Comparison of the antimicrobial effects of semipurified cyclotides from Iranian Viola odorata against some of plant and human pathogenic bacteria

Authors


Correspondence

Mahboobeh Zarrabi, Department of Biology, Faculty of Science, Alzahra University, Vanak St, Tehran, Iran. E-mail: mzarrabi@alzahra.ac.ir

Abstract

Aims

Cyclotides are mini-proteins that are synthesized via the ribosomal pathway. They have a variety of biological activities such as antimicrobial, antitumour, anti-HIV activities. Because of their various bioactivities and unique stability, they are suitable candidate in drug design applications. The main aim of this study was to determine new antimicrobial agents, which can be used instead of chemical antibiotics. For this reason, we compared the antimicrobial effects of semipurified cyclotides against human and plant pathogenic bacteria.

Methods and Results

The cyclotides were isolated from the Iranian plant Viola odorata by fractionation methods and semipurified on a SPE-C18 column chromatography. Antimicrobial activities of extracted cyclotides were studied by radial diffusion assays (RDAs), minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC). Data analysis showed that MIC of semipurified cyclotides was 1·6 mg ml−1 against Staphylococcus aureus, gram-positive bacteria. It was also revealed they are the most susceptible among human pathogenic bacteria used in this research. On the other hand, plant pathogenic bacteria are more susceptible than human pathogenic bacteria.

Conclusion

The results of the study show that cyclotides from Iranian V. odorata have potent antimicrobial activity against gram-negative, plant pathogenic bacteria.

Significance and Impact of the Study

This study is a part of our extended researches on finding new pharmaceutical potentials of plants and on developing new peptides for special purposes in a way that does not have harmful side effects or have the least side effects.

Introduction

Cyclotides are a family of circular peptides that have approximately 30 amino acid residues. Their N- and C-termini are connected via an amide bond, resulting in a circular backbone. The cyclic backbone of a cyclotide consists of six segments (or loops) between successive conserved Cys residues (Dutton et al. 2009; Ireland et al. 2010,b; Daly et al. 2010; Craik et al. 1999). They have a unique structurally motif, termed ‘cystine knot’, which has three disulfide bonds arranged in a knotted manner. Cyclic backbone together with cystine knot defines the cyclic cystine knot (CCK) motif that causes an extreme stability for the cyclotides against chemical, thermal and enzymatic degradation (Colgrave and Craik 1998; Cemažar and Craik 2001).

The cyclotides family due to the existence of cis-Pro falls into two subfamilies: Mobius and bracelet (Craik et al. 2004; Ireland et al. 2010,b; Pelegrini et al. 2003). The Mobius members have a cis-Pro peptide that induces a twist in the peptide's backbone but, because of the lack of cis-Pro peptide, the bracelet members do not induce so (Daly et al. 2010; Henriques and Craik 2008).

Cyclotides are isolated from different plant families such as Rubiaceae, Cucurbitaceae, Violaceae (Dutton et al. 2009; Daly et al. 2010) and Fabaceae. More than 200 different cyclotides have been reported in CyBase and other protein databases.

They have wide range of biological activities such as cytotoxic, haemolytic, antibacterial, anti-HIV and uterotonic activities (Zhang et al. 2004). But their natural function appears to be as plant defence molecules on their insecticidal and molluscicidal properties (Ireland et al. 2010,b). So it seems that plant pathogenic bacteria are more sensitive to cyclotides than human ones.

Two features of these peptides, that is, extraordinary stability and bioactivity, open up possibilities for cyclotides to be used in pharmaceutical and agricultural applications.

Unlike other natural circular peptides such as cyclosporine and bacitracin, which are synthesized by nonribosomal peptide synthesizes, cyclotides are products of the gene (Gruber et al. 2008). Their gene encodes a precursor protein that contains an endoplasmic reticulum (RE) signal, a pro-domain, an N-terminal repeat (NTR) domain, one or more mature cyclotide domains and a C-terminal tail domain.

Cyclotides are produced in all plant tissues such as leaves, flowers, stems and roots. There is evidence for tissue specific expression of cyclotides; some of them are only expressed in the aboveground tissues (Trabi and Craik 1999). It is known that cyclotide expression varies based on the environmental conditions such as habitat or season.

