Developing a real-time quantitative loop-mediated isothermal amplification assay as a rapid and accurate method for detection of Brucellosis

Authors

  • M. Soleimani,

    1. Tasnim Biotechnology Research Center (TBRC), Faculty of Medicine, AJA University of Medical Sciences, Tehran, Iran
    Search for more papers by this author
  • S. Shams,

    1. Biotechnology Research Center, Qom University of Medical Sciences, Qom, Iran
    Search for more papers by this author
  • K. Majidzadeh-A

    Corresponding author
    1. Academic Center for Education, Culture & Research (ACECR), The Breast Cancer Research Center (BCRC), Tehran, Iran
    • Tasnim Biotechnology Research Center (TBRC), Faculty of Medicine, AJA University of Medical Sciences, Tehran, Iran
    Search for more papers by this author

Correspondence

Keivan Majidzadeh-A, Tasnim Biotechnology Research Center (TBRC), Faculty of Medicine, AJA University of Medical Sciences, Etemadzadeh Ave, West Fatemi, Tehran, Iran.E-mail: kmajidzadeh@razi.tums.ac.ir

Abstract

Aim

The aim of this study was designing a LAMP method for the rapid detection of Brucella and development of a sensitive quantitative-LAMP (Q-LAMP) assay for quantification of brucellosis.

Methods and Results

In this study for the LAMP detection of the causative agent of brucellosis, we used specifically designed primers to target the omp25 conserved gene of Brucella spp. The sensitivity of the LAMP method was evaluated by preparing serial tenfold dilution of omp25 gene containing plasmid followed by performing the LAMP reaction. To improve the assay as a quantitative test, LAMP products in the serial dilution were evaluated by Loopamp real-time turbidimeter system and then standard curve was generated by plotting time threshold values against log of copy number. The assay specificity was evaluated using Brucella genomic DNA and a panel containing genomes of 11 gram-positive and gram-negative organisms. The LAMP assay was highly specific and no amplification products were observed from the non-Brucella organisms. The test sensitivity for visual detection of turbidity or fluorescent colour change and also agarose gel electrophoresis was 560 ng and 5·6 ng, respectively. The lower limit of detection was 17 copies of the gene that could be detected in 50 min.

Conclusions

The results of this study indicated that the LAMP assay is a simple, rapid, sensitive and specific technique for detection of Brucella spp. that may improve diagnostic potential in clinical laboratories.

Significance and Impact of the Study

The LAMP assay because of the simplicity and low cost can be preferred to other molecular methods in the diagnosis of infectious diseases.

Introduction

The members of the Brucella spp. are small gram-negative, aerobic, facultative intracellular bacteria which able to multiplied within macrophages (Cutler et al. 2005). The genus Brucella is divided into six classic species including Br. abortus, Br. melitensis, Br. suis, Br. ovis, Br. canis and Br. neotome. This classification is mainly based on the host specificity and pathogenicity of the bacteria. (Moreno et al. 2002) Brucella spp. can cause disease in both animals and humans. Human brucellosis is considered as a life-threatening disease and is the result of animal products consumption, direct contact with infected animals and their carcass. The most common species that cause infection in human are Br. abortus, Br. melitensis and Br. suis. The disease's complications in domestic animals are abortion and infertility in females or orchitis and epididymitis in males that can cause public health problems and economic concerns in different countries (Roth et al. 2003; AkIncI et al. 2006; Russo et al. 2009). Diagnostic methods recommended for detecting brucellosis are microbiological, molecular and serological tests. Although the gold standard for diagnosis is isolation of pathogen by culture, but this method is time consuming and is not always reliable. Also sensitivity of the culture is low (between 50 and 90%) that depends on disease stage, culture medium, etc. (Zerva et al. 2001; Noviello et al. 2004) In serological assays such as complement fixation test, agglutination test and enzyme-linked immunosorbent assay (ELISA), the diagnosis of active cases of disease is difficult because vaccination may yield false-positive. Also structural similarity of Brucella LPS with other gram-negative bacteria such as Escherichia coli O157:H7, Vibrio cholerae, Salmonella group N, etc. may show varying degrees of the cross-reaction (Orduna et al. 2000; Redkar et al. 2001; Franco et al. 2007). There are different molecular methods (for example PCR and real-time PCR) that are sensitive and specific for Brucella spp. detection but the tests need expensive equipments and skilled technicians (Al-Nakkas et al. 2005).

