Caenorhabditis elegans-based in vivo screening of bioactives from marine sponge-associated bacteria against Vibrio alginolyticus

Authors


Abstract

Aim

To establish Caenorhabditis elegans based in vivo method for screening bioactives from marine sponge associated bacteria (SAB) against Vibrio species.

Methods and Results

About 256 SAB isolates were screened for their ability to rescue C. elegans infected with Vibrio species. The chloroform extract of the positive isolate was subjected to column fractionation and purity of the active fraction was analysed using HPLC. Further, the components were elucidated using GC/MS. The active fraction was tested for its in vivo rescue activity, antibacterial and anti-QS activity. In vivo colonization reduction and biofilm inhibition efficiency were assessed using GFP-tagged V. alginolyticus using confocal laser scanning microscopy (CLSM). The ability of the active fraction in modulating expression of V. alginolyticus quorum sensing (QS) regulators luxT and lafK was measured using real-time PCR. The results indicated that the chloroform extract of SAB4.2 displayed significant rescue activity against V. alginolyticus by inhibiting the QS pathway. HPLC analysis of the active fraction revealed a single major peak and GC/MS analysis suggested Pyrrolo[1,2-a]pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl) as the major constituent. The potent bacterial isolate was identified as Alcaligenes faecalis.

Conclusions

In vivo screening using C. elegans identified a marine isolate that inhibits the virulence of V. alginolyticus by interrupting the QS pathway.

Significance and Impact of the Study

The study provides a C. elegans based in vivo screening method for identifying bioactives from natural resources by overcoming the disadvantages of traditional in vitro plate assays.

Introduction

Since the discovery of antibiotics, micro-organisms have been proven to be the source of various important life saving drugs. Innumerable terrestrial microbiomes have been explored for their bioactive metabolites, and several compounds have been identified against Gram-positive and Gram-negative pathogens. As infectious microbes develop resistance against several drugs, new sources for drug discovery have become necessary to overcome multidrug-resistance-related issues. Oceans are the source of structurally diverse and novel anti-infectives. Sponges of the phylum Porifera are the major biomass occupants of the marine environment and only 1% of the phylum accounts to fresh water origin (Radjasa et al. 2007). Besides being the known source of several bioactive principles, marine sponges also serve as the host for innumerable marine micro-organisms (Wang 2006). In the recent years, symbiotic bacteria associated with sponges have been proven to be the source of several lead molecules previously believed as a metabolite of sponges itself (Zhang et al. 2005; Newman and Hill 2006). Bioactive compounds isolated from these sponges gains utmost importance due to their similarity with compounds isolated from terrestrial microbes of highly varied phylogeny (Perry et al. 1988).

Vibrio alginolyticus is a mesophilic marine bacterium responsible for vibriosis, wound infections and gastroenteritis in humans. Infection and mortality caused by V. alginolyticus in aquaculture results in significant economic losses every year (Lee et al. 1996; Liu et al. 2011). The increase in antibiotic resistance of V. alginolyticus isolates at clinical and aquaculture environments and the insufficient information about the mechanism of development of antibiotic resistance have made it difficult to control V. alginolyticus infections. Although the pathogen-associated infections can be treated successfully with the appropriate antibiotics, they can often lead to serious medical conditions especially in immune-compromised patients (Reilly et al. 2011). Hence, it becomes necessary to find novel antivirulent compounds to treat V. alginolyticus infections. The adhesive property of V. alginolyticus is another important reason for its successive and efficient invasion of the host system (Snoussi et al. 2008). Many studies in recent years have proven the ability of Vibrio spp. in developing biofilm during infection (Yildiz and Visick 2009). The bacterium develops resistance to antibiotics by initial attachment and development of multilayered, smeared colonies. Biofilm development in the host and the production of extracellular products are attributes of its virulence and pathogenicity. V. alginolyticus QS pathways like LuxO and LuxR were elucidated in recent reports (Rui et al. 2008). luxT and lafK in V. alginolyticus are found to play important roles in regulation of V. alginolyticus virulence (Ye et al. 2008; Liu et al. 2012). Traditional methods of antibiotic discovery primarily screen for compounds that affect the growth and survival of bacterial pathogens and identify compounds with almost similar mechanism of action. The development of resistance against these structurally similar antibiotics demands the need for a new strategy of antimicrobial discovery (Moy et al. 2006). Hence, identifying a potent QS-inhibitor against V. alginolyticus will be an efficient method to restrict the virulence by avoiding development of any subsequent antibacterial resistance.

