Inhibitory effect of high-dosage zinc oxide dietary supplementation on Campylobacter coli excretion in weaned piglets

Authors


Abstract

Aims

This study investigated the impact of zinc oxide (ZnO) on Campylobacter coli by in vivo and in vitro assays.

Methods and Results

By in vitro growth inhibition assays, a high susceptibility of Camp. coli against ZnO could be observed. At concentrations ≥2·6 mmol l−1 ZnO, a decline in cell numbers occurred. Quantitative real-time PCR assays demonstrated an up-regulation of the main oxidative stress gene (katA) in response to ZnO treatment. The expression level of katA was increased by fivefold after ZnO treatment. An experiment was carried out in pigs to elucidate the impact of ZnO as feed supplement on Camp. coli faecal excretion. Feeding a high-dosage ZnO concentration (3100 mg kg−1) to piglets significantly reduced the faecal excretion of Camp. coli by up to 1 log CFU g−1 as compared to animals receiving a low (40 mg kg−1) or medium (100 mg kg−1) ZnO diet.

Conclusion

In vitro assays showed a high susceptibility of Camp. coli against ZnO. Adding high levels of ZnO to the diet of weaned piglets reduced Camp. coli excretion significantly. There is evidence for the induction of an oxidative stress response by ZnO supplementation in Camp. coli.

Significance and Impact of the Study

Supplementation of a high-dosage ZnO diet to piglets can reduce the Camp. coli load, potentially leading to a lower contamination risk of meat during slaughter.

Introduction

Worldwide, Campylobacter is one of the most common foodborne pathogens causing bacterial enteric infections in humans. After Campylobacter jejuni, Campylobacter coli is the second most important Campylobacter species for human infections. Pigs are an important reservoir for Camp. coli, with prevalences between 50 and 100% and excretion levels ranging from 2 to 7 log CFU g−1 faeces (Alter et al. 2005; Jensen et al. 2005). Faecal contamination of meat during processing is considered to be the main route of transmission. Consumption of contaminated raw minced meat was identified as a specific risk factor for Camp. coli infection (Gillespie et al. 2002). Thus, the approach is to lower the Campylobacter load in slaughter animals and to subsequently reduce the faecal contamination of meat during slaughter (Rosenquist et al. 2003).

Growing pigs (up to 20 kg body weight) require approximately 100 mg Zn kg−1 dry matter (DM) of feed and later approximately 80 mg Zn kg−1 DM. In the EU, zinc as feed supplement is usually delivered as zinc oxide (ZnO). The EU permits the feeding of 150 mg Zn kg−1 over the entire diet (Anonymous 2003). However, high concentrations ≥2000 mg kg−1 of zinc (supplemented as ZnO) have been proven to promote growth by reducing postweaning diarrhoea in commercial pig farming (Pettigrew 2006). Still, the mode of action of ZnO is not fully understood. It is suggested that ZnO provides benefit through impacts on bacterial populations in the digestive tract. The reduced incidence of diarrhoea is explained by restricting the proliferation of pathogenic bacteria in the gut (Clayton et al. 2011). Earlier studies have reported opposing results in porcine microbiota composition in pig digesta when fed with high doses of zinc. For example, Højberg et al. (2005) examined a decrease in lactic acid bacteria and lactobacilli, whereas coliforms and enterococci were more numerous in newly weaned piglets. In contrast, Pieper et al. (2012) observed that lactic acid bacteria were not influenced by high ZnO levels. Janczyk et al. (2013) reported increased shedding of salmonellae when high ZnO was fed and Liedtke and Vahjen (2012) showed that zinc resistance of commensal intestinal bacteria cannot be grouped according to their taxonomic origin, and therefore, the antibacterial activity of ZnO in the intestine of farm animals cannot be generalized.

The purpose of this study was (i) to evaluate the inhibitory effect of ZnO on Camp. coli growth in vitro, (ii) to investigate the mechanisms of ZnO action on Camp. coli and (iii) to describe the impact of ZnO feed supplementation on Camp. coli excretion in weaned piglets in an animal trial.

