Enterococcus faecalis strain LZ-11 isolated from Lanzhou reach of the Yellow River is able to resist and absorb Cadmium

Authors


Abstract

Aim

Lanzhou reach of the Yellow River is contaminated by cadmium (Cd(II)). The aim of this study was to screen bacterial strains that is able to resist and absorb cadmium from soil sediment and elucidate the molecular mechanism.

Methods and Results

A strain named LZ-11 which can resist 1 mmol l−1 and absorb 0·3 mmol l−1 cadmium was isolated from a petrochemical wastewater discharge site. 16S rRNA gene sequencing data and Vitek phenotype results revealed that it was closely related to Enterococcus faecalis. Transmission electron microscopy images and energy dispersive X-ray analysis results showed that Cd(II) was absorbed both intracellularly and extracellularly. Blast results showed that Enterococcus faecalis genome owns cadA, ppx and dsbA which are proven to be involved in Cd(II) resistance and absorption. Quantitative real-time PCR data demonstrated that thesethree genes were upregulated 2–3 folds in LZ-11 under Cd(II) treatment.

Conclusions

We've isolated a strain named LZ-11 from Lanzhou reach of the Yellow River which can resist and absorb Cd(II). LZ-11 was closely related to Enterococcus faecalis. Genes encoding CadA, Ppx and DsbA were up-regulated under Cd(II) treatment. These genes might confer Cd(II) resistance and absorption in Enterococcus faecalis strain LZ-11.

Significance and Impact of the Study

Lanzhou reach of the Yellow River is contaminated by heavy metals. Microbial research and remediation is still scarce. LZ-11 is the first strain that is able to resist and absorb Cd(II) isolated from this area and might be a good candidate for future cadmium bioremediation.

Introduction

Lanzhou city is one of the most important industrial cities in northwest China and replies on the Yellow River for water resources (Bojie and Liding 1996). The discharged industrial wastewater containing heavy metals, organics/inorganics compounds in Lanzhou pollutes the Yellow River water and potentially harms the downstream population's health (Gao et al. 2004). Cadmium, mainly Cd(II), is widely applied in industrial processes including plastics, electroplating, alloy manufacturing, batteries and paints (Deng et al. 2007) and thus is one of the major pollutants in Lanzhou reach with Average Contaminative Index (ACI) of 2·62 (unpublished data). As a heavy metal, Cd(II) has fatal effects on organisms and is extremely toxic at relatively low dosage (Abou-Shanab et al. 2007). Cd(II) can bind to sulfhydryl groups, and disrupt protein function (Cunningham and Lundie 1993; Jungmann et al. 1993). Cd(II) is the repressor of thioredoxin which provides reducing power for many biological reactions (Li and Krumholz 2007). Furthermore, Cd(II) affects cell proliferation, differentiation, apoptosis and increases oncogene activation to carcinogenesis (Schwartz and Reis 2000; Filipič et al. 2006).

Removal of heavy metals from the contaminated soil or water is crucial for environmental protection (Lloyd and Lovley 2001). Microorganisms have developed survival strategies in heavy metal polluted habitats. Their different detoxifying mechanisms such as bioaccumulation, biotransformation, biomineralization and absorption can be applied for economical bioremedication processes (Lovley 2000; Lin and Lin 2005). In previous reports, many bacteria including Pseudomonas aeruginosa PU21 (Chang et al. 1997), Escherichia coli (Quintelas et al. 2009), Geobacillus stearothermophilus (Hetzer et al. 2006) and G. thermocatenulatus Pantoea sp. TEM18 (Ozdemir et al. 2004) have demonstrated ability of accumulating Cd(II) by absorption and good bioremediation potential as well.

Enterococcus faecalis is a Gram-positive, commensal bacterium inhabiting at the gastrointestinal tracts and in soil environments (Ryan and Ray 2004). It shows a high natural resistance to Cd(II) (Paplace et al. 1996). However, there is yet no report on the mechanism of Cd(II) resistance or absorption in E. faecalis. In this study, an E. faecalis strain LZ-11 which can resist and absorb Cd(II) was isolated from Cd (II)-contaminated sediment in Lanzhou reach of the Yellow River. And We discovered that genes cadA, ppx and dsbA might be involved in Cd(II) processing in the isolated strain. As a new addition to the Cd-resistant family, E. faecalis LZ-11 might be useful in Cd(II) bioremediation in Lanzhou reach of the Yellow River.

