs used in real-time RT-PCR are listed in Table 2. The cDNA was synthesized from total RNA using the Takara RNA PCR kit (AMV) ver. 3·0 (Takara, Kyoto, Japan) according to the manufacturer's instructions. The PCRs were performed in 25 μl reaction mixtures using SYBR Premix Ex Taq TM (Takara) as recommended by the manufacturer. The PCR amplification was performed using the 7000 Sequence Detection System (Applied Biosystems, Courtaboeuf, France). All samples were analysed in triplicate, and the housekeeping gene, gyrBRNA, was used as an endogenous control. In this study, the relative quantification based on the relative expression of a target gene versus the gyrBRNA gene was utilized to determine the changes in the transcript level between samples.

Table 2. Primers used for real-time RT-PCR
PrimerGeneOligonucleotide primer sequence (5′–3′)
gyrB-FgyrBTTATGGTGCTGGGCAAATACA
gyrB-RgyrBCACCATGTAAACCACCAGATA
hla F hla TTGGTGCAAATGTTTC
hla R hla TCACTTTCCAGCCTACT
RNAIII FRNAIIITTCACTGTGTCGATAATCCA
RNAIII RRNAIIIGGAAGGAGTGATTTCAATGG

Live/dead and cytotoxicity assays

Human lung epithelial cells (A549) were washed and plated in DMEM medium supplemented with 10% foetal bovine serum. Cells were seeded in 96-well dishes at a density of 2·0 × 104 cells per well. For both assays, the washed cells were cocultured with 100 μl of staphylococcal suspension per well in DMEM medium with 16 μg ml−1 of PNCB or without PNCB in triplicate wells. After 6 h of incubation at 37°C, cells were treated with live/dead (green/red) reagent (Invitrogen, Carlsbad, CA, USA), or cell viability was determined by measuring lactate dehydrogenase (LDH) release using Cytotoxicity Detection Kit (LDH) (Roche) according to the manufacturer's directions. Microscopic images of stained cells were captured using a confocal laser scanning microscope (Olympus, Tokyo, Japan). LDH activity was measured on a microplate reader (TECAN, Salzburg, Austria). Results are representative of a minimum of three independent experiments.

Mouse model of intranasal lung infection

For lung infection, the mice were anesthetized intraperitoneally with ketamine and xylazine, and then, 30 μl of Staph. aureus suspension was dropped into the left nare. The animals were held upright to allow recovery and were then observed for 72 h. Each experimental group contained 20 mice. To investigate the effects of PNCB treatment, the mice were administered 100 μl of PNCB subcutaneously 2 h after infection with Staph. aureus and then at 12-h intervals thereafter for a total of 6 doses. The control mice were treated with 100 μl sterile PBS on the same schedule. For histopathologic analysis, mice were anesthetized and then euthanized by cervical dislocation. The lungs were placed in 4% formalin, and the formalin-fixed tissues were processed, stained with haematoxylin and eosin and visualized with light microscopy.

Statistical analysis

The experimental data were analysed with SPSS 12.0 statistical software. An independent Student's t-test was used to determine statistical significance. A P value less than 0·05 was considered to be statistically significant.

Results

Influence of pinocembrin on Staphylococcus aureus growth

The MIC values of PNCB that were tested against Staph. aureus strains were all greater than 64 μg ml−1, which indicates that PNCB does not inhibit the growth of Staph. aureus. The results of this experiment are shown in Table 1.

Effect of PNCB against haemolytic activity of Staphylococcus aureus culture supernatants

To investigate the effect of PNCB on α-haemolysin in Staph. aureus culture supernatants, haemolysis assays were performed using rabbit erythrocytes. The percentage of haemolysis was calculated by comparison with the control culture. From the results in Table 3, it can be seen that PNCB treatment (from 2 to 16 μg ml−1) repressed the haemolytic activity in culture supernatants. After treatment with PNCB at 16 μg ml−1, the haemolytic abilities of ATCC 29213, Wood 46, BAA 1717 and 8325-4 culture supernatants were 1·14, 0·83, 0·41 and 1·31%, respectively, compared with a PNCB-free culture.

Table 3. Hemolytic activities of Staphylococcus aureus culture supernatants grown in the presence of increasing concentrations of pinocembrin
Staph. aureus strainsHemolysis (%) of rabbit erythrocytes by culture supernatanta
0 (%)1 μg ml−12 μg ml−14 μg ml−18 μg ml−116 μg ml−1
  1. Values represent means ± SD (n = 3). *indicates < 0·05 and **indicates P < 0·01 compared to the corresponding control.