Materials and methods

Bacterial strains and growth conditions

Campylobacter coli 5981, originally isolated from pig faeces in 2007, was used for in vitro studies. Campylobacter coli 5981 belongs to the ST-828 clonal complex and is a typical representative of porcine Camp. coli, based on Multilocus sequence typing analysis (Sheppard et al. 2010), and encodes for the virulence factors cdtABC, cadF and ciaB. Campylobacter coli 5981 was taken from stock culture (−80°C) and grown on Mueller-Hinton agar with 5% sheep blood (MHB; OXOID, Wesel, Germany) for 48 h at 37°C in microaerobic conditions generated by the Mart Anoxomat system (Drachten, the Netherlands). Cells were inoculated in Brucella broth (BB; BD, Heidelberg, Germany) and incubated for 24 h under the same conditions.

For growth inhibition tests and for gene expression analysis, 50 μl of this broth was inoculated into 50 ml fresh BB and incubated for 16 h at 37°C microaerobically to obtain cells at the late exponential phase. To determine the cell number before and after ZnO stress, dilutions of culture aliquots were plated on MHB agar and incubated for 48 h at the same conditions. Cell counts were expressed as log10 colony-forming units (CFU) per millilitre.

Campylobacter coli growth inhibition by ZnO in vitro

A 1·3 mol l−1 stock solution from analytical ZnO powder (Carl Roth, Karlsruhe, Germany) was prepared, and solubility was achieved by adjusting the pH with concentrated HCl to pH 2. For the growth inhibition tests of ZnO on Camp. coli 5981, various ZnO concentrations were added to late exponential-phase cultures of approximately 7 log CFU ml−1 (BB contains 0·52 μg zinc ml−1 and was therefore neglected regarding the total zinc concentration in this assay). ZnO was added to the cultures with a final concentration of 0 mmol l−1 (control), 0·65 mmol l−1 (50 μg ml−1), 1·3 mmol l−1 (100 μg ml−1), 2·6 mmol l−1 (200 μg ml−1) and 3·9 mmol l−1 (300 μg ml−1). Campylobacter coli was incubated as mentioned above, and cell count was monitored in intervals over 24 h.

Gene expression analysis of Campylobacter coli 5981 after ZnO exposure

The expression of selected oxidative and general stress response genes of Camp. coli was analysed. The expression of these genes was analysed after 30 min of stress induced by (i) ZnO (1·3 mmol l−1), (ii) paraquat (0·5 mmol l−1; Th. Geyer, Berlin, Germany) or (iii) heat (46°C) to 9 log CFU ml−1 of Camp. coli 5981 in the late exponential phase (grown as mentioned above). Paraquat was used as positive control as it is known to induce oxidative stress conditions in Camp. jejuni by generating the formation of superoxide, a reactive oxygen species (ROS; Garenaux et al. 2008; Hwang et al. 2011), while heat stress induces a different set of stress response genes (Stintzi 2003).

RNA preparation and quantitative real-time PCR analysis

Total bacterial RNA was extracted from Camp. coli 5981 suspensions containing approximately 9 log CFU ml−1 using the peqGOLD Bacteria RNA Kit (Peqlab, Erlangen, Germany). A DNase treatment was performed in a total volume of 40 μl containing 4 U DNase I, 40 U Ribolock, 1× DNase buffer (all Fermentas, Leon-Rot, Germany) and 28 μl of the extracted RNA and incubated for 15 min at 37°C. DNase was inactivated by adding 4 μl 50 mmol l−1 EDTA and heating at 65°C for 10 min. For cDNA synthesis, the RevertAid Premium First Strand cDNA Synthesis Kit (Fermentas) was used. Reverse transcription of 1 μg total RNA was performed using random hexamer primers (Fermentas) according to manufacturer's instructions.