LAMP assay is a novel gene amplification technique which characterized by use of 4–6 primers that recognize specific regions on the target DNA. The LAMP reaction is carried out at a constant temperature (between 60 and 65°C) in less than an hour without need to special reagent. Therefore, it can be used for the molecular detection of various bacteria, viruses, fungi and parasites (Notomi et al. 2000; Aryan et al. 2010; Han and Ge 2010; McKenna et al. 2011).

The aim of this study was to design and develop a sensitive and specific LAMP assay based on the conserved region of omp25 gene for the rapid detection of Brucella spp. and also to develop a sensitive quantitative-LAMP (Q-LAMP) assay for quantification of this pathogen in various samples. Therefore, our study is the first report describing a quantitative diagnostic test for detection of Brucella using Q-LAMP.

Material and methods

Sequence alignments and primer design

Initially, omp25 sequences of Brucella spp. were obtained from GenBank of National Center for Biotechnology Information (with accession numbers: AM712381.1, AM712382.1, AM694630.2, AM694648.2, AM694603.2, AM694585.2, AM694837.2, AM694900.2, AM694936.2, AM694954.2, AM694873.2, AM884817.1, AM695557.2, AM695575.2, AM695566.2, AM695584.2, AM694459.2, AM694486.2) and multiple alignments were performed using CLC Sequence Viewer 6.4 (CLC bio, Aarhus, Denmark). Then, a set of six Brucella-specific LAMP primers containing loop primers was designed based on the conserved sequences of the target gene by online software program (Primer Explorer V4) from Eiken chemical (http://primerexplorer.jp/e/). The theoretical specificity of the designed primers was confirmed by in silico analysis using BLAST and Primer-BLAST on NCBI Server (http://www.ncbi.nlm.nih.gov/). The primers used in present study are listed in Table 1. The primers were custom synthesized in a commercial source (Bioneer, Daejeon, Korea).

Table 1. Primer sequences for omp25 gene of Brucella spp. in the LAMP assay
PrimerSequence (5′–3′)Reference
F3TGGTGGCTATACCGGTCTTThis study
B3GACTTCCAGGCCGTCCTT
FIPTCCAATCGTCAGGCTTGATGCTTGGCTACGGTGGAACAA (F1c-F2)
BIPCGCCTTTGCTGGCTGGAACTTCTTGGCCCAGGAATAACCT (B1-B2c)
LFACGGTGCTGGTCTTGGC
LBGGACCAGATCGTATACGGTGT

The LAMP assay

The LAMP reaction was performed in 25 μl volume containing 40 pmol−1 of each inner primers (FIP and BIP), 5 pmol−1 of each outer primers (F3 and B3), 20 pmol−1 of the loop primers (LF and LB) (Table 1), 1·4 m mol l−1 each deoxynucleotide triphosphate, 1 mol l−1 betain (Sigma, St Louis, MO, USA), 20 m mol l−1 Tris–HCl (pH 8·8), 10 mmol l−1KCl, 10 mmol l−1 (NH2)SO4, 8 mmol l−1 MgSO4, 0·1% Triton X-100, 25 m mol l−1 MgSo4, 8 U of Bst DNA polymerase large fragment (New England Biolabs, Ipswich, MA, USA) and 2 μl of template genomic DNA. In addition, 25 μ mol l−1 calcein (Dojindo Molecular Technologies, Inc., Tokyo, Japan) as a fluorescent metal indicator was added to reaction. The mixture was incubated at 63°C for 60 min in a Loopamp real-time turbidimeter (LA-320C; Teramecs, Kyoto, Japan), which turbidity readings were obtained in the reaction mix at 650 nm every 6 s. Finally, the reaction was terminated by heating at 80°C for 5 min. The LAMP reactions were examined by electrophoresis of products on 2% agarose gel and direct visual observation to judge turbidity or colour changes. For the specificity confirmation of the LAMP assay, the amplified product was digested with MboI restriction enzyme (Fermentas, Vilnius, Lithuania) at 37°C for 7 h and then was electrophoresed on 2% agarose gel.