In this study, we examined the expression of cyclotides at transcriptional level in Iranian Viola odorata L. that has been used in traditional Islamic medicines for the treatment of asthma and bronchitis, respiratory ailments, coughing, skin irritations, acne, eczema, inflamed gums and sore throat. In this research, 3 genes of cyclotides were identified, of which 2 were expressed at the transcriptional level. Also the antibacterial effect of semipurified cyclotides against several pathogenic bacterial species was determined. Cyclotides, like other antimicrobial peptides, have amphipathic properties. There are several experimental evidences that cyclotides interact with target cell membranes and induce leakage of enclosed content from the cells and disrupt them. Here, we report that antimicrobial effects of cyclotides are more robust against plant pathogenic bacteria rather than human ones.

Materials and methods

Plant

Plant material of V. odorata was collected from West Mazandaran, North Iran, at mid-day in April 2011 and was identified by Dr. Kanani from the Institute of Medical Plants, University of Shahid Beheshti (Tehran, Iran).

Plant extraction

To obtain cyclotides, we used a fractionation protocol described by Claeson et al. 2006;. In this method, powdered plant leaves (30 gr), dried at 55°C, were extracted with 300 ml of dichloromethane (Dr. Mojallali Chemical Laboratories, Terhran, Iran) at room temperature in a shaking table to remove hydrophobic compounds and chlorophyll molecules. This step was repeated five times. Hydrophobic compounds and chlorophylls were eliminated at this stage. The plant residues were dried at room temperature, and the main extract was then washed with 300 ml of EtOH:H2O (1 : 1, V/V) in an similar manner. The acidified extract with 2% acetic acid was passed through the polyamide filter (Fulka) to remove polyphenolic and tannin compounds. Tannin extract powder (1 gr) was partitioned between 100 ml of H2O and 100 ml of n-butanol (MERCK, Darmstadt, Germany), three times (Broussalis et al. 2001). The butanolic phases were collected and then lyophilized.

Solid-phase extraction

The lyophilized butanolic extract (25 mg) was dissolved in ammonium acetate buffer (50 mmol l−1, pH = 8) and then loaded onto a C18 SPE (MACHEREY-NAGEL,Duren, Germany) cartridge that was previously activated with methanol and equilibrated with the same buffer (Claeson et al. 2006; Poth et al. 2001). The cartridge was washed with ammonium acetate buffer (50 mmol l−1, pH = 8) for removing unwanted, interfering and weakly retained substances. Then to separate the hydrophilic noncyclotide compounds from the hydrophobic cyclotide compounds, the column was washed with 50 and 80% aqueous EtOH (V/V), and the samples were collected separately.

The presence of cyclotide in each fraction was verified by reverse phase HPLC, and the mass range properties of the extract compounds were analysed by tricine–SDS-PAGE. Bradford assay was used to determine the concentration of peptide.

RP-HPLC analysis

The solutions obtained with 50 and 80% aqueous EtOH were analysed by C18 RP-HPLC column (5 μm, Knauer, 25 × 4 mm) under gradient conditions, starting with 60% solvent A (water and 0·1% TFA) at a flow rate of 1 ml min−1 and continued until the mobile phase reached 95% solvent B (CH CN, 0·1% TFA) after 25 min. The eluents were monitored using a UV detector set to 215 nm. Due to hydrophobic surface, cyclotides were eluted at a late retention time.

Tricine–SDS-PAGE

Tricine–SDS-PAGE method described by Schagger and Jagow (2006) was used to confirm the molecular weight of cyclotides, which has previously been reported between 2500 and 5000 Da. Tricine is an organic compound that is used in buffer solutions. It is a zwitterionic amino acid with a useful buffering range of pH 7·4–8·8. It has a lower negative charge than glycine, allowing it to migrate faster. Its high ionic strength causes that low molecular weight proteins are separated in lower percentage acrylamide gels. So this method is able to separate proteins in the mass range of 1–100 kDa (Schagger 2010).

