SEARCH

SEARCH BY CITATION

Keywords:

  • Phylogeny;
  • recombination;
  • sex-linked markers

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Contrasting with birds and mammals, most ectothermic vertebrates present homomorphic sex chromosomes, which might be due either to a high turnover rate or to occasional X-Y recombination. We tested these two hypotheses in a group of Palearctic green toads that diverged some 3.3 million years ago. Using sibship analyses of sex-linked markers, we show that all four species investigated share the same pair of sex chromosomes and a pattern of male heterogamety with drastically reduced X-Y recombination in males. Phylogenetic analyses of sex-linked sequences show that X and Y alleles cluster by species, not by gametolog. We conclude that X-Y homomorphy and fine-scale sequence similarity in these species do not stem from recent sex-chromosome turnovers, but from occasional X-Y recombination.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

In sharp contrast with most birds and mammals, sex chromosomes are rarely differentiated in ectothermic vertebrates. In amphibians, for instance, all species investigated so far have genetic sex determination, sometimes with marginal environmental effects (leading e.g. to sex reversal at extreme temperatures). However, very few (~4%) show morphologically distinct sex chromosomes (Schmid et al., 1991; Schmid & Steinlein, 2001; Eggert, 2004; Nakamura, 2009; Smith & Voss, 2009); similar numbers are found in fishes (Devlin & Nagahama, 2002).

Two main hypotheses have been proposed to explain this lack of decay. On the one hand, the “high-turnover” hypothesis assumes that autosomal mutations regularly take over a leading role in sex determination, replacing old sex chromosomes before they had time to decay (Schartl, 2004; Volff et al., 2007; Sarre et al., 2011). Evidence for high turnover rates is accumulating both in fishes (e.g. Tanaka et al., 2007; Cnaani et al., 2008; Ross et al., 2009) and in amphibians: although Hillis & Green (1990) only counted eight heterogametic transitions in this class (due to the difficulty of identifying homomorphic sex chromosomes by cytogenetic methods), molecular techniques are now revealing additional transitions (e.g. Stöck et al., 2011a), and a recent meta-analysis indeed points to a much higher turnover rate (Evans et al., 2012). Sibship analyses of enzymatic polymorphism in the genus Rana have shown that, depending on species or populations, five different pairs of chromosomes have been co-opted as sex chromosomes, some of them several times independently (Hotz et al. 1997; Miura, 2007).

On the other hand, the “fountain-of-youth” hypothesis assumes that X-Y homomorphy is maintained in the long term by rare events of recombination (Perrin, 2009). Even when X and Y do not recombine in males, they might do so in sex-reversed XY females, because recombination patterns depend on phenotypic rather than on genotypic sex (e.g. Inoue et al., 1983; Wallace et al., 1997; Matsuda et al., 1999; Kondo et al., 2001; Lynn et al., 2005; Campos-Ramos et al., 2009; Matsuba et al., 2010). Given that sex reversal occasionally occurs in ectothermic vertebrates (presumably due to the temperature dependence in the expression of genes or the activity of enzymes along the sex-determination pathways), rare events of X-Y recombination in females are expected to prevent X-Y differentiation. The fountain-of-youth model has also received some empirical support: three species of European tree frogs (Hyla arborea group) that diverged in the upper Miocene (5.4 – 7.1 Mya) inherited from their common ancestor the same pair of homomorphic sex chromosomes. Despite complete absence of male recombination, X and Y sequences cluster by species, not by gametologs, pointing to recurrent X-Y recombination events (Stöck et al., 2011b).

Which of these two processes prevails in nature is an important empirical question, with the potential to shed light on the evolutionary causes that prevent sex-chromosome differentiation in many groups. Still little is known in this respect from amphibians, except for Ranidae, which show support for the high-turnover model (Miura, 2007), and Hylidae, which show support for the fountain-of-youth model (Stöck et al., 2011b). Here, we investigate patterns in another family of anurans, the Bufonidae, where species also share highly conserved karyotypes (Bogart, 1972) and homomorphic sex chromosomes (Schmid, 1978; Malone & Fontenot, 2008). Female heterogamety has long been proposed for the common toad Bufo bufo, based on sex-reversal experiments (Ponse, 1941). Cytogenetic methods similarly suggested female heterogamety in the related Bufo gargarizans (Changxiang et al., 1983), as well as in cane toads (Bufo marinus; Abramyan et al., 2009). A meta-analysis of interspecific crosses in Bufonids (Malone & Fontenot, 2008) also found support for widespread female heterogamety (based on sex differences in the fitness of F1 hybrids), however, with some exceptions.

