Immune responses of chickens inoculated with recombinant Lactobacillus expressing the haemagglutinin of the avian influenza virus

Authors

  • Z. Wang,

    1. Key Lab of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, Jiangsu, China
    Search for more papers by this author
  • Q. Yu,

    1. Key Lab of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, Jiangsu, China
    Search for more papers by this author
  • J. Fu,

    1. Key Lab of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, Jiangsu, China
    Search for more papers by this author
  • J. Liang,

    1. Key Lab of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, Jiangsu, China
    Search for more papers by this author
  • Q. Yang

    Corresponding author
    1. Key Lab of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, Jiangsu, China
    • Correspondence

      Qian Yang, Key Lab of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Weigang 1, Nanjing, Jiangsu 210095, China. E-mail: zxbyq@njau.edu.cn

    Search for more papers by this author

Abstract

Aims

To develop a safe, effective and convenient vaccine for the prevention of highly pathogenic avian influenza (HPAI), we have successfully constructed a recombinant lactobacillus (LDL17-pH) that expresses the foreign HPAI protein, haemagglutinin 1 (HA1).

Methods and Results

The mucosal and systemic immune responses that are triggered by LDL17-pH following the oral administration to 10-day-old chickens were evaluated. The results showed that LDL17-pH could significantly increase the specific anti-HA1 IgA antibody level in the mucosa and the anti-HA1 IgG level in sera. Tissues were isolated from trachea and Peyer's patches(PPs)and caecal tonsils of chickens, and gene expression was analysed via real-time quantitative PCR.

Conclusions

The results showed that LDL17-pH could significantly induce the specific anti-HA1 IgA antibody level in the trachea and intestine and the specific anti-HA1 IgG antibody level in the serum (< 0·05). Additionally, LDL17-pH was in the capacity to induce the expression of cytokines IFN-γ, TLR-2 and AvBD-9 in the PPs and caecal tonsils. Most importantly, the chickens that were immunized with LDL17-pH were protected against lethal challenge of the H5N1 virus to some extent.

Significance and Impact of the Study

Therefore, LDL17-pH could be a promising oral vaccine candidate against HPAI.

Introduction

The highly pathogenic avian influenza (HPAI) virus, H5N1, is a threat to the world's poultry industry. H5N1 has rapid evolution, genetic diversity, broad host range, and ongoing circulation in birds and potential human-to-human transmission remain a major global health concern (Zhou et al. 2012). The current vaccination (intramuscular immunization) against HPAI has succeeded in reducing the morbidity and mortality in poultry. However, the intramuscular immunization caused by injection could not induce sufficient mucosal immunity (Niu et al. 2009). Thus, many investigators are pursuing more convenient and economical avenues to construct new vaccine candidates, such as recombinant subunit vaccines using baculovirus (Treanor et al. 2001), plasmid DNA (Chen et al. 1999) or replication-incompetent adenovirus (rAd) vectors (Toro et al. 2007). If it could induce an effective mucosal immune response, the new type of more ideal vaccine would prevent the invasion of HPAI virus because the H5N1 virus would infect animals through their respiratory and intestinal tracts (Gu et al. 2007). Thus, developing mucosal vaccine candidates based on these considerations is a feasible strategy.

Lactic acid bacteria (LAB) are normal residents of the small and large intestines of mammals and birds. Lactobacillus is a genus of Gram-positive facultative anaerobic bacteria that make up the major component of the LAB group (Brisbin et al. 2010). Lactobacillus is the most common type of bacteria used as probiotics. And therefore, a great deal of research has focused on host response and delivery vector to these bacteria (Resta-Lenert and Barrett 2006; Turpin et al. 2010). In chickens, probiotic Lactobacillus normally live in the digestive, urinary and genital systems without causing disease. Their abilities to transit through the stomach intact and to closely associate with the intestinal epithelium combined with their immunomodulatory properties have made Lactobacillus attractive candidates as live vehicles for the delivery of immunogens to the intestinal mucosa (Del Rio et al. 2008; Kajikawa et al. 2010). In addition, probiotic Lactobacillus have been shown to enhance intestinal mucosal immunity (Yurong et al. 2005), increase the serum antibody response (Haghighi et al. 2005, 2006) and regulate the balance of the Th1 and Th2 pathways (Wells and Mercenier 2008; Brisbin et al. 2010) (Brisbin et al. 2008b). It has been demonstrated that some species and strains of Lactobacillus induce cytokines that promote Th1 effector functions, such as gamma interferon (IFN-γ) (Christensen et al. 2002; Subedi et al. 2007; Haghighi et al. 2008), whereas other strains or species of Lactobacillus induce innate immunity cytokines, including TLR-2 and β-defensins (AvBD) (Das et al. 2010). To enhance epitope bioavailability conferred by the delivery vehicle, specific Lactobacillus species could be selected (Wang et al. 2012). Specifically, Lactobacillus delbrueckii ssp. lactis D17 (LDL17), which is isolated from the chickens intestine, can colonize the digestive tract (Yu et al. 2007).

