Development of Methanoculleus-specific real-time quantitative PCR assay for assessing methanogen communities in anaerobic digestion

Authors

  • S. Chen,

    1. Department of Civil and Environmental Engineering, The University of Tennessee, Knoxville, TN, USA
    Search for more papers by this author
  • Z. Zhu,

    1. Department of Civil and Environmental Engineering, The University of Tennessee, Knoxville, TN, USA
    Search for more papers by this author
    • Primers/probes designed in this study are shown in boldface type.

  • J. Park,

    1. Farragut High School, Knoxville, TN, USA
    Current affiliation:
    1. Dartmouth College, Hanover, NH, USA
    Search for more papers by this author
  • Z. Zhang,

    1. College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • Q. He

    Corresponding author
    1. Department of Civil and Environmental Engineering, The University of Tennessee, Knoxville, TN, USA
    2. Institute for a Secure and Sustainable Environment, The University of Tennessee, Knoxville, TN, USA
    • Correspondence

      Qiang He, Department of Civil and Environmental Engineering, The University of Tennessee, Knoxville, TN 37996, USA. E-mail: qianghe@utk.edu

    Search for more papers by this author

  • Kuo Testing Laboratories, Othello, WA, 99344, USA

Abstract

Aim

To develop a Methanoculleus-specific real-time quantitative PCR (RT-qPCR) assay with high coverage and specificity for the analysis of methanogenic populations in anaerobic digestion.

Methods and Results

A Methanoculleus-specific primer/probe set for RT-qPCR was designed in this study based on all Methanoculleus 16S rRNA gene sequences in Ribosomal Database Project (RDP) according to TaqMan chemistry. The newly designed primer/probe set was shown to have high coverage and specificity by both in silico and experimental analyses. Amplification efficiency of the Methanoculleus-specific primer/probe set was determined to be ideal for RT-qPCR applications. Subsequent field testing on anaerobic digesters showed that results from RT-qPCR were consistent with those from clone library analysis, validating the accuracy of the RT-qPCR assay.

Conclusions

The Methanoculleus-specific RT-qPCR assay designed in this study can serve as a rapid and effective tool for the quantification of Methanoculleus populations in anaerobic digestion.

Significance and Impact of the Study

Methanoculleus populations represent important members of archaeal communities in methanogenic processes, necessitating the need to develop effective tools to monitor Methanoculleus population abundance. The RT-qPCR developed in this study provides an essential tool for the quantification of Methanoculleus populations in anaerobic digestion and for the understanding of the functions of these methanogens in anaerobic biotransformation.

Introduction

Anaerobic digestion is a proven technology for the treatment of organic wastes, such as food residue and animal manure (Zhu et al. 2011; Nasir et al. 2012). Recent interest in anaerobic digestion has grown significantly due to its potential in producing biogas as a source of renewable energy and reducing greenhouse gas emission (Abbasi et al. 2012). The broader application of anaerobic digestion as a sustainable waste treatment option, however, requires further improvement in treatment efficiency and process stability (Gupta et al. 2012). Given the importance of methanogenic microbial populations in the anaerobic conversion of organic substrates to biogas, the ability to monitor the population dynamics of methanogens is critical for identifying the key indicators of process stability and metabolic pathways controlling anaerobic biotransformation (Appels et al. 2011).

Considerable efforts have been made to developing tools, particularly culture-independent molecular techniques, for the monitoring of methanogens in anaerobic environments (Narihiro and Sekiguchi 2007). Real-time quantitative polymerase chain reaction (RT-qPCR) has emerged as a rapid technique to target specific microbial populations with high sensitivity (Smith and Osborn 2009). Of the two main chemistries used in RT-qPCR, that is, TaqMan and SYBR Green, the former is considered to be capable of providing greater target specificity in microbial ecology studies with the use of an extra oligonucleotide probe in addition to the set of primers used by SYBR Green (Wang and Brown 1999), leading to the development of a series of TaqMan RT-qPCR assays for methanogen populations by targeting the 16S rRNA genes (Shigematsu et al. 2003; Tang et al. 2005; Yu et al. 2005; Sawayama et al. 2006).