  2. a

    Hemolytic activity in untreated Staph. aureus culture supernatants was set to 100%.

ATCC 2921310096·06 ± 2·0083·39 ± 2·6747·66 ± 2·95**8·14 ± 2·23**1·14 ± 0·52**
Wood 4610094·12 ± 2·5366·11 ± 3·72*33·76 ± 1·00**0·93 ± 0·53**0·83 ± 1·00**
BAA 171710096·08 ± 1·5867·12 ± 3·26*52·90 ± 2·65*13·29 ± 1·84**0·41 ± 0·44**
8325-410095·25 ± 1·9686·78 ± 2·3865·74 ± 3·25*19·23 ± 1·23**1·31 ± 0·25**

Effect of PNCB on α-haemolysin in Staphylococcus aureus culture supernatants

The haemolytic activity of the tested strains was characterized as α-haemolysis. Therefore, Western blot analysis was conducted to determine whether the decreased haemolytic activities of Staph. aureus culture fluids cultured with increasing concentrations of PNCB were attributed to the reduced expression of the toxin. The results showed that, when Staph. aureus was cultured with PNCB, the haemolytic activity of supernatant was markedly attenuated in a dose-dependent manner (Fig. 1a). The addition of 4 μg ml−1 of PNCB resulted in a visible reduction in α-toxin content. However, at 16 μg ml−1, no immunoreactive α-toxin antigen could be detected in the supernatant of the tested strains. Thus, we may conclude that PNCB had significant direct effect on Hla.

Figure 1.

Effect of pinocembrin (PNCB) on Hla and RNAIII transcription in Staphylococcus aureus. (a) Western blot analysis of Hla production by Staphaureus 8325-4 treated with PNCB. Culture supernatants of Staph. aureus strain 8325-4 (lanes 1–6) grown in the absence or in the presence of PNCB were electrophoresed and blotted onto polyvinylidene fluoride membranes, and α-toxin was detected with specific rabbit antibodies against α-toxin. Lane 7, 10 ng of purified α-toxin (Sigma-Aldrich, product # H9395). (b, c) Relative expression levels of Hla and RNAIII in Staph. aureus 8325-4 with increasing concentrations of PNCB. Data are shown as the mean value ± SD of three independent experiments (**P < 0·01).

Effect of PNCB on Hla and RNAIII transcription in Staphylococcus aureus

To verify the relative expression levels of α-haemolysin after PNCB exposure, we performed real-time RT-PCR. Prince et al. (2012) reported that Hla played a key role in cell death as this toxin is a key cytolytic factor and controlled by the agr locus. It has recently been shown that agr locus is composed of two divergent transcriptional units, agr RNAII and agr RNAIII. RNAIII, a 514-nucleotide RNA effector molecule of the agr system, is involved in regulating agr-dependent gene expression at both the transcriptional and, to a lesser extent, the translational level (Manna and Cheung 2006). Here, increasing concentrations of PNCB were found to significantly reduce the transcription of Hla (encoding α-haemolysin) and RNAIII (encoding δ-haemolysin) transcription (Fig. 1b,c). Furthermore, when cultivated with PNCB at 16 μg ml−1, Hla and RNAIII transcription appeared to be affected by 7·50- and 7·01-fold, respectively.

Effect of PNCB on Staphylococcus aureus-mediated alveolar epithelial cell injury

Powers et al. (2012) have demonstrated that Staphylococcal α-haemolysin (Hla), a pore-forming cytotoxin secreted by almost all strains of Staph. aureus, directly contributes to endothelial injury. Using cocultured system, PNCB was next examined for its ability to prevent alveolar epithelial cell injury. As shown in Fig. 2(a), uninfected A549 cells retain a green fluorophore when examined with a live (green)/dead (red) staining reagent. Upon coculture of A549 cells with Staph. aureus ATCC 8325-4 in the presence of PBS control, cell death was apparent, as indicated by an increase in the number of red fluorescent dead cells (Fig. 2b). In contrast, treatment with PNCB (16 μg ml−1) provided nearly complete protection from Staph. aureus-induced death (Fig. 2c). To evaluate the protective ability of PNCB against Hla, we examined concentration-dependent protection using an LDH release assay. The data on cell death rates are shown in Fig. 2(d). As we can see, at concentrations ranging from 4 to 16 μg ml−1, PNCB conferred a significant degree of protection against Staphaureus.