Marine invertebrates have developed highly specific relationships with numerous micro-organisms, and these associations have been recognized for ecological and biological importance (Armstrong and Van Baalen 1979; Sponga et al. 1999; Strahl et al. 2002). It has been reported that the ratio of micro-organisms with antimicrobial activity from invertebrates is higher than from other sources (Ivanova et al. 1998; Burgess et al. 1999), suggesting that invertebrate-associated micro-organisms might play a chemical defence role for their hosts. Several recent studies have proven the efficiency of marine bacterial extracts to inhibit quorum sensing in Gram-positive and Gram-negative bacteria (Bakkiyaraj and Pandian 2010; Nithya et al. 2010; Nithyanand et al. 2010).

Using live animal models as a platform for screening is the most accurate alternative for in vitro solid assay plates, mediating antimicrobial discovery. The main advantage of using live models is that both efficacy and toxicity of the screened candidate are validated simultaneously (Matthews and Kopczynski 2001). Current drug discovery processes rely on popular model systems such as yeast, worms and flies due to their high similarity with the human system in their biological mechanisms and protein functions (Zon and Peterson 2005; Kaletta and Hengartner 2006). The main benefit of using these models in the drug discovery process for in vivo selection and validation is the development of a potent technology for the discovery of tomorrow's small molecular medicines (Powell and Ausubel 2008).

Caenorhabditis elegans is a well-established and popularly accepted model for studying bacterial pathogenicity and screening for antimicrobials (Bhavsar and Brown 2006; Kurz and Ewbank 2007). Recently, we have established C. elegans as a model system for V. alginolyticus (Durai et al. 2011b) and studied the changes in C. elegans at both physiological and molecular levels against Vibrio parahaemolyticus infection (Durai et al. 2011a). With this knowledge on the interaction of C. elegans with Vibrio spp., the present study has screened and characterized several sponge-associated bacteria (SAB) collected from the Palk bay region of India, for their anti-infective activity against pathogenic Vibrio spp. infection under in vivo conditions.

Materials and methods

Bacterial strains and C. elegans

Reference bacterial strains obtained from the American Type Culture Collection (ATCC) included V. alginolyticus (ATCC 17749), V. parahaemolyticus (ATCC 17802) and Vibrio vulnificus (ATCC 29307). All the cultures were maintained in Zobell marine medium 2216 (HiMedia, Mumbai, India). Escherichia coli OP50 was maintained in LB medium. V. alginolyticus was GFP tagged and maintained according to a standardized protocol (Sawabe et al. 2006). C. elegans WT Bristol N2 obtained from Caenorhabditis Genetics Center (CGC) was routinely maintained at 20°C on nematode growth medium (NGM) seeded with E. coli OP50 as per the standard methods (Brenner 1974). In all assays, the size of bacterial inoculum was kept constant at 6·7 × 10cells ml−1 (0·3 OD at 600 nm).

Collection, isolation and identification of sponge-associated bacteria

The marine sponge samples of Haliclona spp. were collected at the depth of 5 m from the costal waters of Mandapam, Palk Bay North (longitude 79° 8″ East; latitude 9°17″ North). Sponge samples were washed gently with sterile seawater to remove debris and loosely bound bacteria and then transported to the laboratory in sterile condition. The sponge samples were squeezed and swabbed using sterile cotton swabs (HiMedia, India) in different regions. The cotton swabs were directly used to inoculate autoclaved marine agar medium (HiMedia). Colonies of different morphology were selected and maintained as pure culture in the marine agar medium. Sterile environment was maintained throughout to avoid external bacterial contamination in pure cultures. The positive isolate SAB4.2 was identified by 16S rRNA gene sequence analysis according to Nithyanand et al. 2011. The identified sequence was then submitted to the GenBank database.

C. elegans rescue assay

For the preliminary screening, a single colony from the pure culture of each SAB was inoculated into 2 ml marine broth and incubated at 37°C overnight. Each culture was centrifuged at 9391 g, and the cell-free culture supernatant was filtered using 0·2-μm filters and extracted with an equal volume of chloroform 1 : 1 (v/v). The solvent fraction was collected and evaporated to remove solvent under reduced pressure. The resultant crude extract was dissolved in 100 μl of molecular grade water and tested for the ability to rescue C. elegans from V. alginolyticus infection. Rescue assay was performed in liquid medium with c. 50 worms transferred into each well of a 24-well plate, and 100 μl of the crude extract was used to analyse the rescue efficacy against pathogen infection. The crude extracts of SAB isolate which showed significant rescue activity against V. alginolyticus was also tested against other Vibrio strains. C. elegans exposed to Vibrio spp. alone served as a negative control and uninfected C. elegans exposed to SAB4.2 alone served as the positive control.