Bacterial strains and media

Antibacterial activity of semipurified cyclotides was evaluated against two species of plant pathogenic bacteria: Xanthomonas oryzae and Ralstonia solanacearum (provided by the Tehran University of Medical Sciences), and three species of human pathogenic bacteria including Escherichia coli (ATCC 25922), Pseudomonas aeruginosa (ATCC 27853) and Staphylococcus aureus (ATCC 25923) (provided by Iranian Research Organization for Science and Technology- IROST). The bacterial strains are described in Table 1. All human pathogenic bacteria were kept on nutrient agar (MERCK) at 4°C, and the plant pathogenic species were kept on Trypticase soy agar (MERCK) at 4°C (for X. oryzae) and room temperature (for R. solanacearum).

Table 1. Bacterial species used in this study
DescriptionStandard numberBacterial species
G−, human pathogenic bacteria, antibiotic resistanceATCC 25922 Escherichia coli
G−, human pathogenic bacteria, antibiotic resistanceATCC27853 Pseudomonas aeruginosa
G+, human pathogenic bacteria, antibiotic resistanceATCC25923 Staphylococcus aureus
G−, plant pathogenic bacteriaIsolated Xanthomonas oryzae
G−, plant pathogenic bacteriaIsolated Ralstonia solanacearum
G−, useful of soil bacteria, fixation of N2.Isolated R. cicil
G−, useful of soil bacteria, production of cellulose.IsolatedBacillus sp.

Antimicrobial assay

In this study, a modified radial diffusion assay (RDA), minimal inhibitory concentration (MIC) assay described by Pranting et al. (2011) and minimal bactericidal concentration (MBC) assay were used to evaluate the antibacterial effects of cyclotides.

In RDA, the bacteria were grown in (3% W/V) TSB at 37°C to obtain mid-logarithmic phase organisms, that is, their optical density at 620 nm was equal to 0·3. Then, 1 ml of the culture was centrifuged at 3400 g for 10 min at 4°C. The bacterial cell pellet was washed once and resuspended in sodium phosphate buffer (SPB) (10 mmol l−1, pH = 7·4). Next, 4 × 106 cfu ml−1 was added to 10 ml of the medium containing 0·03% W/V TSB (Merck), 1% W/V LE agarose (Roche Diagnostics, Meylan, France) and 0·02% V/V Tween 20 (Merck) in SPB (10 mmol l−1, pH = 7·4). After dispersing the bacteria, the mixture was poured into a petri dish. Evenly spaced wells with 3 mm in diameter were made, and 5 and 10 μl of the semipurified cyclotide samples were added to each well. The cyclotide samples were 50 and 80% aqueous EtOH eluents that were dried at room temperature and redissolved in 10% DMSO. The control wells contained 5 and 10 μl of 10% DMSO. The plates were incubated for 3 h at 37°C to diffuse the peptide. Then, 10 ml of overlay agar containing 6% (W/V) TSB and 1% W/V LE agarose in SPB (10 mmol l−1, pH = 7·4) was added each plate. After incubation for 18–24 h at 37°C, the diameter of the clear zone surrounding the well was measured.

MIC and MBC assays

The bacteria were grown overnight in SPB (10 mmol l−1, pH = 7·4)/0·1% TSB. Then, 90 μl of the diluted bacterial solution (~5 × 105 cfu ml−1) was added to each well of 96-well microtitration plates. Then, 10 μl of the peptide solution of different concentrations was added to peptide solution of different concentrations and mixed well. After incubation for 24 h at 37°C, turbidity of each well was measured at 620 nm.

To identify MBC, the bacterial solutions incubated with different concentrations of peptide solution for 24 h were cultured in TSA plate at 37°C for 24–48 h. Then, bacterial growth was examined. To determine the stability of antibacterial activity during 3 months, RDA, MIC assay and MBC assay were performed in different time periods: 1, 2 and 3 months after extraction of cyclotides. The experiments were repeated 3 times, and the average of measurements was reported.