Given the potential metabolic diversity of methanogens, it is often desirable to differentiate and quantify methanogen populations at fine taxonomic resolutions (Jetten et al. 1992; Garcia et al. 2000). Methanoculleus-like organisms have been frequently identified as the dominant hydrogenotrophic methanogen populations in anaerobic digesters and other methanogenic environments, resulting in considerable interest in monitoring the population dynamics of these organisms (Nettmann et al. 2010; Barret et al. 2012; Cardinali-Rezende et al. 2012). Currently, the only Methanoculleus-specific TaqMan RT-qPCR primer/probe set available in the literature targets bases 934–1221 (E. coli numbering) of the 16S rRNA gene (Shigematsu et al. 2003), making it difficult to assess the specificity and coverage of the RT-qPCR assay when sequence information for this segment of the 16S rRNA gene is lacking for the target populations. For example, 16S rRNA gene sequences of Methanoculleus (Fig. 1) obtained from clone library analysis of anaerobic digesters cover bases 21–958 (E. coli numbering) (Zhang et al. 2011; Chen et al. 2012). Thus, the above-mentioned Methanoculleus-specific RT-qPCR primer/probe set could not be applied with confidence for the specific quantification of Methanoculleus populations in these anaerobic digesters. Similar issues may also arise when only short reads and partial sequence information are available. Moreover, the current primer/probe set is reported to lack specificity to the genus of Methanoculleus (Franke-Whittle et al. 2009), which is of particular concern given the considerable phylogenetic diversity of Methanoculleus (Fig. 1). Therefore, the objective of this study was to design alternative Methanoculleus-specific TaqMan RT-qPCR primer/probe set with high sequence coverage and specificity.

Figure 1.

Neighbour-joining phylogenetic tree showing the grouping of reference Methanoculleus cultures and uncultured Methanoculleus clones from anaerobic digesters. The numerical values at branch nodes indicate bootstrap values per 1000 resamplings. The scale bar represents the number of substitutions per sequence position. GenBank accession numbers of the 16S rRNA gene sequences are indicated in the parentheses.

Materials and methods

Primer and probe design

The Methanoculleus-specific primer/probe set for TaqMan RT-qPCR was designed with 1623 16S rRNA gene sequences of the genus Methanoculleus in Ribosomal Database Project (RDP) Release 10 (Cole et al. 2009) as previously described (Yu et al. 2005). Briefly, sequences of primer/probe were determined following guidelines set by Applied Biosystems (Foster City, CA) on parameters including amplicon size, nucleotide position, melting temperature (Tm), complementarity and GC content, using Primer3 (Untergasser et al. 2007). The primer/probe specificity and coverage of the target group, that is, Methanoculleus, was first evaluated in silico using the Probe Match programme of RDP II (Cole et al. 2009).

Experimental evaluation of Methanoculleus-specific primer/probe set

Primer/probe specificity was further assessed using cloned 16S rRNA genes from Methanoculleus (GenBank Accession Number JN052755), Methanosaeta (GenBank Accession Number JN052761) and Methanosarcina (GenBank Accession Number JN052757), all of which were derived from anaerobic digesters and were representative of methanogen populations common in anaerobic digestion processes (Chen et al. 2012). An additional 16S rRNA gene clone phylogenetically related to Crenarchaeota (GenBank Accession Number JN052741) was also included as a potentially significant population in anaerobic digestion (Collins et al. 2005; Zhang et al. 2011). These 16S rRNA gene clones were used as DNA templates for RT-qPCR assays to test the specificity of the Methanoculleus-specific primer/probe set. Amplification efficiency (E) was determined with the CT-Log[Template] plot derived from the quantification of tenfold dilution series of Methanoculleus 16S rRNA gene templates (5·53 × 102–5·53 × 109 copies) as previously described (Schefe et al. 2006).

Field testing of Methanoculleus-specific primer/probe set

The utility of the Methanoculleus-specific primer/probe was subsequently tested in six anaerobic digesters treating animal waste, of which triplicate anaerobic mono-digesters were fed with dairy waste only and the other triplicate anaerobic co-digesters were fed with a mixture of dairy waste and poultry waste (Chen et al. 2012). These bench-scale digesters (3·6 l) were completely mixed at 35°C with a hydraulic retention time of 20 days. Biomass samples (10 ml) were taken from the effluents of the anaerobic digesters during stable process performance following c. 400 days of operation. Aliquots of samples were stored at 80°C until analysis. Total DNA from each sample was obtained using the sodium dodecyl sulphate (SDS)-based extraction method as previously described (Zhang et al. 2009). Crude DNA extracts were further purified with the Wizard® DNA Clean-Up System (Promega, Madison, WI) following the manufacturer's instructions. The purified DNA was subsequently used for the quantification of Methanoculleus and total Archaea with RT-qPCR.