Sex chromosomes are also homomorphic in the Bufo viridis sub-group (Schmid, 1978; Stöck et al., 2005 and refs. therein). A chromosome-banding study by Odierna et al. (2007), involving 18 populations ranging from Morocco to Kazakhstan, confirmed the pattern of widespread homomorphy, but also identified in one population from Moldavia (contact zone between B. viridis and B. variabilis) a female-specific inversion on chromosome pair 4, pointing to a possible chromosomal rearrangement associated with female heterogamety (ZW; Odierna et al., 2007). Contrasting with this result, sex-reversal experiments in B. variabilis (as ‘B. viridis’) from Asia Minor (Kawamura et al., 1980; Ueda, 1990) suggested an XY system. Additional clear-cut evidence for male heterogamety was recently provided by sibship analyses of the Sicilian endemic B. siculus (Stöck et al., 2011a). Hence, heterogametic transitions did occur within Bufonids, and possibly within the B. viridis subgroup.

To test whether the rate of sex-chromosome turnover is high enough to account for the widespread sex-chromosome homomorphy found in Bufonidae (Schmid, 1978; Malone & Fontenot, 2008; Stöck et al. 2005), or whether some X-Y recombination is also involved (as in Hylidae; Stöck et al., 2011b), we focus here on several diploid species from the B. viridis radiation, asking specifically i) When did these species diverge? ii) Do they share the same pair of sex chromosomes and patterns of heterogamety? iii) What are the sex-specific patterns of sex-chromosome recombination? and iv) do sex-linked sequences cluster by species or by gametologs? All responses we obtained to these questions support a role for X-Y recombination in maintaining sex-chromosome homomorphy in bufonid toads.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Study animals and DNA samples

Our study focuses on four species of diploid Palearctic green toads (Table 1): Bufo siculus and B. balearicus, two Western-Mediterranean green toad species with an estimated divergence time of ca. 2.7 million years (Stöck et al., 2008) that are in secondary contact in Eastern Sicily (Colliard et al., 2010), and two Central Asian species: B. turanensis from Kyrgyzstan and B. shaartusiensis from Tajikistan, belonging to the evolutionary lineages that presumably contributed to the formation of polyploids in this complex (Mezhzherin & Pisanets, 1995; Stöck et al., 2010; Litvinchuk et al., 2011).

Table 1. Families of green toads from intraspecific pairs, interspecific crosses and one backcross as used for this study
Families/CrossesSpeciesIndividual IDsOriginNumber of offspring genotypedNumber of offspring sexed
Cross 1balearicus♀ ×  siculus♂Si41♀ × Si11♂Si41♀: Italy, Sicily, Torrenova, 38.118 N,14.699 E;Si11♂: Italy, Sicily, La Fossa, 38.213 N, 13.292 E3116 males 15 females
Backcrossbalearicus × (F1 balearicus♀ × siculus♂)Si337♀ × Cr13♂Si337♀:Italy, Sicily, San Pier Niceto, 38.2113 N, 15.3184 E; Cr13♂: F1 labcross4820 males 28 females
Cross 2turanensis♀ × shaartusiensis♂Ky111♀ × Sz30♂Ky111♀: Kyrgyzstan, S of Bishkek, 42.791 N, 74.697 E; Sz30♂: Tajikistan, Shaartuz, 37.29 484 N, 68.13 344 E 1912 males 7 females
Family 1turanensis♀ × turanensis♂Ky2♀ × Ky3♂Kyrgyzstan, S of Bishkek, 42.791 N, 74.697 E150
Family 2turanensis♀ × turanensis♂Ky15♀ × Ky16♂Kyrgyzstan, S of Bishkek, 42.791 N, 74.697 E140
Family 3turanensis♀ × turanensis♂Ky111♀ × Ky110♂Kyrgyzstan, S of Bishkek, 42.791 N, 74.697 E400
Family 4shaartusiensis♀ × shaartusiensis♂Sz30♀ × Sz31♂Tajikistan, Shaartuz, 37.29 484 N, 68.13 344 E500
Family 5shaartusiensis × shaartusiensis♂Sz22♀ × Sz23♂Tajikistan, Shaartuz, 37.29 484 N, 68.13 344 E380
Family 6shaartusiensis♀ × shaartusiensis♂SzI (unknown parents)Tajikistan, Shaartuz, 37.29 484 N, 68.13 344 E200
Family 7shaartusiensis♀ × shaartusiensis♂SzII (unknown parents)Tajikistan, Shaartuz, 37.29 484 N, 68.13 344 E200
Total   29598