For gene expression analysis, a set of genes involved in oxidative and general stress response was selected. Primers were designed using the Primer3 software (http://frodo.wi.mit.edu/) based on the Camp. coli RM2228 genome sequence. Primers are listed in Table 1. Each 15-μl RT-qPCR mixture contained twofold SsoFast EvaGreen Supermix (Bio-Rad, Munich, Germany), specific primers (primer details are listed in Table 1) and 1 μl of a 1 : 10 dilution of cDNA as template. The amplification program started with an initial denaturation step at 95°C for 30 s, followed by 39 cycles of 95°C for 2 s and 46°C for 2 s (CFX96 real-time system; Bio-Rad). Specificity was tested by melting curve analysis (see Table 1 for Tm of PCR products). Gene expression was analysed with the inline image method described by Livak and Schmittgen (2001) using thiC expression for normalization. All samples, including no-RT and no-template controls, were analysed in biological triplicates.

Table 1. Genes and primers used for RT-qPCR analysis
Gene function/protein encodedGenePrimerSequence 5′–3′Primer conc. Fw/Rev (μmol l−1)Product size (bp)Tm (°C)
  1. Fw, forward primer; Rev, reverse primer; bp, base pairs; Tm, melting temperature of PCR product.

Catalase katA ForwardTCCCAAGCGGCATTATTACT0·3/0·310176·0
ReverseCCAACATTCTTCATCCGTGA
Alkyl hydroperoxide reductase ahpC ForwardTCAAGGGGGTATTGGTCAAG0·3/0·311977·0
ReverseCAAGCAAGAAAGAACCACGA
Superoxide dismutase sodB ForwardGGTGGCTCATGCCAAAGTAT0·3/0·311877·5
ReverseCTGAACCAAAAACCCCTGTC
Chaperone dnaK ForwardTTACTGATGCGGTGATTACTGTGC0·3/0·96575·5
ReverseTTCTTTCGTTGCTTTTCTTTGTGC
Chaperone clpB ForwardAGGAGTAGGAAAAACACAATCTGC0·3/0·98775·5
ReverseTCACTCATATCAAAGCGAATCAT
Chaperone groES ForwardCGTAGAAGAAACCAAAACAACA0·3/0·38974·0
ReverseTTACTGCTACTACTTCACCCATTA
Thiamine biosynthesis protein (reference gene) thiC ForwardTTCCTAGCGCTGATTTGTTTT0·9/0·35973·0
ReverseCCAGTTTATGATGCGGTAGGATT

Animal trials

The animal trial was approved by the local authority (Landesamt für Gesundheit und Soziales, Berlin, Germany; approval No. G0349/09). German Landrace piglets (n = 30) were received from the Leibniz Institute for Farm Animal Biology (Dummerstorf, Germany). Prior to the study, faecal samples of mother sows were tested for Camp. coli, and only piglets from Camp. coli-positive mother sows were included in this study (data not shown). Piglets (naturally infected with Camp. coli) were weaned till day 28 ± 1 (possessing an initial body weight of 8·5 ± 0·9 kg). Piglets were transferred to the experimental facility where they were allocated to three treatment groups (each group, n = 10), based on litter origin, gender and weight. Animals were housed in pens, pairwise. One pen was considered an experimental unit. Feed was mixed with some water and was offered twice daily for an hour as semi ad libitum, to avoid refusals. Water was provided ad libitum via nipple drinkers. Ambient temperature was kept at 25 ± 1°C for the first 4 weeks and then reduced to 22 ± 1°C, with humidity 30–55% and light regime 12 h light, 12 h darkness.