Materials and methods

Sampling site

Soil samples were collected from Lanzhou reach of the Yellow River. The sampling sites were polluted by the wastewater discharged from a petrochemical corporation. The location of the sampling site is 36°13′N 103°63′E (Fig. S1). The sample was collected at a depth of 15 cm at 18°C, pH 5·4. The isolation of Cd(II) resistance strains was done right after the samples were transported to our laboratory in the sterilized aluminum boxes.

Isolation of Cd(II)-resistant strains and culture conditions

Strains LZ-11, LZ-12, LZ-13 and LZ-14 were isolated from the soil samples. The strains were grown in the basal medium which was prepared as follows (per liter) 3 g Yeast, 2·5 g NaCl, 3 g Tryptone and 2 g MgSO4·H2O. The pH was adjusted to 6·8 by 1 mol l−1 piperazine-1,4-bisethanesulfonic acid (PIPES) buffer solution. The stock solution of 0·5 mol l−1 CdCl2 was prepared in purified water and autoclaved at 121°C for 20 min. Then, 1 g soil were added to 9 ml 0·85 mmol l−1 NaCl solution and cultivated at room temperature for 4 h. In order to isolate the Cd(II) -resistant strains, 100 μl of the suspension was added to 5 ml basal medium with 50 μmol l−1 CdCl2 and incubated at 180 rpm, at 37°C for 24 h. Then the strains were incubated on a solid medium which contained 1 mmol l−1 CdCl2 at 37°C for 12 h. Single colonies were collected and re-selected in liquid basal medium containing 500 μmol l−1 CdCl2 solutions.

Identification of the Cd(II) resistant strains

Isolates were grown in 5 ml liquid medium on a shaker (180 rpm) at 37°C for 12 h. DNA was extracted from the suspension according to the method described by Wilson (Wilson 1987). Universal bacterial 16S rRNA gene primers (Table 1) were used to amplify the 16S rRNA gene fragments (Suzuki and Giovannoni 1996). The fragments were sequenced at ShangHai Majorbio Bio-pharm Technology Co. Ltd (Shanghai, China) and the sequences were analyzed at NCBI (http://www.ncbi.nlm.nih.gov/) database and EzTaxon (http://147.47.212.35:8080/) database. Physiological tests were also carried out to identify the strain by using the Vitek 2 System (bioMérieux Industry, Marcy l'Etoile, France) according to the manufacturer instructions. Strain LZ-11 was examined with the colorimetric identification GP card with 64 different carbon sources as well as antibiotic resistance and enzyme activities.

Table 1. The primer used in this study
PrimerSequence
  1. R means the primer used for qRT-PCR. W means the primer used to amplify the whole sequence.

cadA(R)5′TACGCCCAGAAGCAAAAGAG3′/5′ATCGTTTCTGCAACGGATTC3′
ppx(R)5′TGGCTACAGCGGAACTAACA3′/5′ATAGCTGTCGGATTGGCATT'
dsbA(R)5′TGTTTTCCAATGTCTGACCG3′/5′AATCGTTTGCTGACCATCCT3′
16S rRNA gene5′GCAAGTCGAACGTTCTTTC3′/5′CCCCTCTGATGGGTAGGTTA3′
cadA(W)5′AACAATTGAAAACTGGTATAAAAAA3′/5′TAATCCATGGTTTCCGACCAA3′
ppx(W)5′ATTTCTTCTTAACAAGCAAAAAC'3/5′ATAGTGTGCCAACTATTTCTTC'3
dsbA(W)5′TTTTGTTTCATCTTTTTCTTTTAATT3′/5′AATATTATTCCAGTATTCTCTATA
16S rRNA gene5′GGTTACCTTGTTACGACTT3′/5′AGAGTTTGATCMTGGCTCAG3′

Determination of optimum pH and temperature for Cd(II) resistance

Isolated strain LZ-11 was cultivated in medium containing 1 mmol l−1 Cd(II) at pH 5, 6, 7 and 8, respectively at 180 rpm and 37°C. The optimum temperature test was carried out between 22 and 42°C at pH 6·8 (22, 28, 30, 37, 42°C). Growth curves were determined at OD 600 nm. All experiments were performed with three replicates.