The intestine is the site of interaction between microbes, feed antigens and the immune system (Brisbin et al. 2008a,b), and gut-associated chickens lymphoid tissue (GALT) plays a major role in providing chickens repertoire of immune cells and their products to defend against chickens pathogenic invasion. In chickens, the Peyer's patches (PPs) and the caecal tonsils (CT) form chickens major part of the GALT. Caecal tonsils produce precursors of effector chickens' immune cells that are recruited to mucosal surfaces of the intestine (Befus et al. 1980; Muir et al. 2000). Toll-like receptor (TLR), which can recognize pathogen-associated molecular pattern (PAMP), has played an important role in link innate immunity with adaptive immunity (Heine and Lien 2003). In mammals, lactobacilli as a kind of PAMP can recognize the TLR-2 of immunocytes, activate and up-regulate the expression of TLR-2. The β-defensins are cystine-rich cationic antimicrobial peptides (Das et al. 2010). In chickens, a total of 14 avian β-defensin genes (AvBD), designated AvBD-1 to AvBD-14, have been identified (Van Dijk et al. 2008). Expression levels of AvBD-9 were significantly increased in the lymphoid tissue stimulated with the prebiotics (Zhang et al. 2011).

In previous study, it was reported that recombinant Lactobacillus delbrueckii ssp. lactis D17 (LDL17-pH) was a potent mucosal vaccine, which could promote the immune responses of inactivated vaccine after oral immunization to mice (Wang et al. 2012). In the study, we measured immunity effect by oral administration of the chickens with recombinant LDL17-pH. In addition, we have comparative study on immunity effect of chickens vaccinated with AIV-inactivated vaccine and recombinant LDL17-pH. Most importantly, the chickens that were immunized with LDL17-pH were protected against lethal challenge of the H5N1 virus to some extent.

Materials and methods

Bacterial strains and the vaccine

Inactivated vaccine AIV H5N1 (108·6 ELD50 per 0·1 ml) was purchased from Yebio Biological engineering Co. Ltd., (Qingdao, China). The recombinant Lactobacillus delbrueckii ssp. lactis D17 (LDL17-pH) was constructed in our laboratory (Wang et al. 2012). Lactobacillus was grown in MRS Medium (Difco Laboratories, Detroit, MI, USA) at 37°C. When necessary, antibiotics were added to the culture medium at the following concentrations: erythromycin (EM) at 5 μg ml−1 for Lactobacillus. The chickens' anti-HA-positive sera (H5 subtypes) were provided by Harbin Veterinary Research Institute.

Preparation of recombinant strains for immunization

The recombinant lactobacilli strains (LDL17-pH) and corresponding empty plasmid control strains (DLD17-pLEM415) were grown in MRS. The bacteria were washed three times with sterile PBS, and the final pellets were resuspended in sterile PBS supplemented with 1% sucrose for oral immunization at the appropriate concentration. Plate counts were performed for each inoculum to determine the number of colony-forming units (CFU) for administration.

Immunization schedule

One-day-old specific pathogen-free (SPF) chickens were kindly provided by Jiangsu Academy of Agricultural Sciences (Nanjing, China). All experiments were carried out under the guidelines of the National Animal Study Board. The chickens (120) were divided into four groups (30/group) (Table 1). When the chickens were 10 day old, immunizations were administrated orally to the chickens two times at 2-week interval. Each administration included the doses of 200 μl (control MRS, 108 CFU of LDL17-pLEM415 and LDL17-pH). The fourth group was immunized by muscular injection with inactivated vaccine, the doses of 0·3 μl each chicken.