TaqMan RT-qPCR procedure

The Methanoculleus-specific primers and dual-labelled TaqMan probe, 5′-end labelled with 6-carboxyfluorescein (FAM) and 3′-end labelled with the Black Hole Quencher (BHQ), were obtained from Biosearch Technologies (Novato, CA). All RT-qPCR assays were performed in 25-μl reaction tubes with 15 pmol of the primers, 5 pmol of the probe and Brilliant II QPCR Master Mix (Agilent, Santa Clara, CA). Thermal cycling consisted of a starting incubation at 50°C for 2 min and an initial denaturation at 95°C for 10 min, followed by up to 45 cycles of 95°C for 30 s and 60°C for 45 s. To determine the relative abundance of Methanoculleus populations in the archaeal community, total Archaea was quantified using the following TaqMan primer/probe set as previously described (Yu et al. 2005): forward primer Arc 787F-ATTAGATACCCSBGTAGTCC; probe Arc 915P-AGGAATTGGCGGGGGAGCAC and reverse primer Arc1059R-GCCATGCACCWCCTCT. Thermal cycling and fluorescence detection were performed with a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Fluorescence response data were processed with the cfx Manager software provided by the manufacturer (Bio-Rad). For all RT-qPCR assays, standards, controls and samples were run in triplicates. Gene copy numbers were calculated from standard curves based on the log transformation of known concentrations vs the threshold cycle (CT).

Results

Design of Methanoculleus-specific primer/probe set

The set of primers and probe targeting Methanoculleus was designed based on the alignment of all 16S rRNA gene sequences classified as Methanoculleus in the RDP database (Cole et al. 2009). The resulting Methanoculleus-specific primer/probe set spans from bases 274 to 497 (E. coli numbering) of the 16S rRNA gene, with an amplicon size of 224 bp (Table 1). The length of the amplicons from the primer/probe set designed in this study is considerably shorter than that of the primer/probe set reported in a previous study (Table 1), which could potentially improve the amplification efficiency of RT-qPCR assays (Nolan et al. 2006). In addition, the melting temperature (Tm) of the TaqMan probe designed in this study is 69·1°C, precisely within the recommended range of 68–70°C. The difference in Tm between the probe and primers designed in this study is also close to the optimal value of 10°C. All these features could enhance the performance of the Methanoculleus-specific RT-qPCR assay developed in this study (Nolan et al. 2006).

Table 1. Characteristics of primer/probe sets for Methanoculleus-specific TaqMan qRT-PCR assaysa
Primer/probeSequence (5′–3′)Position E. coli No.Amplicon size (bp)Tm (oC)Reference
  1. a

    Primers/probes designed in this study are shown in boldface type.

Forward primer

 Mc-274F

GGAGCAAGAGCCCGGAGT 274–291 224 60·8 This study

Probe

 Mc-361P

CGTGATAAGGGAACCTCGAGTGCCT 361–385 69·1

Reverse primer

 Mc-477R

CCAATAAAAGTGGCCACCACT 477–497 59·5

Forward primer

 AR934F

AGGAATTGGCGGGGGAGCAC934–95330764·6Shigematsu et al. (2003)

Probe

 MCU1023TAQ

GAATGATTGCCGGGCTGAAGACTC1000–102366·9

Reverse primer

 MG1200b

CCGGATAATTCGGGGCATGCTG1200–122165·8

In silico evaluation of Methanoculleus-specific primer/probe set

A phylogenetic analysis of the Methanoculleus 16S rRNA sequences retrieved from RDP indicated that Methanoculleus represented a diverse group of methanogens (Fig. 1). Therefore, sequence coverage and specificity were the primary considerations in our attempts to design RT-qPCR assays with improved performance.

Sequence comparisons showed that the primer/probe set designed in this study had perfect matches to 68, 53 and 63% of the 1623 Methanoculleus sequences in RDP with the forward primer, reverse primer and probe, respectively (Table 2). A similar analysis indicated that the primer/probe set designed by Shigematsu et al. (2003) had perfect matches with 71, 34 and 42% (Table 2). Thus, except the forward primer Mc-274F, the primer/probe set designed in this study exhibited markedly better coverage than the counterparts designed by Shigematsu et al. (2003). The coverage of the forward primer Mc-274F was slightly lower than that of the forward primer AR934F used by Shigematsu et al. (2003). However, the greater coverage by AR934F was expected, because it was an archaeal domain-specific primer, matching to 62% of all archaeal sequences in RDP (Table 2). Thus, it is evident that the primer/probe set designed in this study had considerably improved coverage of Methanoculleus populations.