Figure 2.

Staphylococcus aureus injury of human alveolar epithelial cells is reduced by pinocembrin (PNCB). Live (green) ⁄ dead (red) imaging of human A549 cells was captured using confocal laser scanning microscope 6 h after infection with Staph. aureus 8325-4. Cells were left uninfected (a) or co-cultured with Staph. aureus 8325-4 in media (b), co-cultures in the presence of 16 μg ml of PNCB (c). Lactate dehydrogenase release by A549 cells was observed by cells co-cultured with 8325-4 in medium supplemented with the indicated concentrations of PNCB (d). The data shown in panel a–c are representative of three independent experiments. The values in (d) represent the means ± SD of three independent experiments. * indicates P < 0·05 and ** indicates P < 0·01 compared to the PNCB-free co-culture.

Effect of PNCB on lung injury in Staphylococcus aureus pneumonia

Staphylococcus aureus Hla is a well-characterized toxin. Previous studies have indicated that when administered in purified form to lung tissues or to alveolar epithelial cells, Hla disrupts the integrity of cellular membranes and perturbs lung function by precipitating the accumulation of inflammatory exudates within the pulmonary alveoli (Wardenburg and Schneewind 2008). To investigate the impact of PNCB treatment on lung injury in Staph. aureus pneumonia, the mice were administered 100 μl of PNCB (50 mg.kg−1) subcutaneously 2 h after infection with Staph. aureus and then at 12-h intervals thereafter for a total of 6 doses. Our investigations on pathological manifestations of lung injury revealed that infected mice treated with 100 μl sterile PBS developed widespread tissue injury. However, treatment of mice with PNCB markedly improved the histopathologic features of pneumonia, as indicated by a reduction in the red appearance of the tissue and the accumulation of inflammatory exudates (Fig. 3a,b). As histopathologic appearance of lung injury seemed to be fully distinguishable from that seen in control mice, we conclude that PNCB appeared to be able to treat Staph. aureus pneumonia in a murine model of infection.

Figure 3.

Protective effect of pinocembrin (PNCB) against Staphylococcus aureus-induced pneumonia. The mice were infected via the intranasal route with Staph. aureus 8325-4 or DU 1090. (a) Gross pathological changes and (b) histopathology of Staph. aureus-infected lung tissue from mice that were treated with either phosphate-buffered saline or PNCB. Experimental results shown in panels (a) and (b) are representative of the results of three independent experiments.

Discussion

Staphylococcus aureus is the leading cause of bacterial infections, increasingly reported around the world. Severe invasive methicillin-resistant Staph. aureus (MRSA) infections, which include pneumonia, are more difficult to cure because bacteria come up with various ways of countering antibiotic action (DeLeo and Otto 2008). The continuing emergence of MRSA as a nosocomial pneumonia pathogen is particularly problematic not only because of its prevalence, but also because antimicrobial resistance is increasingly associated with inappropriate empirical antibiotic therapy (Niederman 2009). Emergence of resistance among commonly occurring bacterial pathogens has limited the utility of many penicillins, cephalosporins and other antimicrobial classes, driving increased utilization of carbapenems for Gram-negative pathogens, and vancomycin, daptomycin and linezolid for Gram-positive pathogens (Fritsche et al. 2008). The increasing prevalence of multidrug-resistant strains raises the spectre of untreatable staphylococcal infections, and a novel therapeutic strategy different from antibiotic treatment is required.

To be a useful agent to treat Staph. aureus pneumonia, several characteristics are important. Activity against key pneumonia pathogens, including Staph. aureus and other resistant micro-organisms, is essential. Discovering virulence factors of pathogenic bacteria is a key in identifying targets for novel drugs (Wu et al. 2008). Consequently, targeting these virulence factors is an especially compelling approach for combating Staph. aureus infections. Clinical studies have shown that Staph. aureus α-haemolysin (Hla) is a pore-forming toxin expressed by most Staph. aureus strains and reported to play a key role in the pathogenesis of pneumonia (Adhikari et al. 2012). Multiple lines of evidence confirm that Hla binds to most eukaryotic cells, often by a nonspecific adsorptive mechanism requiring micromolar concentrations of toxin. Gordon and Lowy (2008)demonstrated that Hla is responsible for mortality in a mouse pneumonia model. Alpha-haemolysin may be also involved in the loss of cardiac performance during Staph. aureus septic shock. In a rat model of sepsis, this toxin provoked coronary vasoconstriction and a loss of myocardial contractility. Immunization against α-haemolysin (Hla) protects mice against lethal pneumonia (DeLeo and Otto 2008). Based on these considerations, targeting α-toxin is promising approach for combating Staph. aureus infections.