Specificity of the LAMP assay

For evaluating specificity of the test, the LAMP reactions same as above were performed using genomic DNA of Br. abortus, Br. melitensis and also genomic DNA of non-Brucella organisms (Shigella sonnei ATCC 9290, Klebsiella pneumoniae ATCC 7881, E. coli ATCC 25922, Bacillus subtilis ATCC 6051, Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, Enteropathogenic Escherichia coli (EPEC) ATCC 43887, E. coli O157:H7 ATCC 43895, Yersinia enterocolitica ATCC 23715, Streptococcus pneumonia ATCC 700669 and Coxiella burnetii Nine Mile strain ATCC VR-615). The reactions were evaluated with the Loopamp real-time turbidimeter. Electrophoresis on 2% agarose gel was carried out to confirm results of the reactions.

TA cloning and preparation of standard plasmid

After PCR amplification of the omp25 gene of Br. melitensis using F3 and B3 primers, TA cloning of the product was carried out. For this purpose, the PCR product was purified using the PCR Purification Kit (Bioneer). The purified omp25 gene fragment with length of 196 bp was ligated into pTZ57R/T vector by 1 U of T4 DNA ligase according to work instructions of InsTAclone™ PCR Cloning Kit (Fermentas). Competent cells of E. coli JM107 were transformed with the ligation reaction product. The transformed cells were incubated at 37°C for 24 h on Luria-Bertani (Merck, Darmstadt, Germany) medium containing 38·4 μg ml−1 IPTG (isopropyl-beta-D-thiogalactopyranoside) (Sigma, St. Louis, MO, USA), 40 μl ml−1 X-gal (5-bromo-4-chloro-3-indolyl beta D- galactoside) (Sigma), 50 μg ml−1 nalidixic acid and 100 μg ml−1 ampicillin (Merck). Recombinant clones on the medium were identified by blue/white screening and some white colour colonies containing recombinant vector were selected for further evaluation. Then, plasmids of the selected clones were extracted by AccuPrep Plasmid Mini Extraction kit (Bioneer) and omp25 gene containing recombinant plasmids were confirmed by PCR with outer primers (F3 and B3). Digestion by MboI restriction enzyme was used for final confirmation of the positive clones. The confirmed plasmid was named pTZ57R/T-omp25 and quantified using UV absorbance measurement at 260 and 280 nm and further used in the sensitivity testing, quantitative evaluation and as positive control in the LAMP assay.

Sensitivity of the LAMP assay and quantitative test

Sensitivity of the LAMP assay was evaluated using serial tenfold dilution of pTZ57R/T-omp25 plasmid from 560 ng to 56 × 10−4 fg (17 × 107to 17 × 10−4 copy number). To detect amplified target DNA in the reactions containing above concentrations, the following methods were used: real time turbidity measurement with Loopamp real-time turbidimeter, visual observation of turbidity by naked eye, direct and under UV lamp visualization of fluorescent and electrophoresis on 2% agarose gel. Finally, detection limit (LOD) of the LAMP assay was determined. To quantify the copy number of omp25 gene when performing the assay with Loopamp real-time turbidimeter, standard curve was generated by plotting the Tt (Time threshold) values against log copy number and linear regression was calculated using Microsoft Excel program.