Determination of the minimum inhibitory concentration of Hg(II), U(VI), Cr(VI) and Cd(II)

The stock solutions of Hg(II), U(VI), Cr(VI) and Cd(II) were prepared (100 mmol l−1 UO2(NO3)2, 0·5 mmol l−1 K2Cr2O7, and 0·5 mmol l−1 CdCl2 with sterile water and autoclaved at 121°C for 20 min; 0·1 mmol l−1 sterile ready HgCl2 was obtained from Chemistry Department, Lanzhou University). The basal medium was used to determine the minimum inhibitory concentration (MIC) of Hg(II), Cd(II), and a medium containing 2·5 g l−1 Tryptone, 1·25 g l−1 Yeast, 5 g l−1 NaCl, 3·612 g l−1 Citric acid and 1·6 g l−1 NaOH was used to determine the MIC of U(VI). 100 μl 12-h culture were added to 5 ml medium containing different metals and cultured at 37°C, 180 rpm for 16 h. All experiments were performed with three replicates.

Cd(II) absorption in strain LZ-11

Strain LZ-11 and E. coli DH5α was incubated in 500 ml liquid basal medium on a shaker (180 rpm) at 37°C for 12 h. Then the culture was centrifuged (10 000 g × 2 min) and washed with 1 mol l−1 PIPES buffer solution twice. The cell pellets were resuspended in 1 ml 1 mol l−1 PIPES buffer containing 1 mmol l−1 CdCl2 solutions and incubated on a shaker (180 rpm) at 37°C. One millilitre samples were took out and centrifuged (10 000 g × 2 min) after incubated 3 h. The supernatants of the culture were used for Cd(II) concentration determined by Atomic absorption spectrophotometer (Chen and Teo 2001). Escherichia coli DH5α was used as negative control. All experiments were performed with three replicates.

Cd (II) detection by transmission electron microscopy analysis

Strain LZ-11 was cultivated in basal medium with or without 1 mmol l−1 Cd(II) at 37°C, 180 rpm for 24 h. Cells were harvested by centrifugation (12 000 × g) at 4°C for 2 min, and washed twice with deionized water, and resuspended in 2·5% (v/v) glutaraldehyde in phosphate buffered saline (PBS) for 2 h. Then the Cells were washed four times in PBS and fixed by 1% (w/v) osmium tetroxide for 2–3 h followed by three-times wash with PBS. After that, the samples were dehydrated in 50, 70, 90, and 100% (v/v) ethanol for 10 min each. Then samples was incubated in the mixture of epoxy resin and acetone (v/v = 1/1 for 1 h, v/v = 3/1 for 3 h) in epoxy resin overnight. The cells were re-centrifugated (12 000 × g, 2 min) among three steps. After that, samples were embedded in solid resin blocks for 24 h at 70°C and sectioned on a microtome. Ultra-thin sections were observed using Transmission Electron Microscopy (TEM) (TecnaiG2F30; FEI, Hillsboro, OR, USA) and the precipitates were determined by EDX. Escherichia coli DH5α was used as negative control.

Genome screen for genes that might be involved in Cd(II) resistance and absorption

In order to address the mechanism of chromate reduction in strain LZ-11, we blasted the genomes of Enterococcus faecalis OG1RF, Enterococcus faecalis V583 and Enterococcus faecalis 62 in NCBI database with amino acids sequences of proteins involved in Cd(II) resistance and absorption by previous studies. We found that Enterococcus faecalis genome contains analogs of ppx, cadA and dsbA which confer Cd(II) resistance and absorption (Nucifora et al. 1989; Akiyama et al. 1993; Rensing et al. 1997). All three genes were amplified with selected primers (Table 1) and sequenced (ShangHai Majorbio Bio-pharm Technology Co. Ltd). The sequences were then blasted against ppx, cadA and dsbA.