Table 1. Animals and immunization ways used for this study
Number of chickensImmunization ways
30Oral immunization with control MRS
30Oral immunization with LDL17-pLEM415
30Oral immunization with LDL17-pH
30Muscular injection with inactivated vaccine H5N1

Sample collection

Blood samples were taken weekly for 7 weeks from seven chickens in each group after the first immunization. The serum was separated by centrifugation and stored at −20°C. The chickens were sacrificed at the 1st, 3rd and 5th weeks after the second immunization. Tissue samples of trachea and PPs and CT were taken from seven chickens in each group, and then, they were repeatedly washed with 0·5 ml of PBS to collect their mucosal suspensions. The suspensions were centrifuged at 5000 g for 10 min, and the supernatant was collected and stored at −20°C for the detection of anti-AIV sIgA. Nasal cavity and trachea were also collected at 24 h after the second immunization and stored in liquid nitrogen for the detection of cytokines and TLRs expression by RT-qPCR.

Assay of haemagglutination inhibition (HI)

The AIV antibody was detected by haemagglutination inhibition (HI) assay, according to the OIE standard method (Haan et al. 2001). Briefly, 25 ml PBS was pipetted into each well of a plastic V-bottom microtitre plate. Later, 25 ml of serum was added into the first well and make twofold dilution of the serum across the plate. Four haemagglutination units (HAU) of antigen in 25 μl was then added to each well, and the mixture was incubated for 30 min at room temperature (RT). Subsequently, 25 ml of 1% (v/v) chicken red blood cells (RBCs) was added to each well, mixed gently and allowed RBCs to settle for about 40 min at RT. The HI titre was defined as the highest dilution of serum causing complete inhibition of 4 HAU of antigen. The HI titres were defined as the highest serum dilution capable of preventing haemagglutination.

Detection of specific IgG and IgA antibodies by ELISA

Specific secretory IgA antibody titres in the intestinal and tracheal lavage fluids were determined by the enzyme-linked immunosorbent assay (ELISA) as previously described (Wu and Chung 2007). ELISA plates were coated with purified HA1 protein in carbonate buffer (pH 9·6) at 4°C overnight. The plates were washed five times with PBS containing 0·05% Tween-20 and saturated with PBS containing 5% skim milk at 37°C for 1 h. Intestinal and tracheal lavage fluids were added in duplicate and incubated for 1 h at 37°C. The plates were then washed five times with PBS containing 0·05% Tween-20. Horseradish peroxidase-conjugated (HRP) goat anti-mouse IgG or IgA was added to each well and incubated for an additional l h at 37°C. After another round of washing, a substrate solution containing o-phenylenediamine (OPD) and H2O2 was added. The reaction was allowed to proceed for 15 min at room temperature before it was terminated by the addition of a stop solution. The absorbance was measured at 495 nm using an ELISA autoreader (Molecular Devices Company, Sunnyvale, CA, USA). End-point titres were defined as the maximum dilutions.

RNA isolation and quantitative RT-PCR analysis

Total RNA was extracted from nasal cavity and trachea using a RNA extraction kit (TIANGEN DP431, Beijing, China) and was subjected to reverse transcription with Prime Script RT-PCR Kit (Takara RR064A, Dajin, Japan). PCR was carried out in a volume of 20 μl reaction mixture containing 2 μl of the cDNA, 0·4 μl ROX dye II, 10 μl SYBR Premix Ex Taq (TaKaRa) and specific primers (0·4 μmol l−1 each of the forward and reverse gene-specific primers; Table 2) using an ABI 7500 instrument (Life Technologies Corporation, Carlsbad, CA, USA). cDNA levels were determined using the standard curve of cycle thresholds and normalized to the housekeeping gene (β-actin) to account for repeated measures. math formula

Table 2. Oligonucleotide sequences of sense and antisense primers for real-time PCR products determined
GeneAccession numberPrimer sequencesProduct size (bp)
  1. IFN-γ, interferon-γ; IL-4, interleukin-4; TLR-2, Toll-like receptor 2; AvBD-9, avian β-defensin.

β-actin X00182

Forward

Reverse

ATGAAGCCCAGAGAGCAAAAGA

GGGGTGTTGAAGGTCTCAAA

222
TNF-γ Y07922

Forward

Reverse

AGCTGACGGTGGACCTATTATT

GGCTTTGCGCTGGATTC

259
IL-4 AJ621735

Forward

Reverse

ACCCAGGGCATCCAGAAG

CAGTGCCGGCAAGAAGTT

258
TLR-2 NM204278

Forward

Reverse

GATTGTGGACAACATCATTGACTC

AACGCTGCTTTCAAGTTTTCCC

286
AvBD-9 NM00100161

Forward

Reverse

ATGAGAATCCTTTTCTTCCTTGTTGCT

TAGGAGCTAGGTGCCCATTTGCAGC

250

Data analysis was performed as reported previously by Shiraishi et al. (2008). Briefly, the ▵CT was calculated for each sample by subtracting the cycle threshold (CT) value of the housekeeping gene (β-actin ; internal control) from the CT of respective cytokine for example IL-4. For relative quantification, the ▵CT value of β-actin was then subtracted from the ▵CT of each experimental sample to generate the ▵▵CT. The ▵▵CT value was therefore fit in the formula 2−▵▵CT to calculate the approximate fold difference. The results are expressed as the ratio of IL-4 mRNA : β-actin mRNA.