Genomic DNA extraction

Genomic DNA was extracted from V. odorata leaves using the modified protocol described by Pirtila et al. (2007). In this study, the extraction buffer did not include PVP. The primers to amplify the cyclotide genes were designed against the conserved region of cyclotide precursor transcripts and are shown in Table 2. The PCR conditions comprised 30 cycles with the following programme: 95°C, 1 min; 60°C, 30 min; and 72°C, 1 min. The PCR products were gel-purified with a QIAquick Gel Extraction Kit (QIAgene, Hilden, Germany).

Table 2. Sequence and features of primers used
Primer nameSequenceTm (ºC)Length of fragment

Forward A

Reverse A

GACCTTTGAGAAAGATTTCATCAC

AAGGAGACATCAAACCACGC

64·2

63·8

570 bp

voc-A

Forward B

Reverse B

GACCTTTGAGAAAGATTTCATCAC

GCAAACACACGAGCGGAG

64·2

63·8

444 bp

voc-B

Forward C

Reverse C

AGTCTGCACCAGAAACTCTCTTG

GGTAAATCCATATGTCACGAGC

65

63·6

479 bp

vok-C

RNA isolation and reverse transcription-PCR

Total RNA was isolated from V. odorata leaves using Ambion's RNAqueous®system-Midi Kit (Ambion, Austin, TX, USA). Reverse transcription reaction was then carried out by Expand Reverse Transcriptase Kit (Roche). cDNA was then subjected as template in PCR as with previous conditions to analyse gene expression in transcription level.

Results

This study aimed to examine the presence of cyclotides in the native Iranian V. odorata and changes of their expression profile according to the environmental conditions. We further evaluated the antibacterial activity of cyclotides against human and plant pathogenic bacteria. To obtain and isolate the desired cyclotides, fractionation protocol (FP), solvent–solvent partitioning (SSP) and solid-phase extraction (SPE) methods were used, and then, the presence of cyclotides was confirmed by RP-HPLC and tricine–SDS-PAGE methods.

Cyclotide isolation

After removing the compounds interfering with the antimicrobial bioactivity, the existence of cyclotides was verified by RP-HPLC chromatography. Cyclotides elute late on HPLC (Fig. 1). Also the molecular weight of semipurified cyclotides using tricine–SDS-PAGE methods was determined as ~ 5000 Da (Fig. 2).

Figure 1.

RP-HPLC chromatogram. Solution obtained with 50% (a) and 80% (b) aqueous EtOH.Peaks a, b, c and d increase non-polarity feature.

Figure 2.

Tricine-SDS-PAGE. lane1: molecular weight of protein marker. Lane2: Solution obtained with 50% aq EtOH. Lane 3: Solution obtained with 80% aq EtOH. Arrow: Cyclotide.

Identification of 3 cyclotide genes and investigation of cyclotide expression

Three cyclotide genes were identified from the leaves, DNA (Fig. 3a). After cDNA was constructed, PCR was carried out with specified primers, and the results revealed that 2 of 3 cyclotide genes introduced in this study have been transcribed (Fig. 3b).

Figure 3.

Identification of three cyclotide genes (a), consideration of expression of cyclotides (b). a: voc-A gene, b: voc-B, c: voc-C, S.M: DNA size marker.

Antibacterial activity

To identify which SPE fractions have stronger antibacterial bioactivity, we used the solutions obtained with 50 and 80% aqueous EtOH (namely solution A and B, respectively) for RDA, MIC assay and MBC assay.

Radial diffusion assay

RDA is a sensitive method to indicate the bioactivity of antimicrobial peptides. In this method, antibacterial activity is measured based on the diameter of clear zone (mm). Both solutions (A and B) inhibited the growth of all species used in this study, but solution A was more effective (Tables 3 and 4). Additionally, the results ascertained that the plant pathogenic species are more susceptible than human ones. Plant pathogenic bacteria were more susceptible to cyclotides that human ones, suggesting that cyclotides play role in host defence system. The antibacterial effect of semipurified cyclotides against all species of bacteria was constant with time.

Table 3. Radial diffusion assay results against human pathogenic bacteria
BacteriaSolution AaSolution Bb
5 μl10 μl5 μl10 μl
1 month2 months3 months1 month2 months3 months1 month2 months3 months1 month2 months3 months
  1. a

    The solution obtained with 50% aqueous EtOH from SPE column.