Expression profiles of cadA, ppx and dsbA under Cd(II) treatment

Strain LZ-11 was grown in basal medium with or without (as a negative control) 0·2 mmol l−1CdCl2 on a shaker (180 rpm) at 37°C. The cells were harvested at OD600 nm of 0·3 and the total RNA was extracted by SV Total RNA Isolation Kit (Promega, Beijing, China) according to the manufacturer's instructions. cDNAs were synthesized by PrimeScriptRT reagent Kit (TaKaRa, Dalian, China) with random hexmers. Quantitative real-time PT-PCR was carried out to determine the expression levels of cadA, ppx, dsbA, the 16S rRNA gene was used as the endogenous control. The primers used for RT-PCR were shown in the Table 1. Reactions were performed on Thermal Cycler Dice Real Time system according to the manufacturer's instructions. For real-time PCR, reaction mixture contained 0·8 μl cDNA, 0·2 μl of each primer (20 mmol l−1), 5 μl SYBR green PCR Master Mix, and distilled water with a final reaction volume of 10 μl. The Taq DNA polymerase was activated at 95°C for 10 min; and the cycle was composed of 40 cycles of 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s. The relative quantification ratio can be obtained according to the follow equation (Pfaffl 2001):

display math

Results

Isolation and identification of a Cd (II)-resistant strain

Four strains which can resist 0·5 mmol l−1 Cd(II) were isolated from the soil sediments and one strain that can resist 1 mmol l−1 Cd (II) was named LZ-11 and chosen for further studies. 16S rRNA sequencing analysis showed that all four strains were closely related to Enterococcus faecalis (Fig. S2). Vitek phenotype result identified strain LZ-11 as Enterococcus faecalis with 99% similarity (Table S1).

Optimum growth conditions

The most suitable temperature for Cd(II) resistance and growth of strain LZ-11 was 37°C (Fig. 1b). The maximum growth for strain LZ-11 with Cd(II) was achieved at pH 7 (Fig. 1a).

Figure 1.

The optimum growth conditions of LZ-11 with 1 mmol l−1 Cd(II) was determined by spectrophotometer (optical density, OD) at 600 nm. (b) (□) Temperature at 22°C; (■) Temperature at 28°C; (▲) Temperature at 32°C; (♦) Temperature at 37°C; (♢) at 42°C. (a) (●) pH at 5; (♦) 6; pH at (■) 7; pH at (▲) 8. Results represent the means of three separate experiments, and error bars indicated.

Resistance of heavy metals in strain LZ-11

Strain LZ-11 can resist 1 mmol l−1 Cd(II). We also tested its tolerance to other heavy metals, including Cr(VI), Hg(II), and U(VI). Strain LZ-11 showed high resistance to U(VI) (4 mmol l−1). It can also tolerate 1 mmol l−1 Cr(VI). However, it was very sensitive to Hg(II) (Table 2).

Table 2. MICs of different heavy metal in strain LZ-11
MetalsConcentration (mmol l−1)
0·0050·010·511·52344·55
  1. a

    Cd(II) forms precipitates in basal medium when concentration is higher than 1·5 mmol l−1.

Cr(VI)++++
Hg(II)+
U(VI)++++++++
Cd(II)++++N/AaN/AN/AN/AN/AN/A

Strain LZ-11's growth under different Cd(II) concentrations

To determine the Cd(II) resistance ability of strain LZ-11, its growth under different concentrations of Cd(II) were measured. The growth of strain LZ-11 was not affected by Cd(II) at 1 mol l−1 or lower concentrations, but it was impaired under 1 mol l−1 Cd(II) (Fig. 2a). Escherichia coli DH5α which was sensitive to Cd(II) was used as negative control (Fig. 2b).

Figure 2.

Microbial growth of strain LZ-11 monitored by spectrophotometer (optical density, OD) at 600 nm under different Cd(II)concentrations. For clarity, the data reflect the growth conditions at 8 h (a). Control was Escherichia coli DH5α (b). Results represent the means of three separated experiments, and error bars indicated. (♦) 0μmol l−1 Cd(II), (▲) 250μmol l−1 Cd(II), (■) 500μmol l−1 Cd(II).