Pigs were fed a diet based on wheat, barley and soya bean supplemented with different ZnO doses. One group received 40 mg of ZnO kg−1 feed, covering daily zinc requirements (low-ZnO group), the second group received 100 mg ZnO kg−1 feed (reaching the permitted zinc concentration in the EU being 150 mg Zn kg−1 feed; medium-ZnO group), and the third group was supplemented with 3100 mg ZnO kg−1 feed (high-ZnO group). The different zinc diets were fed until day 28 of the animal trial (first trial period, day 0–28). To investigate the lasting effect of the high ZnO supplementation on Camp. coli excretion, the zinc concentration of the high-ZnO group was reduced to that of the medium-ZnO group for another 2 weeks (second trial period, day 29–42). ZnO supplementation in the low- and medium-ZnO groups was continued according to the conditions of the first trial period. For the second trial period, only five animals per group were investigated.

Sampling of faeces

Faecal samples were collected directly from the rectum. These samples were collected in intervals over the whole study period to monitor quantitative Camp. coli excretion and the faecal consistency. Faecal consistency was monitored daily using a subjective scoring system ranging from 1, watery diarrhoea to 5, hard dry stool (Bratz et al. 2012).

All faecal samples were placed into sterile plastic dishes and transported immediately to the laboratory where analysis was initiated. The time between sampling and processing was kept at a maximum of 4 h for all samples.

Enumeration of Campylobacter coli in faeces

To determine Camp. coli counts, semi-quantification was performed according to ISO 10272–3. Briefly, 1·5 g of faecal material was diluted in 12 ml (dilution 1 : 8) Bolton broth with Bolton selective antibiotic supplement and 5% lysed horse blood (all OXOID) in stomacher bags (Meintrup, Lähden-Holte, Germany). Samples were homogenized in BagMixer 400 (Interscience, Saint Nom, France) for 2 min at maximum speed. Serial tenfold dilutions of up to 10−8 of the initial homogenate were made in selective enrichment (Bolton broth) and incubated for 48 h at 37°C in a microaerobic atmosphere. For quantification, 10 μl of each enrichment dilution was streaked on modified charcoal-cefoperazone-deoxycholate agar (mCCDA; OXOID). Plates were incubated for 48 h under conditions mentioned above. From every dilution showing bacterial growth, DNA was extracted for species verification of Camp. coli and Camp. jejuni by multiplex PCR (Wang et al. 2002). Campylobacter coli levels were expressed as log10 CFU per gram sample material (detection limit 1 CFU g−1). Based on this method, the number of Camp. coli is expressed between two log levels and lower values were used for analysis.

DNA extraction and species verification by PCR

For isolation of DNA, bacterial colonies were scraped from plates and washed in 0·1× TE buffer (10 mmol l−1 Tris/HCl, pH 8·0, 1 mmol l−1 EDTA). Pellets were resuspended in 5% Chelex Resin 100 (Bio-Rad). One-hour incubation at 56°C was followed by 15 min at 95°C, and 2 μl of the supernatants were used for PCR. Primers and PCR protocol for Camp. coli and Camp. jejuni verification are described by Wang et al. (2002).

Analytical procedure for total zinc measurements in faeces

Faecal samples (10 g) from three animals per group were analysed for the total zinc concentration at four different time points during this study according to Pieper et al. (2012). Zinc content was determined by atomic absorption spectrometry in an AAS vario 6 spectrometer (Analytik Jena, Jena, Germany) after hydrolysis of the samples in concentrated HCl.

Statistical analysis

Calculation of statistical significance was performed with GraphPad Prism v5 (La Jolla, CA, USA) using the one-way anova with Tukey's post hoc test. Means ± standard deviation (SD) are mentioned for all variables. The effect of the different Zn doses, age and their interaction on the pig body weight was calculated applying a general linear model with repeated measures with pen as experimental unit. Differences were considered significant at P < 0·05.