H5N1 virus challenge experiments

All experiments were performed under Biological Safety Protection third-level Laboratory (BSP3L), and the chickens were kept under specific pathogen-free (SPF) conditions in individual ventilated cages (IVC). Immunization schedule were the same as above. The chickens (60) were divided into three groups (20/group). Immunizations were administrated orally to the chickens two times at 2 week interval. Each administration included the doses of 200 μl (control MRS, 108 CFU of LDL17-pH). The third group was immunized by muscular injection with inactivated vaccine, the doses of 0·3 μl each chicken. Two weeks after the final immunization, the chickens were challenged intranasally with 5 × 102 lethal doses (LD50) of H5N1 virus in a volume 40 μl. The accession number of avian influenza virus (AIV) H5N1 is AF144305.1. The chickens were monitored for disease signs and death for 14 days after infection.

Statistical analysis

All data were expressed as mean ± SEM. Experimental values were analysed by analysis of variance (anova). Statistical analyses were performed using SPSS statistical software 17.0 (IBM Company, New York, NY, USA). Differences between means were considered significant with Duncan test. All tests and results were repeated for three times.

Results

HI titre in the sera of immunized chickens with recombinant lactobacilli

The antibody titres in the sera after the immunization were detected by HI assay. As shown in Fig. 1, the antibody titres decreased gradually after immunization with the negative lactobacilli LDL17 and control group, whereas the antibody titres could increase gradually after immunization with LDL17-pH and inactivated H5N1 vaccines. The antibody titres of chickens immunized with LDL17-pH were lower than those immunized with inactivated H5N1 vaccines.

Figure 1.

The HI titre in serum collected from the immunized chickens 10, 17, 21, 28, 35, 42 and 49 days old. (image_n/jam12325-gra-0001.png) Control; (image_jam12325-gra-0002.png) LDL17 (image_n/jam12325-gra-0003.png) LDL17-pH; (image_n/jam12325-gra-0004.png) i.m H5N1.

Recombinant lactobacilli induce the level of mucosal HA1-specific IgA antibodies in the intestinal and tracheal lavage fluids in immunized chickens

After the chickens were administered the recombinant LDL17-pH, anti-HA1 IgA antibodies were detected in the intestinal and tracheal lavage fluids at 7 days after the second immunization (Fig. 2), indicating that the recombinant Lactobacillus LDL17-pH stimulated the mucosal immune response in the respiratory and digestive tracts. The levels of anti-HA1 IgA antibodies were maintained at a high level at 35 days after the second immunization. However, the antibody level of other groups was significantly lower than that induced by LDL17-pH (< 0·05).

Figure 2.

The HA1-specific IgA level in the trachea (a) and intestine (b) lavage fluids harvested from chickens sacrificed on days 7, 21 and 35 after the second immunization were analysed by indirect ELISA in triplicate. Symbols: *< 0·05; **P < 0·01. The error bars represent the standard deviation. (image_n/jam12325-gra-0005.png) Control; (image_n/jam12325-gra-0006.png) LDL17; (image_n/jam12325-gra-0007.png) LDL17-pH; (image_n/jam12325-gra-0008.png) i.m H5N1.

The level of HA1-specific IgG antibodies in the sera of immunized chickens with recombinant lactobacilli

To examine the systemic immune responses to orally administered recombinant lactobacilli, we measured the level of anti-HA1 IgG antibodies in the sera of immunized chickens. The sera samples were collected from the chickens at 7, 21 and 35 days after the second immunization. The HA1-specific IgG titres of the LDL17-pH and inactivated vaccines immunized groups increased over time, although these increases were not significant compared with the control groups after immunization (Fig. 3). We also found that the HA1-specific IgG titres induced by LDL17-pH were significantly lower than group immunized by inactivated vaccines. These results suggested that a significant HA1-specific systemic immune response was induced by oral immunization with the recombinant lactobacilli LDL17-pH.

Figure 3.