We examined both intra-specific and inter-specific crosses. The latter were initially performed to investigate hybrid viability, study meiosis in the F1 and use heterozygous F1 as parents for backcrosses (see Colliard et al., 2010 for details). This design allowed producing F1 individuals with one homolog from the maternal species and the other from the paternal species, hence maximizing the level of heterozygosity on sex chromosomes, and thereby the probability of detecting sex linkage from the backcrossed offspring generation. From a B. balearicus × B. siculus cross (“cross 1” in Table 1), about 200 F1 offspring were raised in the lab, revealing an even sex ratio (Colliard et al., 2010). Of these, we genotyped 31 mature sub-adults (16 males, 15 females), unequivocally sexed by both secondary male characters (nuptial excrescences) and anatomical observation of ovaries or testes (see Appendix S1 in Stöck et al., 2011a). A mature 2-year old F1-male from this cross was mated to a wild-caught mature B. balearicus female (“backcross” in Table 1). From this backcross, 48 offspring (28 females and 20 males) could be raised and sexed (Colliard et al., 2010). In addition, 50 F1 offspring from a B. turanensis × B. shaartusiensis mating (“cross 2” in Table 1) were raised in the laboratory, 19 of which were killed about 8 months after metamorphosis, and sexed anatomically by observation of ovaries or testes (12 males, 7 females).

Finally, sex-specific recombination rates were evaluated from three pure B. turanensis families (families 1–3 in Table 1; 69 offspring in total), and four B. shaartusiensis families (families 4–7 in Table 1; 128 offspring in total), for two of which parents were unknown (families 6 and 7).

Molecular marker development for genotyping and sequencing

We checked for sex linkage 36 microsatellite markers published by Colliard et al. (2009), Dufresnes et al. (2011) and Betto-Colliard et al. (in press). The microsatellite marker (BvS1), previously shown to be sex-linked in B. siculus (Stöck et al., 2011a), was not further used, due to low cross-amplification success and ambiguous size. New markers came from two genomic libraries, enriched for tri- and tetranucleotide repeats (Genetic Identification Services, www.genetic-id-services.com; DNA from Bufo turanensis from south of Bishkek, Kyrgyzstan and Bufo latastii, from Skardu, Pakistan). Four markers revealed sex linkage (C223, C201, B223 and D214; see below). For C223 and D214, we developed an additional primer pair (Table 2), close to the outer ends of the known microsatellite flanking sequence, to obtain more extensive sequence information from the flanking regions for phylogenetic analyses. After successfully cloning and sequencing these flanking regions in some species, we developed nested primers in proximate (and presumably conserved) regions to cross-amplify products from additional species (“adapted”, Table 2). Sex linkage was also checked for these new markers, by inspecting transmission patterns within families.