Results

Analysis of the LAMP products and cloning

In the tubes with positive reaction for isothermal amplification, the turbidity comprised of the white magnesium pyrophosphate precipitation was observed by naked eye (Fig. 1a). In addition, colour change in the tubes was seen under UV light because calcein reagent in the mixture had been combined with magnesium ions and had produced greater green fluorescence (Fig. 1b). Electrophoresis of the products on 2% agarose gel was showed a clear ladder-like DNA amplification (Fig. 1c). Furthermore, the results which were confirmed by MboI restriction enzyme digestion of the LAMP product, yielded the sizes predicted theoretically (70 and 126 bp) (data not shown). Also, effect of the loop primers on the diminution of incubation time was explored. In the reactions without the loop primers, optimal time for isothermal amplification was 50 min whereas in the reaction containing the loop primers, this time was obtained in 32–35 min as minimum time. In the cloning process, PCR assay with the outer primers (F3 and B3) on the extracted recombinant omp25-plasmids from white colonies yielded a clear and sharp band on 2% agarose gel about 200 bp. Also, results of MboI digestion of the plasmid confirmed the right cloning (data not shown).

Figure 1.

Sensitivity of the LAMP assay based on tenfold of serial dilution of pTZ57R/T-omp25. (a) Turbidity assay by naked eye. (b) Visual inspection by adding calcein. Tube 1-11, serial dilution of 10−1 to 10−11; tube 12, negative control. (c) Electrophoresis of the products: Ladder-like pattern on the gel. Lane M, 100 bp DNA ladder; lanes 1–11, serial dilution of 10−1 to 10−11; lane 12, negative control. (d) A representative turbidity judgment graph. Curves 1–7, serial dilution of 10−1 to 10−7; curve 8, negative control.

Sensitivity and specificity of the LAMP assay

Results of the sensitivity assays indicated that the lowest concentration of pTZ57R/T-omp25 detected by the real-time turbidimeter was 56 fg (17 copy number) while on the agarose gel, the characteristic of ladder-like was observed to 0·56 fg (approx. 1 copy number). In addition, the visual observation of the turbidity assay and strong green fluorescent of calcein were determined up to concentration of 56 fg (consistent with real-time turbidimeter results) (Fig. 1d). In quantitative assays based on the standard curve generated by the turbidity-based real-time LAMP assay, the correlation coefficient (r2) was calculated as 0·983. For templates ranging from 17 × 107 to 17 copies of pTZ57R/T-omp25 in 25 μl, the average Tt values fell between 33·3 and 49·1 min. The LAMP assay was specific because judgment graph of the real-time turbidimeter showed exclusive amplification for Brucella spp. while this result for 11 non-Brucella bacteria species was negative. This result in agreement with in silico analysis using BLAST indicated that there were no false-positive and false-negative amplification. In addition, gel agarose electrophoresis of the LAMP products showed the characteristic ladder-like multiple bands just in the tubes containing Brucella spp. genome DNA.

Discussion

Brucellosis is a worldwide zoonotic disease that its accurate diagnosis is very important. Our study describes a rapid, sensitive and cost-effective method comparable with other DNA amplification methods that are considerably used in the diagnosis of different micro-organisms in laboratory. Various sequences in the genome of Brucella can be used for the detection of the organism, such as 16S rRNA, omp2, omp25, bcsp31 and the 16S-23S intergenic spacer region (Bricker 2002). We used the omp25 gene which is involved in synthesis of the outer membrane protein and is highly conserved among all Brucella species and is the best option for genus-level detection of Brucella spp (Edmonds et al. 2002). There are various conventional and molecular diagnostic methods for detection of the agent (Zerva et al. 2001; Noviello et al. 2004). The current molecular methods also are complex, time consuming with risk of contamination to ethidium bromide that require expensive equipment and experienced personnel. Therefore, the LAMP method, because of its many advantages can be a good alternative for the diagnosis of the disease (Okamura et al. 2008). Also, LAMP assay does not require special process and can be approved by naked eye contrary to electrophoresis. Another advantage of the LAMP method is the high resistance of Bst polymerase enzyme to some inhibitory factors in the amplification reaction. Francois et al. demonstrated that the LAMP as a robust technique is tolerant to moderate concentration of known Taq polymerase inhibitors such as bile salts, haemoglobin, EDTA, N-acetyl cysteine, NaCl, etc. (Francois et al. 2011; Kaneko et al. 2007; Liang et al. 2009). These characteristics show that using the LAMP assay in laboratories with limited equipment and in large scale (e.g. epidemiological studies) is valuable. The designed primers in this study were quite specific for the omp25 gene and amplification was carried only with DNA of Brucella, so their analytical specificity was 100%. In addition, using the designed loop primers in the mixture could increase speed and efficiency of amplification by attaching to the stem loops which formed during reaction process (Yoshikawa et al. 2004). In our study, the real-time LAMP assay was able to detect 17 copies of Brucella DNA in a reaction tube that is comparable with other molecular methods such as real-time PCR. This indicates high sensitivity of the assay so can detect the trace amounts of the DNA in clinical samples. In some studies, nonspecific amplification has been reported in high cycles of real-time PCR method (Ohtsuki et al. 2008), but in this study, false-positive and false-negative results in the LAMP assay were not observed and any cross-reactivity also with other species was not seen. It seems that the high specificity of the reaction in the LAMP assay may be due to the use of six primers (specially the designed loop primers that can improve the specificity and specificity of reaction) that recognizing distinct regions on the target sequences (Jaroenram et al. 2009). However, also the fragments generated from the omp25 LAMP assay by MboI digestion were in accordance with the sizes predicted theoretically and indicated that amplified products were completely specific and unique.