Results

In vitro Campylobacter coli growth inhibition by ZnO

Growth inhibition of Camp. coli 5981 was examined in broth cultures containing various ZnO concentrations over 24 h. Significantly reduced cell counts could already be detected after 2 h treatment for the ZnO groups containing ≥2·6 mmol l−1 ZnO compared to control (F = 31·74; df = 29,90; P = 0·0001). Without addition of ZnO, the Camp. coli cell count increased within the assay to log10 7·78 ± 0·26 CFU ml−1, while the cell count showed no changes over the whole testing period with 1·6 mmol l−1 ZnO (log10 6·64 ± 0·04 CFU ml−1). After incubation with 2·6 mmol l−1 ZnO, the cell count decreased to log10 1·30 ± 1·61 CFU ml−1. Only sporadically colonies could be counted after 24 h exposure at 3·9 and 6·5 mmol l−1 ZnO (Fig. 1).

Figure 1.

Antibacterial activities of different zinc oxide (ZnO) concentrations against Campylobacter coli 5981 in vitro. Behaviour of Camp. coli 5981 in Brucella broth in the absence of additional ZnO (circles) and in the presence of 1·3 mmol l−1 ZnO (squares), 2·6 mmol l−1 ZnO (dark triangle), 3·9 mmol l−1 ZnO (diamonds) and 6·5 mmol l−1 ZnO (bright triangle). Results are expressed as means ± standard deviation of log10 CFU ml−1 (n = 4). (image) 0·0 mmol l−1 ZnO; (image) 1·3 mmol l−1 ZnO; (image) 2·6 mmol l−1 ZnO; (image) 3·9 mmol l−1 ZnO and (image) 6·5 mmol l−1 ZnO.

Gene expression analysis of Campylobacter coli 5981 after ZnO exposure

To understand the mechanism of action of ZnO on Camp. coli, a set of genes involved in oxidative and general stress response was selected for gene expression analysis in Camp. coli 5981 cells after ZnO exposure (Table 1). As controls, an oxidative and heat stress response was generated by paraquat and a temperature upshift to 46°C, respectively. Most apparently, the major oxidative stress gene katA was up-regulated fivefold (ZnO exposure) and 70-fold (paraquat treatment) but not by heat stress (Fig. 2). The expression of sodB and ahpC was not up-regulated by all three stress treatments. The expression of the more generally associated stress response genes clpB, groES and dnaK was slightly up-regulated by ZnO treatment (2·2-, 2·5- and 2·6-fold, respectively), unaffected after exposure to paraquat and up-regulated by heat treatment (4·5-, 14- and 10-fold, respectively).

Figure 2.

Expression changes in selected genes in Campylobacter coli 5981 under different stress conditions in vitro. Campylobacter coli 5981 cells in the late exponential phase were stressed by 1·3 mmol l−1 zinc oxide (ZnO) (dark grey), by 0·5 mmol l−1 paraquat (grey) or heated to 46°C (bright grey) for 30 min. Transcripts of the selected genes were quantified by RT-qPCR, and data were analysed using the comparative critical threshold (inline image) method. The relative expression ratio for each gene is presented as a log2 value in the histogram. Data indicate the mean ± standard deviation (n = 3). (image) ZnO; (image) paraquat and (image) heat.

Animal health and faecal consistency

All animals remained in very good health conditions throughout the study. None of the animals developed signs of zinc deficiency or zinc intoxication. No diarrhoea occurred in any group and the faecal score remained at levels between 3 and 4 throughout the study without differences among the groups. No differences in the pig performance were detected. However, the body weight of the pigs in the low-ZnO group was numerically lower (17·6 ± 0·2 kg) than in the medium-ZnO (18·4 ±0·2 kg) and high-ZnO group (19·5 ± 0·1 kg) after 4 weeks of treatment (end of the first trial). At the end of the second trial, this pattern was further observed without statistical differences (25·7 ± 0·2, 28·0 ± 0·3, 29·4 ± 0·2 kg in low-, medium- and high-ZnO group, respectively).