Table 2. Comparison of the coverage and specificity of Methanoculleous-specific TaqMan qRT-PCR assays
Primer/probe characteristicsNo. of matching sequencesb
Primer/probe nameaSequence (5′–3′)E. coli positionMethanoculleus (1623)cNon-Methanoculleusd
Methanomicrobiaceae (2285)eArchaea (115 750)f
  1. a

    Designations in the parentheses: F, forward primer; R, reverse primer; and P, probe. The primers/probe in italics were designed in this study while the remaining primers/probe were from Shigematsu et al. (2003).

  2. b

    Number of 16S rRNA gene sequences belonging to the target taxon in the Ribosomal Database Project (RDP) database with perfect match to the primer/probe.

  3. c

    Number in the parenthesis indicates the total number of 16S rRNA gene sequences belonging to the genus Methanoculleus in RDP.

  4. d

    Number of non-Methanoculleus 16S rRNA gene sequences with perfect match to the Methanoculleus-specific primer/probe.

  5. e

    Number in the parenthesis indicates the number of 16S rRNA gene sequences in the family Methanomicrobiaceae which did not belong to the genus Methanoculleus.

  6. f

    Number in the parenthesis indicates the number of 16S rRNA gene sequences in the domain Archaea which did not belong to the genus Methanoculleus.

Mc-274F (F) GGAGCAAGAGCCCGGAGT 274–291 1111 7 27
Mc-477R (R) CCAATAAAAGTGGCCACCACT 477–497 859 97 240
Mc-361P (P) CGTGATAAGGGAACCTCGAGTGCCT 361–385 1022 9 23
AR934F (F)AGGAATTGGCGGGGGAGCAC934–9531163109072 583
MG1200 (R)CCGGATAATTCGGGGCATGCTG1200–1221556299947
MCU1023TAQ (P)GAATGATTGCCGGGCTGAAGACTC1023–104667757132

More noteworthy is the significant improvement in specificity provided by the primer/probe set designed in this study, which had nonspecific matches to 7, 97 and 9 of the 2285 non-Methanoculleus sequences in the family Methanomicrobiaceae, with the forward primer, reverse primer and probe, respectively (Table 2). In comparison, the primer/probe set designed by Shigematsu et al. (2003) had nonspecific matches to 1090, 299 and 57 of the 2285 non-Methanoculleus sequences in the family Methanomicrobiaceae. Extending the same analysis to Archaea, nonspecific matches by the primer/probe set designed by Shigematsu et al. (2003) amounted to 72 583, 947 and 132 of non-Methanoculleus archaeal sequences (Table 2). Apparently, the specificity of the primer/probe set by Shigematsu et al. (2003) was primarily attributable to the specificity of the probe, but not the forward and reverse primers, which is not desirable (Franke-Whittle et al. 2009). In contrast, only 27, 240 and 23 of the 115 750 non-Methanoculleus archaeal sequences were matched by the forward primer, reverse primer and probe designed in this study, respectively (Table 2). Thus, all three sequences of the primer/probe set designed in this study exhibited high specificity in the Archaea domain. Indeed, the specificity of the primer/probe set designed in this study is also demonstrated by the high-quality alignments between the primers/probe and 16S rRNA sequences of reference strains and uncultured clones of Methanoculleus in RDP (Fig. 2).

Figure 2.

Alignment of representative Methanoculleus 16S rRNA gene sequences (5′–3′) to the qRT-PCR primer/probe set developed in this study. Mismatches are shown as shaded.

Experimental evaluation of Methanoculleus-specific primer/probe set

Amplification efficiency is an important measure of the performance of RT-qPCR assays and was evaluated experimentally using tenfold serial dilutions of Methanoculleus 16S rRNA gene templates. Amplification using the primer/probe set designed in this study was highly reproducible with strong correlation (R2 = 0·998) between template concentration and fluorescence response detected as threshold cycle (Fig. 3). The amplification efficiency was determined to be 92·73%, which is considered to be feasible for RT-qPCR quantification (Zhang and Fang 2006).

Figure 3.

Amplification efficiency of Methanoculleus-specific qRT-PCR primer/probe set designed in this study as determined with the CT-Log[Template] plot derived from the quantification of tenfold dilution series of Methanoculleus 16S rRNA gene templates (5·53 × 102–5·53 × 109 copies).

The specificity of the primer/probe set designed in this study was also evaluated with experimental RT-qPCR testing. The DNA templates tested for the Methanoculleus-specific RT-qPCR assay were four archaeal 16S rRNA genes from Methanoculleus, Methanosarcina, Methanosaeta and Crenarchaeota. Amplification was observed for DNA templates from Methanoculleus only and no amplification was detected for DNA templates from any other archaeal population after 45 PCR cycles (Fig. 4), demonstrating the specificity of the primer/probe set to Methanoculleus.