Purification and identification of active compound

Silica gel column and thin-layer chromatography

To identify the component of the crude extract responsible for the rescue activity, the SAB4.2 extract was purified using silica column chromatography with a solvent system that was standardized using thin-layer chromatography (TLC). The crude extract was purified using 20 × 2 cm silica gel columns (SRL, Mumbai, India), with a mesh size of 60–120 μm packed into a total column volume of 40 ml. A methanol/chloroform/hexane solvent system in the ratio of 0·5 : 2·5 : 7 was used as a mobile phase and the absorbed compound was eluted using methanol/water (75 : 25) solution at a flow rate of 2 ml min−1. The purity of the elutant was confirmed by TLC. Individual fractions were analysed for their in vivo rescue activity. Active fractions were collected many times and pooled together and evaporated. Survival assay was performed using the column-purified fraction at different concentrations (150–600 μg ml−1). The toxicity of the SAB extract was tested by exposing C. elegans to the active fraction in all test concentrations (150–600 μg ml−1). C. elegans exposed to V. alginolyticus alone served as a negative control and uninfected C. elegans exposed to SAB4.2 alone served as the positive control.

HPLC and GC/MS analysis

The column fraction displaying rescue activity was analysed using high-pressure liquid chromatography (HPLC), to check the purity. Column-purified active fraction (5 mg) was redissolved in 0·5 ml of HPLC grade methanol and introduced into a SHIMADZU system (Japan) with C18 silica gel column. Fractions were eluted using binary gradient of methanol with water from 0·1% to 100% (v/v). The major peaks were collected and checked for rescue activity, and the active fraction was analysed using gas chromatography/mass spectrometry. GC/MS analysis of the column purified active fraction was conducted using a Shimadzu GCMS-QP 2010 plus system comprising a manual injector. The gas chromatograph is interfaced to a mass spectrometer equipped with RXi-5MS (5% diphenyl, 95% dimethyl polysiloxane) fused to a capillary column (30 × 0·25 × 0·25 μm). For GC/MS detection, an electron ionization system was operated in electron impact mode with ionization energy of 70 eV. Helium gas (99·9%) was used as a carrier gas at a constant flow rate of 1·0 ml min−1 and an injection volume of 2 μl (splitless). The injector temperature was maintained at 260°C, the ion-source temperature was 250°C and the oven temperature was programmed from 140°C (for 2 min) with an increase of 10°C min−1 to 250°C as the final temperature. Mass spectra were taken at 70 eV at a scan interval of 0·5 s and from 45 to 450 Da. The solvent delay was 4 min, and the total GC/MS running time was 30 min. The relative percentage amount of each component was calculated by comparing its average peak area to the total area. Real-time analyser (Agilent Technologies, Palo Alto, CA, USA) was used to handle the mass detector, mass spectra and chromatograms. Metabolites were identified by comparison with the NIST database and standards.

Antibacterial and QSI assay

The effect of SAB4.2 column-purified active fraction (600 μg ml−1) on cell proliferation of V. alginolyticus was determined by a growth curve assay. The growth curve of V. alginolyticus was determined for up to 24 h, along with a quorum-sensing inhibition assay. The quorum-sensing inhibition assay was performed using Chromobacterium violaceum ATCC 12472 in a 24-well plate liquid medium as mentioned previously (Nithya et al. 2010). Cinnamaldehyde (75 mmol l−1) was the positive standard control as at lower concentration and it has been proven to inhibit quorum sensing without inhibiting bacterial growth (Niu et al. 2006; Brackman et al. 2008).

Bacterial colonization assay

The effect of the column-purified SAB4.2 extract on in vivo colonization in C. elegans intestine was analysed using GFP-tagged V. alginolyticus. C. elegans exposed to GFP-tagged V. alginolyticus in the presence and the absence of SAB extract were examined under confocal laser scanning microscope (CLSM) for their intensity of GFP fluorescence which is directly proportional to the intestinal colonization by V. alginolyticus. Worms exposed to GFP-tagged E. coli served as negative controls. In addition, any GFP-like pseudo-fluorescence activity of SAB4.2 against V. parahaemolyticus was used as another control to avoid any false-positive results. Also, the colony forming unit (CFU) count of the sample isolated from the infected C. elegans was performed on TCBS agar plates according to standardized procedures (Durai et al. 2011b).