Cd(II) was absorbed in Strain LZ-11 in resting cells assay

We tested whether LZ-11 resist Cd(II) via absorption by resting cells assay. The initial Cd(II) concentration of the assay was 0·95137 ± 0·02233 mmol l−1. After 3 h incubation, the Cd(II) concentration of the liquid phase was 0·65653 ± 0·0327 mmol l−1 (Table 3). The Cd(II) absorption rate was 32·3436% while the E. coli DH5α was 0·887856 ± 0·00612 mmol l−1, 0·763891 ± 0·002024 mmol l−1 and 13·9624%, respectively. This result indicated that the absorption rate of strain LZ-11 was three times than control E. coli DH5α.

Table 3. The absorption ability of strain LZ-11 compared to Escherichia coli DH5α
StrainsCd(II) concentration (mmol l−1)Absorption rate (%)
InitialAfter 3 h
Strain LZ-110·951368 ± 0·0223280·643662 ± 0·00516332·3436
E. coli DH5α0·887856 ± 0·006160·763891 ± 0·00202413·9624

Location of the absorbed Cd(II) in strain LZ-11

To determine the location of the absorbed Cd(II) in strain LZ-11, we performed Transmission-electron microscopy (TEM) analysis. The TEM image data indicated that the precipitates formed inside cells. Energy Dispersive X-Ray EDX Analysis detected the Cd(II) was inside cells and on the membranes even though it hard to see the precipitates on the membranes (Fig. 3b). No precipitates were observed in the negative control which was strain LZ-11 cells without Cd(II) treatment (Fig. 3a). The result revealed that strain LZ-11 absorbed Cd(II) both intracellularly and extracellularly.

Figure 3.

TEM micrographs of strain LZ-11 cells grown with 1 mmol l−1 Cd(II) (b) and without Cd(II) (a).

Identify the genes involved in Cd(II) resistance and absorption in strain LZ-11

We then explored molecular mechanism of Cd(II) resistance and absorption in strain LZ-11 by identifying genes that might be involved. We screened Enterococcus faecalis genome for genes that might be involved. The genome consists of cadA, ppx and dsbA genes by blasting. We then used PCR to amplify homologs of these genes in LZ-11. The sequencing result showed that the homologs in strain LZ-11 were similar to cadA (Gene ID: 1201482, 99% similarity), ppx (Gene ID: 12287928, 98% similarity), and dsbA (Gene ID: 12289919, 98% similarity) and further confirmed that strain LZ-11 has these three genes on its genome. Expression of cadA, ppx and dsbA was monitored at transcript level in strain LZ-11 grown with or without 0·2 mol l−1 Cd(II) (Table 4). Expressions of ppx and cadA were upregulated twofold and dsbA threefold with Cd(II) treatment. These results suggested that genes ppx, cadA, and dsbA might be involved in Cd(II) resistance and absorption in strain LZ-11.

Table 4. The expression levels of cadA, ppx, and dsbA during 0·2 mmol l−1 cadmium treatment
GeneExpression unitsFold change
Without Cd(II)Cd(II)
  1. The expression units of gene 16S rRNA was 1000 units.

cadA 0·281367 ± 0·0498240·611098 ± 0·0956552·171895
ppx 0·671073 ± 0·0619051·308336 ± 0·0848581·949617
dsbA 0·400156 ± 0·0266541·230806 ± 0·0847713·075817

Discussion

Lanzhou reach of the Yellow River is heavily contaminated by industrial wastes. Bacteria previously isolated from this environment showed heavy metal resistance and remediation potential (Zhang et al. 2013). In this study, we have isolated bacteria with high resistance to Cd(II). Previous study showed that Enterococcus faecalis can resist 50 mg ml−1 Cd(II) in M17 medium (Paplace et al. 1996). In this study, we've tested M17 medium and we found that the Cd(II) precipitates in M17 medium once the Cd(II) was above 1·83 mg l−1. Therefore, M17 medium was not a suitable for further study and the resistance ability of strain LZ-11 was not comparable to the previous one. Instead, we used a modified basal medium in which Cd(II) won't form precipitates up to 2 mmol ml−1 (El-Helow et al. 2000). The strain LZ-11 showed higher Cd(II) resistance than many bacteria including Bacillus thuringiensis (El-Helow et al. 2000), Pseudomona putida KNP9 (Tripathi et al. 2005), Enterobacter cloacae and Klebsiella (Haq et al. 1999) and Spirulina Indica (Siva Kiran 2012). The high resistance of Cd(II) and other heavy metals in LZ-11 might be related the adaptation of the heavy Cd(II) contamination in Lanzhou reach of the Yellow River and strain LZ-11 might be a good candidate for Cd(II) bioremediation in this area.