Enumeration of Campylobacter coli in faeces in the three ZnO treatment groups

Only piglets from mother sows with confirmed Camp. coli-positive faecal samples (ranging from 1 to 4 log10 CFU Camp. coli g−1) were included in the animal trial. Quantitative data on the faecal excretion of Camp. coli in piglets of the three different ZnO treatment groups over the whole trial period (day 0–42) are summarized in Fig. 3. All piglets were naturally colonized with Camp. coli. Highest Camp. coli levels were detectable on the first sampling day (day 0) of the experiment. Campylobacter coli counts for the medium and high-ZnO group reached 6·7 ± 0·82 and 6·68 ± 1·5 log CFU g−1 and for the low-ZnO group 6·33 ± 1·23 log CFU g−1 faeces. From the seventh sampling day on, reduced Camp. coli levels could be observed for the high-ZnO group compared with the low- and medium-ZnO groups with the exception of day 21 where Camp. coli counts did not show differences among the three groups. Taken all data from the first trial period together (day 0–28), a significant reduction in Camp. coli shedding of 1 log CFU g−1 faeces (F = 9·14; df = 2,27; P = 0·0009) was detectable for the high-ZnO group in comparison with the low- and medium-ZnO group (Fig. 4).

Figure 3.

Course of faecal excretion of Campylobacter coli in naturally colonized weaned piglets fed three different zinc oxide (ZnO) concentrations from day 0 to 42. Campylobacter coli levels in the faeces detected by semi-quantification in the first trial period (day 0–28, n = 10) and second trial period (day 29–42, n = 5); square: low ZnO (40 mg kg−1), triangle: medium ZnO (100 mg kg−1) black dot: high ZnO (3100 mg kg−1), white dot: reduction from high to medium ZnO (3100→100 mg kg−1); ---: time point of reduction of dietary ZnO from 3100 to 100 mg kg−1; results are expressed as mean ± standard deviation of log10 CFU per gram faeces. (image) low ZnO; (image) medium ZnO; (image) high ZnO and (image) high→medium ZnO.

Figure 4.

Summarized Campylobacter coli levels in faeces from piglets fed three different zinc oxide concentrations (first trial period: day 0–28). Summarized Camp. coli levels in the faeces detected by semi-quantification in the first trial period (day 0–28, n = 10), results are expressed as mean ± standard deviation of log10 CFU per gram faeces.

To investigate the lasting effect of a reduced Camp. coli faecal excretion in the high-ZnO group, the diet containing 3100 mg ZnO kg−1 was lowered to the medium-ZnO concentration of 100 mg ZnO kg−1 after 28 days for another 2 weeks (second trial period, day 29–42). That decrease in dietary ZnO supplementation leads to an increase in Camp. coli numbers in faeces within a few days in this group. Faecal Camp. coli levels of animals receiving an adjusted dietary ZnO supplementation equalled and even exceeded the ones of the low- and medium-ZnO group (Fig. 3).

Total zinc measurements in faeces

Faecal zinc concentrations in the three ZnO treatment groups are shown in Fig. 5. As zinc homeostasis in pigs is mainly regulated in the gastrointestinal tract by retention or excretion, we analysed the total zinc concentration in faeces. Therefore, samples of three animals per group on the first and last sampling day of both trial periods were taken to measure the zinc excretion.

Figure 5.

Total faecal zinc excretion by weaned piglets fed different dietary zinc oxide (ZnO) concentrations. Total zinc concentration was determined in faeces before and after the reduction in dietary ZnO from 3100 to 100 mg kg−1 from the three treatment groups, results are expressed as mean ± standard deviation of mg Zn kg−1 (n = 3). (image) Low ZnO; (image) medium ZnO; (image) high ZnO and (image) high→medium ZnO.

As expected, the faecal zinc concentration was affected by the ZnO level in the feed diet (Fig. 5). Faecal zinc concentrations of the low-ZnO group on the first day (4 days after the start of zinc supplementation) were approximately 420 mg kg−1 faeces and increased to 860 mg kg−1 faeces after 4 weeks. It remained relatively constant at approximately 700 mg kg−1 zinc for the rest of the study.