  2. b

    The solution obtained with 80% aqueous EtOH from SPE column.

  3. c

    Diameter of inhibition zone (mm) that reported as 3 repeated average ± standard deviation.

Escherichia coli (ATCC 25922)12·33 ± 0·57c12 ± 012·25 ± 0·3512 ± 013·33 ± 0·5713 ± 08 ± 08·66 ± 0·579 ± 010·66 ± 0·5710 ± 010 ± 0
Pseudomonas aeruginosa (ATCC 27853)10·33 ± 0·5710·33 ± 0·5710·5 ± 0·7113·3 ± 1·1513·33 ± 1·1513·5 ± 0·716·33 ± 0·576·16 ± 0·766·5 ± 0·718·66 ± 0·578·66 ± 0·579 ± 0
Staphylococcus aureus (ATCC 25923)15·33 ± 0·5715·66 ± 0·5715 ± 017 ± 018·16 ± 0·2817·5 ± 0·7112·33 ± 0·5712·66 ± 0·5712 ± 014·33 ± 0·5714·66 ± 0·5714·5 ± 0·71
Table 4. Minimal inhibitory concentration (MIC) assay results against human pathogenic bacteria
BacteriaSolution AaSolution Bb
MIC (μg ml−1)MBC (μg ml−1)MIC (μg ml−1)MBC (μg ml−1)
  1. a

    The solution obtained with 50% aqueous EtOH from SPE column.

  2. b

    The solution obtained with 80% aqueous EtOH from SPE column.

Escherichia coli (ATCC 25922)3·26·428·3528·35
Pseudomonas aeruginosa (ATCC 27853)6·412·814·214·2
Staphylococcus aureus (ATCC 25923)1·61·677

MIC and MBC assays

Although RDA is a sensitive and useful method to detect antimicrobial activity, but it has disadvantages in interpreting the potency of the peptides and in evaluating whether the cells have actually been inhibited or killed. To verify the results of the RDA, MIC assay and MBC assay were assigned against all of the used bacteria. The results of MIC and MBC against human and pathogenic bacteria are presented in Table 4. The MIC and MBC results were in accordance with the RDA results. They further confirmed that solution A was more active than solution B.

Staphylococcus aureus is the most sensitive bacterium against cyclotides among the tested human pathogenic bacteria. Table 4 reveals that the MIC of solution A is 1·6, 3·2 and 6·4 μg ml−1 against Staph. aureus, E. coli and Ps. aeruginosa, respectively. The results of RDA, MIC assay and MBC assay uggest that cyclotides may be utilized for agriculture goals. However, to find out that they are not active against useful soil bacteria, RDA was performed against Rhizobium cicil and Bacillus sp. The results revealed that antimicrobial effects of cyclotides on useful soil bacteria are much less than on plant pathogenic bacteria (Table 5).

Table 5. Radial diffusion assay results against plant pathogenic bacteria and useful of soil bacteria
BacteriaSolution AaSolution Bb
5 μl10 μl5 μl10 μl
1 month2 months3 months1 month2 months3 months1 month2 months3 months1 month2 months3 months
  1. a

    The solution obtained with 50% aqueous EtOH from SPE column.

  2. b

    The solution obtained with 80% aqueous EtOH from SPE column.

  3. c

    Diameter of inhibition zone (mm) that reported as 3 repeated average ± standard deviation. ND: nondetermined.

Xanthomonas oryzae 18·66 ± 0·57c17·66 ± 0·5717·5 ± 0·7119·33 ± 0·5720 ± 020·5 ± 0·7114 ± 014·66 ± 0·5714 ± 015·66 ± 0·5715·66 ± 0·5716 ± 0
Ralstonia solanacearum 20 ± 0NDND22·33 ± 0·57NDND13·66 ± 0·57NDND16 ± 1NDND
R. cicil 11·66 ± 0·5712·67 ± 0·5712 ± 014 ± 014·33 ± 0·714·5 ± 0·710 ± 011 ± 010·25 ± 0·7111·33 ± 0·5713·33 ± 0·5711·57 ± 0·71
Bacillus sp.12 ± 112·67 ± 0·5711 ± 013·33 ± 0·5714·33 ± 0·5713 ± 010 ± 010·33 ± 0·288·5 ± 0·7111 ± 011·66 ± 0·5710·5 ± 0·71

Discussion

Based on homology sequences, cyclotides fall into two subfamilies: bracelet and Mobius, although their nomenclature is based on the presence or absence of cis-proline peptide bond. In this study, we reported 3 genes of cyclotide family; according to the phylogenetic tree (Fig. 4), one of them belongs to Mobius subfamily, and the two others belong to bracelet subfamily.