Desulfovibrio desulfuricans DSM 1926 can absorb Cd(II) inside cytoplasm and on the membrane (Naz et al. 2005). In agreement with the previous study, our TEM and EDX data also showed that strain LZ-11 absorbed Cd(II) both intracellularly and extracellularly. This result also showed that LZ-11 has a complex Cd(II) absorption mechanism. Gene cadA encodes a P-type ATPase reportedly involved in Cd(II) resistance in Staphyococcus aureus (Nucifora et al. 1989), Listeria monocytogenes (Lebrun et al. 1994), Stenotrophomonas maltophilia (Alonso et al. 2000) and Helicobacter pylori (Herrmann et al. 1999). In a previous study, CadA ATPase were indicated to transport Cd(II) in a directly ATP-dependent manner in strain Bacillus subtilis (Tsai et al. 1992). cadA was upregulated under erythromycin treatment in Enterococcus faecalis V583 (Aakra et al. 2005). But cadA's role in Cd(II) stress response in Enterococcus faecalis was not clear. Our quantitative PCR data showed that cadA was upregulated twofold under Cd(II) treatment which suggesting that gene cadA might be involved in Cd(II) resistant and absorption in LZ-11. Exopolyphosphatases (Ppx) can remove the terminal phosphate of polyphosphate (Akiyama et al. 1993) and polyphosphate kinase (Ppk) transfer the terminal phosphate of ATP to polyphosphate (Ahn and Kornberg 1990). In our case, ppx in strain LZ-11 was overexpressed under Cd(II) treatment, and it might increase the tolerance to Cd(II) by producing cadmium phosphide precipitates (Akiyama et al. 1993). In this study, we've found that ppx gene was upregulated twofold by Cd(II) addition indicating that this gene was also involved in Cd(II) resistance. However, we didn't find ppk gene or its homologs in Enterococcus faecalis genomes by blasting or arbitrary PCR amplification. This result suggests that there might be another protein plays the similar role of Ppk in LZ-11 which requires further study. The product of gene dsbA is a periplasmic protein associated with disulfide bond formation (Bardwell et al. 1991). and DsbA protein can binds to Cd(II) and confers Cd(II) resistance in the strains of Escherichia coli (Rensing et al. 1997). In strain LZ-11, dsbA was overexpressed under Cd(II) treatment. This result implied that dsbA might confer Cd(II) in LZ-11.

Based on our data and previous studies, we have elucidated the mechanism of Cd(II) absorption and resistance in strain LZ-11 (Fig. 4). First, Cd(II) was uptaken through magnesium, zinc, calcium uptake system (Hinkle et al. 1987; this study). Cd(II) was then partially transported out through P-type ATPases (Tsai et al. 1992) precipitated with phosphate groups which were secreted by PpX as cadmium phosphide (Akiyama et al. 1993; this study). Then DsbA protein binds to the free Cd(II) ion in the cytosol to protect the thioredoxin and other proteins (Rensing et al. 1997; this study). Therefore, strain LZ-11 has high Cd(II) resistance and absorption ability and it might be considered as a good candidate for Cd(II) remediation in Lanzhou reach of the Yellow River.

Figure 4.

The mode pattern of Cd(II)resistance and absorption in strain LZ-11.Cd(II) was taken through the Mn2+/Zn2+/Ca2+ transporter and transport out by a P-type ATPase, the intracellular Cd(II)was performed the precipitate of cadmium phosphate or transfer to extracellular to combine with phosphate radical and the product of dsbA will prevent the Cd(II)combine with free thiols to enhance the tolerance.

Acknowledgements

This work was supported by National Natural Science Foundation grant 31200085 to X. Li 31100888 to P. Liu and Gansu Provincial Science and Technology support program 1104NKCA092 to Y. Chen.

Conflict of interest

All authors have read the manuscript and approved to submit to Journal of Applied Microbiology. We also ensure that no material submitted as part of this manuscript infringes existing copyrights or the rights of a third party.

Ancillary