Pharyngeal pumping assay

To determine the pharyngeal pumping rate, infected worms and column-purified SAB4.2 extract treated worms were placed on NGM plates seeded with E. coli OP50 and V. alginolyticus respectively. Pharyngeal pumping was observed manually using a stereomicroscope continuously for a minute. Animals infected with V. alginolyticus served as controls against treated animals. The pumping rate in the presence of E. coli OP50 was also monitored and compared.

In vitro biofilm inhibition and microscopic observation

For visualization by light microscopy, biofilms were allowed to grow on glass pieces (c. 1 × 1 cm) placed in 24-well polystyrene plates supplemented with the column-purified bacterial extract (50–300 μg ml−1) and incubated for 24 h at 37°C. The glass pieces were removed from the plate and stained with crystal violet. The stained glass pieces were placed on slides with the biofilm pointing up and inspected by light microscopy. Visible biofilms were documented with an attached digital camera (Nikon, Tokyo, Japan). The biofilms were also monitored under CLSM (Carl Zeiss, Goettingen, Germany) after washing with PBS and staining with 0·01% acridine orange. A 488 nm Ar laser and 500–640 nm band pass emission filters were used to excite and detect the stained cells. CLSM images were obtained from 24 h control and treated biofilms and processed using Zen 2009 image software. Quantitative analysis of biofilm inhibition was performed using liquid assay (Nithya et al. 2010).

In vivo biofilm inhibition and CLSM analysis

Approximately, 25 worms per well were taken in 24-well polystyrene plates containing Zobell Marine Broth 2216 (ZMB) and the column purified SAB4.2 extract. The wells without SAB4.2 extract acted as controls. Each well was inoculated with 1% (0·3 OD at 600 nm) of GFP-tagged V. alginolyticus and incubated at 25°C. After 24 h, a worm from each well was taken washed gently with M9 buffer to remove planktonic cells and observed for adhered bacterial cells using CLSM. The density of the surface biofilm was measured by intensity profile analysis using Zen software 2009. The intensity of the GFP recorded was directly proportional to the amount of bacterial biofilm.

RNA isolation and qPCR

To analyse the regulation of quorum-sensing genes in V. alginolyticus, total RNA was isolated from both V. alginolyticus and V. alginolyticus treated with SAB4.2 column-purified active fraction for 12 h. Total RNA was isolated using a guanidine thiocyanate/phenol extraction method. RT-PCR was performed using Superscript III Kit (Invitrogen) according to the manufacturer's instructions. RT-PCR was followed by a standard real-time PCR method in a single-well format in which the V. alginolyticus QS-specific primers and the primers for the housekeeping gene (rpoB) (Table 1) with their PCR mix (SYBR Green kit, Applied Biosystems) were combined separately at a predefined ratio. The PCR cycle numbers were always titrated according to the manufacturer's and previously established protocols to ensure that the reaction was within the linear range of amplifications. The steady-state levels of QS-specific gene mRNA were assessed from the cycle threshold (Cq) values during the real-time PCR of the candidate QS-specific gene product relative to the Cq values of the rpoB using a relative relationship method supplied by the manufacturer (Applied Biosystems).

Table 1. Gene-specific primers for qPCR
S. NoGenePrimer sequence (5′–3′)
1 luxT-FP GCGTAGTAAAGAAGATACCGA
luxT-RP GGAAGTGATGGCTAATACCGG
2 lafK-FP GAATCGGGAACGGGTAAAGAA
lafK-RP GGTGAACGCGCCTTTTACAT
3 rpoB-FP TCCGTATTCCCGATTCAGAG
rpoB-RP CAGCGGTGCAGAATAAGTCA

Statistical analysis

All the experiments were conducted thrice, and one-way anova (using SPSS Ver. 17.00) was used to compare the mean values of each treatment. The significant difference between the means of the parameter was calculated by using Dunnett's test (< 0·05).

Results

Alcaligenes faecalis (SAB4.2) extract rescued C. elegans from V. alginolyticus infection

Among the screened isolates, crude chloroform extracts (100 μl) of eight SAB isolates had rescued C. elegans from V. alginolyticus infection during the preliminary screening. Crude extract from the isolate SAB4.2 significantly (P < 0·05) promoted the survival rate of C. elegans by 60% against V. alginolyticus infection in 48 h postinfection. In the assay, C. elegans exposed to Vibrio spp. displayed complete death (negative control) and C. elegans exposed to SAB4.2 extract alone (without Vibrio spp. infection) displayed 100% survival (positive control). The ability of the SAB4.2 crude extract to rescue C. elegans against other Vibrio spp. was also tested. The activity of SAB4.2 extract against the other Vibrio strains was not as significant as against V. alginolyticus. Hence, bioactivity of the SAB4.2 isolate against V. alginolyticus was explored in further studies. A full-length 16S rRNA gene sequence of the SAB4.2 isolate was PCR amplified, sequenced and aligned to the closest match using BLAST. The strain SAB4.2 was identified as A. faecalis. The entire 16S rRNA gene sequence was submitted to the GenBank database with the accession number JQ040510.