Detection of anti-HA-specific IgG levels in sera harvested from chickens sacrificed on days 7, 21 and 35 after the second immunization were analysed by indirect ELISA in triplicate. The titres are given as the geometric mean ± SD(n = 7). Increases are denoted by ‘*’. Increases in significance are given by symbols: one symbol = < 0·05; two symbols = < 0·01. (image_n/jam12325-gra-0005.png) Control; (image_n/jam12325-gra-0006.png) LDL17; (image_n/jam12325-gra-0007.png) LDL17-pH; (image_n/jam12325-gra-0008.png) i.m H5N1.

The expression levels of IL-4, IFN-γ, TLR-2 and AvBD-9

To determine whether immunization could indeed enhance mucosal cell-mediated immune response, cytokines expression levels in the trachea and PP and caecal tonsils were measured at 24 h after immunization (Fig. 4). The expression levels of IFN-γ, TLR-2 and AvBD-9 in PPs and CT of the chickens immunized with LDL17-pH significantly were up-regulated compared with those of other groups (< 0·05). However, the expression levels of IFN-γ, TLR-2, IL-4 and AvBD-9 in trachea show no significant differences among groups immunized. In addition to this, the expression levels of IL-4 in PPs and caecal tonsil of the chickens immunized with LDL17-pH were significantly down-regulated compared with those of other groups (< 0·05) (Fig. 4b).

Figure 4.

Fold exchange for IFN-γ (a), IL-4 (b), TLR-2 (c), AvBD-9 (d) expression in the trachea and Peyer's patches and caecal tonsil after immunization. The data are given as the geometric mean ± SD (n = 7). Increases are denoted by ‘*’. Increases in significance are given by symbols: one symbol = < 0·05; two symbols = < 0·01. (image_n/jam12325-gra-0005.png) Control; (image_n/jam12325-gra-0006.png) LDL17; (image_n/jam12325-gra-0007.png) LDL17-pH; (image_n/jam12325-gra-0008.png) i.m H5N1.

Protection against lethal H5N1 virus challenge

To test whether vaccinated chickens could stand against H5N1 virus challenge, all chickens were infected by intranasal drip with a lethal dose of 40 μl of 1 × 102 LD50. After H5N1 virus infection, the survival rate was observed for 14 days. The result in percentage survival indicated that the chickens immunized with the LDL17-pH strain obtained 60% protection. In contrast, the chickens for the control group were all killed within 5 days. Hundred percentage survival was observed for the group immunized with i.m H5N1 (Fig. 5).

Figure 5.

Twenty chickens per group were challenged intranasally with 1 × 102 lethal doses(LD50)of H5N1 virus in a volume 40 μl. More than 60% survival after challenge was observed for the group immunized with the LDL17-pH. Hundred percentage survival was observed for the group immunized with i.m H5N1. All the chickens of the control group were dead. (image_n/jam12325-gra-0009.png) Control; (image_n/jam12325-gra-0010.png) LDL17-pH; (image_n/jam12325-gra-0011.png) i.m H5N1.

Discussion

Oral mucous vaccine has the advantages of low risk of contamination, self-administration and a reduced price; furthermore, it induces systemic and mucosal immune responses simultaneously at sites where pathogens interact with mammalian hosts (Mohamadzadeh et al. 2009). The lactobacilli are thought to have beneficial effects for the host. Among these benefits, the immunomodulatory activities of these bacteria are of note. Despite the evidence for the ability of lactobacilli to induce or regulate immune responses in chickens, the underlying mechanisms of this phenomenon are unknown. That the lactobacilli have been applied as live vehicles for delivery of immunogens to the animal mucosa would be of greatly attention in the future (Kunisawa et al. 2007). Lactobacillus strain the LDL17, which was isolated from the chicken gut, was well adapted to the living conditions of the intestine. Our previous research indicated that oral administration of the recombinant lactobacilli LDL17-pH to mice was capable of triggering the AIV-specific humoral and cellular immune responses. In this study, we showed that the recombinant lactobacilli LDL17-pH could significantly induce the specific anti-HA1 IgA antibody level in the trachea and intestine and the specific anti-HA1 IgG antibody level in the serum. Additionally, the recombinant lactobacilli LDL17-pH have the capacity to induce the expression of cytokines IFN-γ, TLR-2 and AvBD-9 in the PPs and caecal tonsils. Expression of these genes was dependent on both the locations from which the cells were isolated and the bacterial isolates used.