Table 2. PCR-Primers used for microsatellite genotyping. When used for sequencing, the two marked C223 and D214 were amplified with the primers indicated by “self”
LocusGenBankRepeat MotifPrimer SequencesRef.
C223 FJ613135 (TCTA)nF: CAGAGGTCAAGAGGGAGAAGColliard et al. (2009)
   R: CAGAGGTCAAGAGGGAGAAG
   C223selfF: TTCCAGAAGTTAAAAACAAACTGTGThis article
   C223selfR: CTGAGGCCAACGTATCTTGAG
   C223R_Adapted: GGMACCACATCCTGATKAG
C201 HQ386137 (TCTA)nF: AGGACCCAGGATTTCCATDufresnes et al. (2011)
   R: GCTTCTACCAAAGACTGTTCC
B223 JX658759 (TAC)n(TA)nF: TGTGCATGAGTCCTAATTCGTABetto-Colliard et al. (in press)
   R: GCCTGTGAGTGCTGATAAGTG
D214 JX658773 (CTAT)nF: CCCTTGTCCTCGTAGATAGGBetto-Colliard et al. (in press)
   R: CGTATGCTGTTTTCTTCTGTG
   D214selfF: CACTGTGCAGGCGCAACTThis article
   D214selfR: GCCCTCACGATGTCTACTCC

Recombination analyses

Pairwise linkage analysis was performed using Crimap v. 5.0 (Green et al., 1990) with the same procedures as described in Berset-Brändli et al. (2008), allowing for sex-specific recombination rates. Pairwise linkage was considered significant if the logarithm of odds (LOD score) exceeded 3. Heterogeneity in recombination rates among species was tested for each available marker interval with Morton's M-test (Morton, 1956). In absence of heterogeneity, sample sets were pooled with the option merge, and linkage analyses were performed for the whole data set.

DNA sequences and phylogenetic analyses

For the sex-linked markers C223 and D214 (obtained with primers “self”, Table 2), PCR products were cloned using the Pgemeasy cloning kit following a modified manufacturer's protocol as described (Stöck et al., 2010). Eight to 10 clones per individual were sequenced with universal vector primers SP6 or T7. Clones were edited using Sequencher 4.9, to eliminate singletons. Sequences were submitted to GenBank (GenBank accession numbers: microsatellite C223: KC205555-KC205573; microsatellite D214: KC205574-KC205594; mitochondrial D-loop (control region): DQ629726-DQ629729, DQ629731-DQ629733; DQ629848-DQ629850, DQ629852-DQ629854, DQ629780; EU497493-EU497511, EU497574, EU497595-EU497596, HM852711-HM852713, KC205595-KC205655). Each of at most two sequences (in diploid heterozygotes) was then included into an alignment, which was optimized using the Muscle algorithm as implemented in Seaview (Gouy et al., 2010). Mitochondrial DNA sequences were obtained and edited as described previously (Stöck et al., 2006). For all markers, homologous sequences obtained from Bufo latastii, a basal species in the green toad phylogeny (Stöck et al., 2006), served as “outgroup”. We applied four different phylogenetic methods: Neighborjoining, Maximum Parsimony (MP), Maximum Likelihood (ML) as implemented in Seaview (Gouy et al., 2010) and Bayesian analyses using Mr. Bayes. Under MP, gapped sections in repetitive regions were either ignored or encoded as a “5th base”. Using ML, gapped repeat regions were either included or excluded from the analyses. Bootstrap support values were obtained from 1000 re-sampled data sets.

Divergence time estimates

Divergence times to the most recent common ancestor of the four species were estimated assuming an uncorrelated exponential relaxed molecular clock, using the program BEAST v. 1.6 (Drummond et al., 2007; http://beast.bio.ed.ac.uk/Main_Page) with the mitochondrial d-loop markers. As we lack appropriate fossils, we based our prior on results from previous study (Stöck et al., 2008; Colliard et al., 2010), assuming a normal distribution for the divergence time between B. siculus and B. balearicus, with a mean of 2.7 Millions of years ago (Mya), and a standard deviation of 1 My (thus effectively spanning a large range from 1 to 5 Mya). We applied an HKY + Gamma model of sequence evolution (Modeltestserver 1.0), and a Yule tree prior (constant speciation rate per lineage) as most appropriate for species-level divergences (Drummond et al., 2006).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

mtDNA phylogeny and divergence time

All four species received very high support (bootstrap values 99 to 100%; Fig. 1). Lower support (62% bootstrap value) was given to the sister-clade relationship between B. balearicus and B. shaartusiensis. The most recent common ancestor of the four ingroup taxa (B. balearicus, B. turanensis, B. siculus and B. shaartusiensis) was estimated to be of Pliocene age, i.e. to have lived about 3.3 Mya (95% high probability density interval: 1.7–5.1 Mya). This timeframe is largely sufficient to allow sequence differentiation, as also confirmed by nuclear markers (Fig. 3).