Purification and characterization of SAB4.2 extract

In total, 20 fractions (2 ml each) collected from silica gel column were tested for their rescue activity. The active fraction (fraction number 8) was collected repeatedly, pooled and evaporated for further assays. The survival assay, with varying concentrations of the column purified extract indicated 300 μg ml−1 as the minimum dose required to display a significant rescue activity of >50% (P < 0·05) (Fig. 1). We observed that the SAB4.2 active fraction displayed no toxic effect on C. elegans. Further, no reduction in life span was observed in C. elegans exposed to the active fraction alone in all the tested concentrations (P < 0·05). Before proceeding with further assays, the purity of the active fraction was analysed using HPLC. The HPLC chromatogram displayed a single major peak at the RT of 52·52. The fraction corresponding to the major peak was collected and tested for the rescue activity. Other minor peaks with no significant intensity were also tested for rescue activity. The results of the rescue assay indicated activity only in the fraction corresponding to the major peak and not in other fractions. The column-purified active fraction was characterized using GC/MS. The results of the mass spectrometry indicated Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3-(2-methylpropyl) as major constituent (29·29%) (Fig. 2). The other compounds identified include l-proline (7·72%) and uric acid (4·52%). Considering the HPLC chromatogram and the GC/MS analysis, it is clear that the major peak corresponds to Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3-(2-methylpropyl) which is the only component to display rescue activity.

Figure 1.

Survival curve for Caenorhabditis elegans exposed to Vibrio alginolyticus, in the presence of various concentrations (150–600 μg ml−1) of column-purified SAB4.2 extract. C. elegans exposed to V. alginolyticus alone displayed complete death (negative control) and C. elegans exposed to SAB4.2 without V. alginolyticus displayed 100% survival (positive control). Data are expressed in percentage of live C. elegans in each group (P < 0·05). (□) V. alginolyticus alone; (▵) V. alginolyticus SAB4.2 150 μg; (image) V. alginolyticus SAB4.2 300 μg; (image) V. alginolyticus SAB4.2 450 μg; (image) V. alginolyticus SAB4.2 6050 μg and (image) SAB4.2 alone 600 μg.

Figure 2.

(a) HPLC analysis of column-purified active fraction of SAB4.2 (b) GC/MS spectra of the major compound Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3-(2-methylpropyl) in column purified active fraction of SAB4.2.

Growth curve and QS inhibition

The column-purified active fraction of SAB4.2 did not inhibit cell proliferation of V. alginolyticus even at a high test concentration of 600 μg ml−1 (Fig. 3a). This result suggested that the SAB4.2 active fraction inhibited only the virulence of V. alginolyticus without affecting the bacterial cell proliferation. QS Inhibition assay performed with the marker strain C. violaceum further confirmed the ability of SAB4.2 to prohibit bacterial communication by inhibiting colour formation (Violacein) in vitro equal to cinnamaldehyde the positive control (Fig. 3b).

Figure 3.

(a) Growth curve analysis: Influence of column-purified active fraction (600 μg ml−1) on growth of Vibrio alginolyticus. The data represent the mean value of experiments performed in triplicates. (b) QS Inhibition: Liquid assay in a multiwell plate for QS inhibition displaying CV control; Cinnamaldehyde (75 mmol l−1) as a positive standard control; CV treated with SAB4.2 active fraction (250 μg ml−1) as test and sterile medium with active fraction alone (250 μg ml−1) as medium control. The SAB4.2-treated sample showed no colour formation in comparison with untreated CV control. No contamination from SAB4.2 active fraction is seen in medium control. (image) V. alginolyticus control and (image) V. alginolyticus + SAB4.2.

Active fraction reduced in vivo colonization of V. alginolyticus

The intensity of GFP fluorescence observed in the gut of C. elegans was directly proportional to the density of pathogen load in C. elegans. CLSM analysis of C. elegans indicated reduced colonization of V. alginolyticus in the presence of SAB4.2 extract at a significantly lower concentration (250 μg ml−1) (Fig. 4a). This in turn indicated the in vivo efficacy of the SAB4.2 active fraction to prevent bacterial adherence, thereby inhibiting colonization in C. elegans intestine. Assays performed using higher concentrations of SAB4.2 active fraction (300–500 μg ml−1) displayed similar results. It should be noted that the in vivo colonization reduction concentration of the SAB4.2 active fraction was lower than the optimal concentration observed in rescue assay (300 μg ml−1) proving the efficiency of the extract in inhibiting the adhesion property of V. alginolyticus. The in vitro time course CFU count of infected C. elegans calculated in the presence of the active fraction (250 μg ml−1) further supported the CLSM data on the reduced intestinal colonization by V. alginolyticus (Fig. 4b).