It is generally assumed that IgA is the main antibody isotype and effector in the host defence at mucosal surfaces (Liu et al. 2009a,b). Our results indicate that the recombinant lactobacilli LDL17-pH that express HA1 triggered a mucosal immune response both in the respiratory and in the digestive tracts (Fig. 2), whereas inactivated vaccines immunized groups not induced a mucosal immune response in the trachea and digestive tract. The different IgA antibody levels could be explained by the difference in immunization ways. Actually, there are many mucosa-associated lymphoid tissues underneath the epithelia of the respiratory and intestinal tracts. The recombinant lactobacilli LDL17-pH adapted to the living conditions of the intestine the protective HPAI antigens could induce an effective mucosal immune response. However, the groups established by intramuscular injection with inactivated vaccines could not induce an effective mucosal immune response. This hypothesis has been confirmed in a previously published article (Wang et al. 2012).

The recombinant lactobacilli LDL17-pH bacteria also effectively triggered systemic immune responses against HA1, although the HA1-specific IgG and HI antibody titres were low. Our studies demonstrated that mucosal immunization with the recombinant lactobacilli could elicit both mucosal IgA and circulating IgG and supported the theory that mucosal immunization could provoke both mucosal and circulating antibody responses. However, the HA1-specific IgG and HI antibody titres elicited by LDL17-pH were lower than those elicited by intramuscular injection with inactivated vaccines.

Although oral immunization with the recombinant lactobacilli LDL17-pH could induce HA1-specific serum IgG and mucosal IgA production, cell-mediated immune responses also played a crucial role in protecting the host from invading pathogens. It was well known that lactobacilli could promote the secretion of Th1 cytokines IL-6, IL-12 and TNF-a; then, these cytokines further stimulate NK cells to secrete IFN-γ or T cell to enhance the CTL responses (Vissers et al. 2010). Therefore, in this study, the expression of IL-6, IL-12 and IFN-γ was significantly increased after booster immunization with the recombinant lactobacilli LDL17-pH, suggesting that the cellular immunity (Th1 type response) had been boosted (< 0·05). Moreover, IL-4 was secreted at lower levels in the groups that were administered the recombinant lactobacilli compared with the control group. This conclusion has been confirmed in the previously published article (Kogut et al. 2005; Costalonga et al. 2009).

Interestingly, the expression of TLR-2 and avian β-defensin genes(AvBD) cytokine mRNA in the PPs and CT was significantly increased compared with that from chickens immunized with inactivated vaccine, indicating that it induced innate immune response and later adaptive response by activating the NF-κB pathway (Kaisho and Akira 2001; Steinhagen et al. 2011). In addition, Lactobacillus could induce the expression of cytokines, which could activate immune state, thereby keeping on guard against pathogenic micro-organisms. Therefore, Lactobacillus possessed the ability to adhere and to colonize the gastrointestinal tract as well as to perform adjuvant functions (Plant and Conway 2002; Davidson et al. 2011).

The challenge test results showed the chickens immunized with the LDL17-pH strain obtained 60% protection(Fig. 5). The data demonstrated that oral immunization with the LDL17-pH could protect against H5N1 virus challenge to some extent. However, the chickens immunized with the i.m H5N1 obtained 100% protection. The group immunized with the i.m H5N1 was shown to be more effective. The reason was that inactivated vaccine was the whole virus by intramuscular immunization. To enhance the effect of immunization of the recombinant LDL17-pH, an effective mucosal adjuvant use or modification of the recombinant antigenic protein has been recommended. In addition, some results suggested that a certain amount of IL-1, IL-2, IL-10 and IL-18 as adjuvant co-expressing also could improve the protection efficacy (Kogut et al. 2005; Costalonga et al. 2009).

In the current study, oral immunization offers several advantages over intranasal vaccination. First, oral immunization induces more effective mucosal immune responses and protective rates (Liu et al. 2009a,b). Second, the oral immunization is easier to administer to animals, particularly poultry. In conclusion, we have demonstrated the feasibility of using Lactobacillus species as vehicles for an orally administered AIV vaccine candidate. Compared with inactivated vaccines, the recombinant lactobacilli LDL17-pH were more effective in inducing the systemic and mucosal immune responses with higher anti-HA1-specific IgA and IgG levels. This result implied that the acquired immune responses are dependent on the strain of Lactobacillus. Thus, recombinant LDL17-pH could be preferably used as an oral vaccine to induce protective immunity against HPAI.

Acknowledgments

This work was supported by Grant No. 31172302 from the National Science Grant of China and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Conflict of interest

No conflict of interest declared.

Ancillary