Antimicrobial agents are essential drugs for human and animal health and welfare (OIE 2007). Since the 1940s, these drugs have greatly reduced illness and death from infectious diseases. Previous advances in research of antimicrobial effects demonstrated that only vancomycin and linezolid are currently approved in the USA for the treatment of MRSA pneumonia. However vancomycin exhibits poor penetration into lung tissue, and increasing MIC values for Staph. aureus are associated with treatment failure and poor microbiological eradication. Combining vancomycin with rifampicin, fusidic acid or fosfomycin is theoretically effective for the treatment of MRSA pneumonia although data from randomized controlled trials are lacking (Welte and Pletz 2010). MRSA getting resistant to the last-resort antibiotic (vancomycin) has been reported. These facts suggest that MRSA would acquire more resistance to vancomycin in the near future. It is therefore increasingly important and necessary to find new antimicrobial agents and to devise new measures that are effective against MRSA infection (Koyama et al. 2011). In the present study, we have shown that PNCB can inhibit the production of Hla (an agr-regulated gene) by Staph. aureus without affecting their viability. The production of many virulence factors is regulated by the accessory gene regulatory (agr) operon and several other global regulatory loci. The agr system of Staph. aureus is a global regulator of virulence factors in culture and is implicated in promoting greater disease severity in animal models of staphylococcal infection (Pang et al. 2010). RNAIII, one of the largest regulatory RNAs (514 nucleotides long), regulates the translation of α-toxin mRNA. It is also an RNA effector molecule that reciprocally regulates the transcription of cell-associated adherence factors and secreted proteins (Novick and Geisinger 2008). Herbert et al. (2001) have found that agr expression was minimally affected by subinhibitory clindamycin, which blocked the production of several of the individual exoprotein genes, including spa (encoding protein A), Hla (encoding α-haemolysin) and spr (encoding serine protease). In this study, we found that PNCB inhibits Staph. aureus pathogenesis by inhibiting the synthesis of agr transcripts RNAIII.

At present, little is known about the specific role of Staph. aureus–epithelial cell interactions, especially epithelial cell damage, in the pathogenesis and antibiotic responsiveness of endovascular infectious syndromes. Staphylococcus aureus -induced epithelial cell damage, rather than invasion, is crucial for innate virulence and vancomycin responsiveness in model of infective endocarditis. Epithelial cell damage might thus serve as a ‘biomarker’ for certain aspects of host–pathogen interactions in vivo related to Staph. aureus. Many factors have been suggested to mediate epithelial cell damage including bacterial toxins (Seidl et al. 2011). These factors may be useful in identifying pharmacological treatments that minimize cell injury and improve patient outcomes by altering the architecture of the cell wall of Staph. aureus. Here, PNCB provided a high degree of protection against Hla-mediated alveolar epithelial cell injury in vitro and can alleviate the pulmonary inflammatory reaction caused by Staph. aureus-induced pneumonia in a murine model. When compared to other components such as β-cyclodextrin IB201 (Ragle et al. 2010), farrerol, luteolin, costus oil, licochalcone (Qiu et al. 2010a,b, 2011a,b), allicin (Leng et al. 2011), PNCB seems to have a similar influential effect on antimicrobial testing. In agreement with these considerations, these data suggest that the development of cell-based therapy as a strategy to restore or protect the alveolar epithelium in injured lung tissue may be beneficial.

In summary, we have provided new evidence of the effects of PNCB, which suggests that PNCB at low concentrations exhibits in vitro inhibitory activity against α-haemolysin production and attenuates α-haemolysin-mediated cell injury. Furthermore, the in vivo findings demonstrated that PNCB protected mice from Staph. aureus pneumonia. Taken together with previous studies, these results demonstrated that PNCB developed as a promising anti-Staph. aureus agent.

Acknowledgements

This work was financially supported by the National Nature Science Foundation of China (No.3097221) and Chinese postdoctoral station of Jilin University (No. 20090461034).

Ancillary