Figure 4.

(a) In vivo colonization reduction: Confocal laser scanning microscopic images of Caenorhabditis elegans infected with GFP tagged Vibrio alginolyticus displaying reduced in vivo colonization upon treatment with the SAB4.2 chloroform extract; (a,b) Infection in the absence of SAB extract; (c,d) Infection in the presence of the SAB4.2 extract (250 μg ml−1). (b) CFU assay: Kinetic analysis of bacterial colonization in C. elegans in untreated and SAB4.2 extract (250 μg ml−1) treated samples. (image) Untreated and (image) treated.

The presence of the SAB extract improved nematode activity

In C. elegans, food intake by pharyngeal pumping is directly correlated with the activity of animals. It is important to note that the decrease in pharyngeal pumping is a symptom of disease, illness or infection. The pharyngeal pumping of C. elegans was visually scored between control worms infected with V. alginolyticus and worms infected in the presence of the SAB4.2 active extract (250 μg ml−1). The results indicated a gradual decrease in pharyngeal pumping during infection, in the absence of the SAB4.2 extract. In contrast, worms infected in the presence of the active extract displayed pumping rate equal to that of worms treated with the food source E. coli OP50 (Fig. 5).

Figure 5.

Pharyngeal pumping: Treatment with SAB4.2 extract (250 μg ml−1) promotes the activity of Caenorhabditis elegans against Vibrio alginolyticus infection. (■) Control; (□) untreated and (image) treated

In vitro and In vivo antibiofilm activity of SAB4.2

The effect of the SAB4.2 extract on V. alginolyticus biofilm formation was studied on glass slides using crystal violent staining, followed by light microscopic analysis. The inhibition of biofilm was also studied using CLSM, wherein the untreated biofilm always showed higher surface coverage in contrast to the treated samples that displayed disrupted biofilm (Fig. 6a). Quantification of in vitro biofilm inhibition indicated a gradual increase with increase in extract concentration. At a concentration of 250 μg ml−1, the SAB4.2 extract displayed significant (75%) biofilm inhibition activity (Fig. 6b).

Figure 6.

(A) In vitro biofilm inhibition: Effects of SAB4.2 chloroform extract at different concentrations on biofilm formation by Vibrio alginolyticus on glass slides observed under light and Confocal microscopes, (a) Control untreated; (b) SAB4.2 100 μg ml−1and (c) SAB4.2 250 μg ml−1. (B) Dose-dependent biofilm inhibition by SAB4.2 active fraction (100–250 μg ml−1). Statistically significant (P < 0·05) values are indicated by *. (C) In vivo biofilm inhibition: Representative confocal laser scanning microscopic images of biofilm disruption with SAB4.2 chloroform extract at different concentrations on glass slides and on Caenorhabditis elegans outer surface after 24 h, (a) Control untreated; (b) SAB4.2 treated (100 μg ml−1); (c) SAB4.2 treated (250 μg ml−1).

In vivo biofilm analysis from C. elegans CLSM micrographs displayed a significant difference in the surface biofilm between the control and the treated samples (Fig. 6c). The density of adhering bacteria on C. elegans surface was imaged and analysed using the software provided with the CLSM instrument. The intensity of fluorescence in the control animal without the SAB extract treatment was much higher (250 units) than the SAB4.2 treated samples (50 units). The above results confirmed the ability of the SAB4.2 to reduce V. alginolyticus adherence both in vitro and in vivo.

Regulation of QS responsible genes

The luxT gene, a strong regulator of the V. alginolyticus QS system and lafK gene (responsible for a swarming phenotype which is under control of luxT) were reported for their significant role in V. alginolyticus infection (Liu et al. 2012). As the SAB4.2 active fraction displayed significant reduction in the QS-mediated violacein production in the C. violaceum strain and inhibited QS-controlled biofilm formation in V. alginolyticus, the effect of the SAB extract on the transcription of V. alginolyticus QS genes was analysed using qPCR. The results indicated a significant down regulation of luxT and lafK genes in V. alginolyticus exposed to the SAB4.2 active fraction (Fig. 7). Taken together, all these results ascertain the quorum-sensing inhibition mechanism of the SAB4.2 extract against V. alginolyticus. Further studies on understanding the complete QS pathway regulation in the presence of SAB4.2 active fraction will provide clear information on the mechanism of action.