Figure 4.

Specific detection of Methanoculleus as increases in fluorescence using 16S rRNA gene templates of four representative archaeal groups—Methanoculleus (Mc), Methanosarcina (Msc), Methanosaeta (Mst) and Crenarchaeota (Cren). All gene templates tested are environmental sequences cloned from anaerobic digesters in a previous study (Chen et al. 2012). RFU, Relative fluorescence unit. (–×–) Mc; (–□–) Msc; (–▲–) Mst and (–♦–) Cren.

Field testing of Methanoculleus-specific RT-qPCR assay

The utility of the primer/probe set designed in this study was tested in RT-qPCR assays to quantify the population abundance of Methanoculleus in anaerobic digesters. Results from RT-qPCR quantification of both Methanoculleus and total Archaea revealed that the relative abundance of Methanoculleus in the overall archaeal community averaged 5·4 and 3·8% in the mono-digesters and co-digesters, respectively (Table 3). This observation is consistent with the relative abundance of 7 and 5% determined by clone library analysis (100 clones per library) of the same samples (Chen et al. 2012), supporting the effectiveness of the Methanoculleus-specific RT-qPCR assay designed in this study for the rapid and accurate quantification of methanogen populations in anaerobic digestion.

Table 3. Quantification of Methanoculleus abundance with qRT-PCR in anaerobic digesters treating animal waste
Sample sourcea16S rRNA gene targetsNo. of copies ml−1bRelative abundance (% of total Archaea)
  1. a

    Samples were taken from the treated effluent of anaerobic digesters. Mono-digesters were fed with dairy waste only; co-digesters were fed with a mixture of dairy waste and poultry waste.

  2. b

    The values are the means of triplicate samples ± standard deviation.

Mono-digesters Methanoculleus (8·3 ± 1·6) × 1065·4 ± 1·0
Total Archaea(1·6 ± 0·2) × 108
Co-digesters Methanoculleus (4·3 ± 1·8) × 1063·8 ± 0·7
Total Archaea(1·2 ± 0·4) × 108

Discussion

Methanoculleus populations are frequently detected in anaerobic digestion processes and are considered as the key members of the microbial community responsible for hydrogenotrophic methanogenesis (Narihiro and Sekiguchi 2007). However, the abundance of Methanoculleus has been reported to vary significantly in anaerobic digestion processes, ranging from being the dominant methanogen population (Cardinali-Rezende et al. 2012; Wirth et al. 2012) to near absence (Rivière et al. 2009; Sundberg et al. 2013). Thus, rapid and accurate quantitative tools, that is, RT-qPCR, are needed to monitor the dynamics of Methanoculleus population abundance and its linkage to process performance to gain insight into the functions of these methanogens in anaerobic digestion processes.

A major challenge is that the genus Methanoculleus represents a relatively diverse group of hydrogenotrophic methanogens (Fig. 1). Thus, the specificity of RT-qPCR assays targeting Methanoculleus is of particular importance, making RT-qPCR assays based on the TaqMan chemistry more attractive because of greater specificity (Wang and Brown 1999). Only one TaqMan RT-qPCR assay has been reported in the literature (Shigematsu et al. 2003), which has been shown to lack specificity (Table 2). One of the concerns of this primer/probe set is the use of an Archaea domain-specific primer as the forward primer (Table 2). Thus, the specificity of the RT-qPCR designed by Shigematsu et al. (2003) relied completely on the probe and the reverse primer only, which is not desirable for the design of highly specific RT-qPCR (Nolan et al. 2006).

In contrast, the Methanoculleus-specific RT-qPCR assay designed in this study provides greater specificity from all three sequences of the primer/probe set without sacrificing coverage (Table 2). The utility of the RT-qPCR assay designed in this study is further supported by experimental and field validation of its amplification efficiency (Fig. 3) and quantification accuracy (Table 3). Thus, the Methanoculleus-specific RT-qPCR assay designed in this study provides a rapid and effective tool much needed for the specific quantification of Methanoculleus populations in anaerobic digestion processes.

Acknowledgements

This work was partly supported by the Science Alliance—Tennessee Center of Excellence and a US Environmental Protection Agency Grant SU834318. SC was supported by Institute for a Secure and Sustainable Environment and JP was supported by the Pre-Collegiate Research Scholars program at the University of Tennessee, Knoxville.

Conflict of interest

No conflict of interest declared for all authors.

Ancillary