Figure 4.

Phylogenetic tree of cyclotide peptides from Violaceae family.

Cyclotides have been found in every Violaceae species screened to date (Gruber et al. 2008; Daly et al. 2010). Cyclotide's expression profile changes according to the environmental conditions and ecosystem. So here, we hypothesized that cyclotide sequence and expression profile are different between Iranian V. odorata and the one grown in Australia. cDNA analysis demonstrated that 2 of the above 3 genes are expressed at transcriptional level, whereas all of three genes are expressed in Australian V. odorata. On the other hand, alignment of known cyclotide sequences from the literature with the sequences reported in GenBank shows that not only cyclotide expression profile varies under different environmental conditions, but cyclotide sequences vary, too (Fig. 5).

Figure 5.

Multiple peptide sequences alignment. Very light grey: different amino acid residue; light grey: similar aminoacid residue; dark grey: identical amino acid residue.

In the current study, we examined the antibacterial activity of cyclotides against human and plant pathogenic bacteria. Staph. aureus was found to be more sensitive against cyclotides than other gram-negative human pathogens (of course, this conclusion is a bit too early, and more bacterial species should be investigated). The results showed that cyclotides can be applied to protect against bacterial infections. The antimicrobial characteristics of cyclotides have been examined in three previous studies (Gran et al. 2004; Pranting et al. 2011; Tam et al. 1987).

In the study by Tam et al., cyclotides were found to be more effective against Staph. aureus (gram-positive bacteria) than against gram-positives; this finding is in accordance with the results of the present work. On the other hand, Gran et al. and Pranting et al. showed that gram-negatives are more susceptible than gram-positives. In this research, a complex mixture of cyclotides was used for determining the antibacterial activities. It is possible that some cyclotides have synergistic effects with each other on killing gram-positives or have antagonistic effects on the cell death of gram-negatives. However, plant pathogens are more sensitive than human ones (Fig. 6).

Figure 6.

Antimicrobial effects of solution A against all used bacterial species.

As inferred from the results, the most sensitive tested bacterium against cyclotides is a plant pathogenic gram-negative bacterium. The possible reason that some gram-negative bacteria such as E. coli ATCC 25922 are less susceptible than gram-positive bacteria such as X. oryzae to cyclotides is the difference between the membrane of the bacteria or that cyclotides specifically bind to specific receptors on the surface of target cells. All of these possibilities are proper subjects for future studies.

Figure 7.

Effects of timing on antimicrobial activity of solution A against of used bacterial species. (image_n/jam12251-gra-0001.png) 1st month; (image_n/jam12251-gra-0002.png) 2nd month and (image_n/jam12251-gra-0003.png) 3rd month.

Therefore, application of cyclotides in agriculture and biological control is convenient, but the matter will be challenged by the effects of cyclotides against useful soil bacteria (Table 5). So using genetic engineering methods to inhibit plant bacterial diseases is suggested.

The shelf-life of cyclotides was also studied in this research. The results showed that antibacterial effects of cyclotides were constant after 1, 2 and 3 months (Fig. 7). Stability of cyclotides against heat, chemicals and proteases is due to their unique structure.

These features make cyclotides as templates for drug design applications.

The nucleotide sequences identified in this study have been submitted to GenBank under the following accession numbers:

  • BankIt1588540seq1KC417290
  • BankIt1588540seq2KC417291
  • BankIt1589798seq1KC417292
  • BankIt1589798seq2KC417293
  • BankIt1589798 seq3KC417294

Acknowledgements

Iran National Science Foundation (INSF) is gratefully acknowledged for financial support of this work (Project 88000118).

Ancillary