Figure 7.

Regulation of Vibrio alginolyticus QS regulator genes, luxT and lafK in control and SAB4.2 extract (250 μg ml−1) treated samples. (■) Control and (□) treated.

Discussion

Marine sponges are an untapped source of anti-infectives and act as shelter for diverse microbial communities (Garson 1993). The present study screened secondary metabolites from marine bacterial isolates associated with the sponge Haliclona simulans for their ability to rescue C. elegans against Vibrio spp. infection. C. elegans provide a strong platform for screening bioactives from medicinal plants, natural product libraries and synthetic chemical libraries against bacterial pathogens (Bhavsar and Brown 2006; Moy et al. 2006, 2009; Adonizio et al. 2008). Hence, the primary objective of the study was to exploit the amenability of the model organism for in vivo screening of anti-infectives from sponge-associated bacteria. In contrast to traditional plate assay methods, the activity and toxicity of the extracts under examination were validated in a single step while using in vivo screening (Moy et al. 2006). The simplicity of C. elegans system allowed for the screening of a large number of samples in a short time period (Bhavsar and Brown 2006). Although C. elegans have been previously used as a screening model in the identification of anti-infectives, this is the first study to validate the bioactivity of marine bacterial extract using C. elegans based screening against V. alginolyticus. Previously, C. elegans has been established as a model for Vibrio spp. infection and the infection related phenotypic changes, including bacterial colonization, pharyngeal activity and transcriptional regulation of immune responsible genes, have been reported (Durai et al. 2011a,b).

With the knowledge about infection from our previous studies, preliminary screening using chloroform extract of SAB isolates was performed against V. alginolyticus to observe various phenotypic parameters. The observed parameters included (i) rescue of the nematode against V. alginolyticus infection; (ii) negligent toxicity of the extract to C. elegans and (iii) developmental changes in C. elegans due to extract treatment (egg laying). Results of the preliminary screening identified 8 SAB isolates that promoted C. elegans survival against V. alginolyticus infection without displaying toxicity and developmental changes. Toxicity assays in C. elegans are well established and have been reported to be comparable with higher animal models (Williams and Dusenbery 1990) and mammalian cell lines (Moy et al. 2006). Hence, the active compound identified by the current C. elegans-based screening assay can be easily taken to drug trials. The results suggested that the SAB4.2 extract displayed significant rescue activity (60%) only against V. alginolyticus infection.

HPLC analysis of the column-purified active fraction showed a single major peak that exhibited the rescue activity. GC/MS analysis of the major fraction revealed the presence of Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3-(2-methylpropyl) as the major constituent (29·29%). The compound identified in the present study was previously isolated from sponge-associated bacteria and reported for its bioactivity including antibiofilm and antilarval settlement activity against Vibrio halioticoli (Dash et al. 2009).

Identification of natural anti-infectives that target the virulence of bacteria rather than the survival is considered to be highly important (Clatworthy et al. 2007). To understand the mechanism of action of SAB4.2 extract in promoting survival of C. elegans, in vitro assays were performed. From comparing the in vitro growth assay and the in vivo rescue assay, it became clear that SAB4.2 rescues C. elegans from V. alginolyticus infection by a different mechanism without affecting the growth of the bacteria. Also, it is observed that low concentration of SAB4.2 is efficient under in vivo conditions compared with in vitro. The reason behind this could be SAB4.2 mainly inhibits the bacterial cell to cell communications that could reduce the quorum-sensing-mediated virulence phenotypes like adhesion. Due to reduced adhesive property of the pathogen the level of colonization in C. elegans intestine might be reduced, and hence, there was a reduction in pathogenesis. The other possible reason for this could be the efficiency of SAB4.2 to support the innate immune system of C. elegans and act efficiently to digest the pathogen and cure the infection paving way for survival in the presence of SAB4.2. Similar results regarding efficient in vivo activity of screening compound was also observed by Moy et al. 2006. The efficiency of high throughput screen to identify compounds targeting the virulence of V. cholera has been previously reported (Hung et al. 2005). The ability of cinnamaldehyde derivatives to interfere with the AI-2-dependent QS system of Vibrio spp. and its ability to rescue Artimia shrimp against Vibrio harveyi infection has been documented in earlier studies (Brackman et al. 2009; Musthafa et al. 2011). Antipathogenic activity of marine bacterial isolates in inhibiting the virulence of Gram-negative bacterium Pseudomonas aeruginosa by targeting the AHL-mediated virulence factor has also been reported (Musthafa et al. 2011). In many cases, the marker strain C. violaceum was used to identify the QS inhibition activity of marine metabolites (Adonizio et al. 2008; McLean et al. 2008; Bakkiyaraj and Pandian 2010; Nithya et al. 2010; Annapoorani et al. 2012). Hence, the ability of SAB4.2 to inhibit QS was studied initially using the marker strain C. violaceum. The assay suggested that SAB4.2 significantly quenched the QS-mediated pigment production in C. violaceum.