Results for the medium-ZnO group showed a median level of approximately 860 mg Zn kg−1 faeces on the first day. It decreased with time to approximately 640 mg Zn kg−1 faeces. On day 28, only 300 mg Zn kg−1 faeces were detectable in this group. Faecal zinc concentrations from piglets fed with the high ZnO diet resulted in an excessive faecal zinc concentration with up to 8250 mg kg−1 after 4 weeks. Decreasing the diet from the high to the medium-ZnO concentration in this group resulted in zinc concentrations comparable with the other two treatment groups within 4 days.

Discussion

The results of this study demonstrate the dose-dependent reduction in Camp. coli numbers by ZnO in vitro.

To our knowledge, no study has been published that tested the antimicrobial impact of ZnO against Camp. coli yet. Besides, recent studies concentrate on ZnO nanoparticles (NP) as their antimicrobial effect is shown to be higher compared with ZnO powder (Tayel et al. 2011). However, the research on ZnO NP focuses more on its usage as a preservative agent and disinfectant in food industry whereas ZnO powder is commonly used as feed additive in farm animals.

Based on the in vitro growth inhibition experiments (Fig. 1), we were able to demonstrate a high susceptibility of Camp. coli against zinc stress. Liedtke and Vahjen (2012) classified a broad range of intestinal bacterial species for their susceptibility to ZnO supplemented media into three categories according to their minimum inhibitory concentration (MIC). Bacteria were determined as low (18–73 μg ml−1), medium (130–290 μg ml−1) or highly resistant (250–580 μg ml−1), with the majority of intestinal bacteria belonging to the latter group. When applying this classification scheme, Camp. coli 5981 possesses a medium zinc resistance with a MIC of <2·6 mmol l−1 (200 μg ml−1). Comparable data were obtained for Camp. jejuni DSM 4688 (German Collection of Micro-organisms and Cell Cultures-DSMZ) and Camp. jejuni NCTC 11168 (National Collection of Type Cultures), with MICs of 290 and 145 μg ml−1 ZnO, respectively (Liedtke and Vahjen 2012).

Several proteins play a role in the protection of Campylobacter spp. from oxidative stress. Three major proteins are involved in the inactivation of ROS (Murphy et al. 2006): Superoxide dismutase (SodB) is thought to provide the first line of defence during exposure of Camp. jejuni to air as it removes superoxide anions by their dismutation into hydrogen peroxide and oxygen (Purdy and Park 1994; Purdy et al. 1999). The peroxide stress defence protein catalase (KatA) degrades hydrogen peroxide to water and oxygen in the cytoplasm. The alkyl hydroxide reductase (AhpC) is important in the resistance of Camp. jejuni to alkyl hydroperoxides as it can destroy toxic hydroperoxide intermediates. To describe the stress response of Camp. coli after ZnO exposure, selected genes involved in oxidative and general stress response were tested for expression changes after ZnO exposure (Fig. 2). We were able to show that ZnO induces a significant increase in the expression of the oxidative stress gene katA. This is in agreement with the study of Xie et al. (2011), who detected an increase in katA expression after exposure of Camp. jejuni 81–176 to ZnO NP. In contrast to that study, ahpC was not up-regulated in Camp. coli 5981. The expression of sodB was not affected by ZnO stress. That corresponds to the study by Xie et al. (2011). In addition, the expression of general stress response genes groES and dnaK was up-regulated under ZnO exposure. Similar results were reported in Camp. jejuni 81–176 by Xie et al. (2011). These data suggest that ZnO exposure leads – in addition to an oxidative stress response – to a general stress response in Camp. jejuni/Camp. coli.

No data exist on the impact of ZnO powder as feed additive on Campylobacter colonization and shedding in animals. We were able to show a reduction in Camp. coli shedding of approximately 1 log CFU g−1 faeces when supplementing feed with a high ZnO dose compared with excretion rates in piglets fed a low and medium ZnO dose (Figs 3 and 4). By investigating a second trial period (Fig. 3) where ZnO supplementation was reduced from high (3100 mg kg−1) to medium (100 mg kg−1) concentration in the high-ZnO group, we could demonstrate that the reduction in Camp. coli shedding at high ZnO concentrations in feed is a transient phenomenon: decreasing ZnO supplementation leads to an increase in Camp. coli shedding within a few days (Fig. 3). These data indicate a fast adaption of Camp. coli to new environmental zinc conditions present in the intestine of the porcine host when fed different zinc diets.