In this study, we used calcein as an intercalating dye for detecting the amplification. When adding the fluorescent dye to the reaction in the one-step assay, amplification results can be observed by naked eye as a consequence of colour change. Therefore, this system can minimize the risk of contamination in laboratory and eliminate the need for electrophoresis (Zhu et al. 2009). Although visual observation of the turbidity was similar to judgment graph of Loopamp real-time turbidimeter and calcein -fluorescence assay (56 fg), but detection by electrophoresis was twofold more sensitive (0·56 fg). Thus, Brucellosis diagnosis especially in resource-poor settings can rely on turbidity assay without need to complex instruments.

Quantifying studies in the bacteriology and the monitoring of organism DNA load in the patients with brucellosis may theoretically offer a new insight from the disease process and how the infectious agent can be eradicated from the human body (Navarro et al. 2006; Queipo Ortuño et al. 2008; Vrioni et al. 2008). In quantitative experiments of our study, the liner correlation (r2 = 0·98) between the log copy number and Tt values indicated that quantifying of the reaction in the LAMP assay is measurable.

Study of Ohtsuki et al. (2008) was the first study in the diagnosis of Brucella based on LAMP assay. For this purpose, they used bcsp31 gene and found that this method could be suitable alternative for PCR and real-time PCR methods. Their specificity was high and sensitivity of method was 10 fg of Brucella DNA (Ohtsuki et al. 2008).

Lin and his colleagues targeted omp25 gene for the detection of Brucella spp. by the LAMP method. Sensitivity of their qualitative assay when using agarose gel as product detector was determined as 9 fg, but we found it as 0·56 fg. In another study performed by Pan, the LAMP assay was designed by targeting the omp25 gene with detection limit of 10 pg (Lin et al. 2011; Pan et al. 2011). Unlike these studies, we used the loop primers that in addition to the reaction velocity, it may also be effective on the specificity of the test. Also our study is the first report about designing and developing a quantitative LAMP assay suitable for determination Brucella spp bacterial load in suspected samples. In this research also turnaround time for a test (from sample preparation to result) was approx. 55–80 min compared with at least 5–7 days, <24 h and <2 h for conventional culture-based methods, PCR and real-time PCR assays, respectively (Queipo-Ortuno et al. 2005; Ilhan et al. 2008).

Conclusions

The LAMP method because of the simplicity, low cost (per sample can be carried out about 3–6 times cheaper than PCR and real-time PCR) and no need to complex equipment can be preferred to other molecular methods.

Also, the LAMP assay for the quantitative detection of Brucella spp. was highly sensitive and specific. Therefore, this method could be a useful tool for rapid detection of Brucella spp. in epidemiologic studies and in resource limited settings in developing countries.

Acknowledgements

The authors acknowledge with grateful appreciation the kind assistance provided by the Vice Chancellor for Research at the AJA University of Medical Sciences.

Ancillary