Intestinal colonization and persistence are claimed as the major routes by which V. alginolyticus establishes infection in C. elegans (Durai et al. 2011b). The persistence and integrity of the bacterium in C. elegans intestine has a crucial role in infection manifestation. In vivo integrity of bacteria leads to the enhanced accumulation of bacterial cells resulting in the formation of an extracellular matrix and provides the environment necessary for biofilm formation (Sousa et al. 2009). It was observed that adhesive property and biofilm formation play major roles in V. alginolyticus infection in human and marine hosts (Snoussi et al. 2008). In the current study, CLSM analysis of SAB4.2 treated C. elegans revealed reduced pathogen colonization in the intestine. In vitro bacterial colonization assay proved the ability of SAB4.2 extract in reducing pathogen CFU in the infected worm intestine. Biofilm assay performed in vitro proved the ability of SAB4.2 to reduce the adherence of V. alginolyticus on a glass slide. The in vivo biofilm assay on C. elegans also confirmed reduced adhesion of V. alginolyticus in the presence of SAB4.2 extract. Previously, many marine and nonmarine micro-organisms have been proven to reduce virulence by inhibiting biofilm formation against pathogenic bacteria (Valle et al. 2006; Jiang et al. 2011). Recently, SAB belonging to Bacillus spp. was reported to inhibit biofilm formation in E. coli (Sayem et al. 2011). Extracts from coral associated bacteria and coral associated actinomycetes were also reported to have antibiofilm activity against Streptococcus pyogenes (Nithyanand et al. 2010) and clinical isolates of S. aureus (Bakkiyaraj and Pandian 2010). Inhibiting virulence without affecting the growth of bacteria is a better way of screening to avoid emergence of antibacterial resistance behaviour against antibiotic compounds. Hence, natural compounds inhibiting the conserved virulence pathway of many pathogenic bacteria can become a potent lead to combat future bacterial infections. The quorum-sensing system among the bacterial community is a primary target of recent screening studies to reduce virulence without cell lethality. The V. alginolyticus QS system was identified to be similar to that of V. harveyi, involving the LuxO and LuxR system controlling the major virulent factors (Liu et al. 2012; Rui et al. 2008; Ye et al. 2008). Recently, a new regulator, LuxT, was identified to control LuxO at the transcriptional level and LuxR at post-transcriptional level (Liu et al. 2012). The effect of SAB4.2 extract on V. alginolyticus luxT regulation was proven for the first time using real-time PCR. Down regulation of luxT and lafK upon SAB4.2 treatment might have prevented V. alginolyticus from adherence and in vivo colonization, thereby preventing infection in the nematode. The efficiency of C. elegans-based screening for the validation of QS regulators from South Florida medicinal plant has been previously reported against P. aeruginosa (Adonizio et al. 2008). With the results of the present study and previous validation, it is evident that C. elegans-based screening can identify not only antimicrobials and immune modulators (Moy et al. 2006) but also new leads attenuating bacterial virulence.

To our knowledge, this is the first study employing an in vivo screening system to identify sponge associated bacteria which produce bioactive compounds with rescue activity against V. alginolyticus infection in C. elegans. The present study confirmed that using such efficient screening systems with stringent criteria for identification of novel anti-infective producers will lead to new perspectives of screening methods.

Acknowledgements

This study was supported in part by the Grants from University Grants Commission (UGC), Department of Biotechnology (DBT), Council of Scientific & Industrial Research (CSIR), and Department of Science and Technology (DST), Ministry of Science and Technology, India to Dr. K. Balamurugan. Financial support to S. Durai provided by Lady Tata Memorial Trust in the form of Senior Scholarship is thankfully acknowledged. The authors acknowledge the computational and Bioinformatics facility provided by Alagappa University Bioinformatics Infrastructure Facility (funded by DBT, GOI; Grant No. BT/BI/25/001/2006). Also, the authors thankfully acknowledge Miss. S. Krishnaveni for her timely help in manuscript preparation.

Conflict of Interest

No conflict of interest declared.

Ancillary