However, there was a high variation in faecal Camp. coli counts, even in the faeces of one animal at consecutive sampling points. This can be explained by the heterogeneous distribution of Camp. coli in the gut content, which results in oscillating Camp. coli excretion (Weijtens et al. 1999; Leblanc Maridor et al. 2008).

A number of studies already demonstrated the positive impact of high doses of ZnO on animal health and improved weight gain in piglets (Jensen-Waern et al. 1998; Pluske et al. 2002; Pettigrew 2006). Here, similar observation could be made. Despite no significant differences in body weight between the different ZnO groups, numerical improvement in body weight was observed with increased ZnO concentrations in the feed. These findings remained in agreement with data collected in another experiment of our group, where pigs were infected with Salmonella Typhimurium and fed similar ZnO levels in the diet for 6 weeks (Janczyk et al. 2013).

High ZnO doses can alter the bacterial community composition in general (Li et al. 2001) and the variety and diversity of coliforms in particular (Gielda and DiRita 2012). Nonetheless, these authors could not detect a specific effect of ZnO on the number of excreted Escherichia coli, enterotoxigenic E. coli, coliforms or Enterococcus spp. (Jensen-Waern et al. 1998; Katouli et al. 1999; Gielda and DiRita 2012). In contrast, Slade et al. (2011) showed that dietary ZnO supplementation (3100 mg/kg feed) reduced shedding of enterotoxigenic E. coli O149 in pigs.

We analysed the zinc concentration in the faeces of the three treatment groups as zinc homeostasis is regulated mainly by faecal excretion (Poulsen and Larsen 1995). Excessive faecal zinc concentrations were detectable in the high-dosage zinc dietary group, whereas no major differences were observed for the other two groups (Fig. 5). The lack of differences in the zinc concentration in faeces between the low- and medium-ZnO group could be explained by either the low difference in the dietary zinc or a heterogeneous dispersion of zinc in faecal material. Zinc was measured in fresh faecal material, and differences in water concentration could have affected the measurements. Nevertheless, these data provide evidence of the minor effect of low and medium ZnO supplementation to the feed diet and explain the lack of differences in Camp. coli counts between those two groups. Reducing the high dietary ZnO dose to the medium ZnO level led to a decrease in zinc concentration in the gut within a few days. These results correspond with the observed Camp. coli excretion data where cell numbers increased within the same time period, confirming the disappearance of the inhibiting effect of excessive zinc.

Summarizing, this work provides evidence of an antimicrobial impact of ZnO against Camp. coli in vitro and in vivo. The application of high doses of ZnO in feed a few days prior to slaughter could be suitable to reduce the Camp. coli load in pigs at slaughter. Nonetheless, data are needed to evaluate potential side effects of high ZnO doses in feed for animal health, the zinc concentration in meat and the impact of zinc excretion into the environment with potential side effects on soil and water bacteria.

Acknowledgements

We acknowledge Stefanie Banneke and Mechthild Ladwig (Federal Institute for Risk Assessment, Berlin) for their input during the animal trial. We thank Wilfried Vahjen (Institute of Animal Nutrition, Freie Universität Berlin) for the chemical analysis. The technical assistance of Jasmin Blume (Institute of Food Hygiene, Freie Universität Berlin) is gratefully acknowledged. The study was funded by the German Research Foundation (Deutsche Forschungsgemeinschaft, DFG) within the Collaborative Research Group (SFB, Sonderforschungsbereich) 852/1 ‘Nutrition and intestinal microbiota – host interactions in the pig’.

Conflict of interest

The authors have no conflict of interest to declare.

Ancillary