image

Figure 1. Maximum-likelihood phylogeny for mitochondrial d-loop lineages of four diploid green toads. The time to the most recent common ancestor of the four species B. siculus (orange), B. shaartusiensis (violet), B. turanensis (yellow) and B. balearicus (green) was estimated to average 3.3 My (1.7–5.1 My, 95% high probability density interval). Bufo latastii was used as an out-group. Labels at branches show bootstrap support obtained from 1000 re-sampled data sets (major nodes below 50% remained unlabeled).

Download figure to PowerPoint

Sex linkage and sex-specific recombination rates

The four markers C223, C201, B223 and D214 formed a single linkage group. Recombination rates were high in females from all families (average 0.38), but very low in males (average 0.02). In these, pairwise recombination rates (Table 3) suggest complete linkage between C223 and D214, rare recombination with C201 (~ 0.005) and slightly more with B223 (~0.05). Morton's (1986) tests did not detect heterogeneity in recombination rates among the four species, so that a consensus map could be built by merging all family data (Fig. 2).

Table 3. Consensus matrix of recombination rates from four Bufo species on four sex-linked markers. Analyses based on 295 offspring from 10 family groups (Table S1). Male values above diagonal (average 0.025), female values below diagonal (average 0.41)
 C201D214C223B223
C201 0.000.000.05
D2140.50 0.000.05
C2230.500.19 0.05
B2230.500.320.50 
     
image

Figure 2. Recombination map for sex-linked markers (consensus of all four species) obtained with the program Crimap v. 5.0. The low rate of recombination in males (a) contrasts sharply with the high recombination rates found in females (b). Lengths are given in cM units.

Download figure to PowerPoint

This linkage group also comprised the sex locus. Whenever parents from the three crosses were heterozygous, offspring sex correlated strongly with paternal alleles, but not with maternal alleles (Table S1), pointing to a homologous male-heterogametic system. In line with the patterns of recombination on this linkage group, correlations with paternal alleles were perfect for C223, D214 and C201, but rare recombinants occurred for B223, suggesting this marker to be situated farther apart from the sex-determining locus.

Phylogenetic analyses of sex-linked markers

Phylogenies built on markers C223 and D214 turned out to be very robust, with tree topologies for each marker independent of the tree-building approach. Results from the maximum-likelihood approach (Fig. 3) suggest B. balearicus to be sister-clade to turanensis rather than shaartusiensis. Most importantly, putative X- and Y-specific sequences from both markers cluster by species and not by gametolog in well-supported branches.

image

Figure 3. Maximum-likelihood phylogenies for two sex-linked markers. The same colour code for species is used as in Fig. 1. Shown are phylogenetic trees based on the flanking regions of microsatellites C223 (a) and D214 (b). Bufo latastii was used as an out-group. Labels at branches show bootstrap support obtained from 1000 re-sampled data sets (major nodes below 50% remained unlabeled).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

From our results, all four green toad species investigated here inherited the same pair of sex chromosomes and patterns of male heterogamety (Fig. 2) from a common ancestor that lived some 3.3 Mya. We caution that unequivocal evidence for sex linkage is only provided for XY males, but given that they belong to the most diverged species (B. siculus and B. shaartusiensis respectively; Fig. 1), parsimony suggests that the same system is shared by B. turanensis and B. balearicus. We also note that the topology within the well-supported turanensis-balearicus-shaartusiensis clade (sister to B. siculus) is not yet well-resolved: the mtDNA phylogeny provides weak support for a balearicus-shaartusiensis clade (62% bootstrap value, Fig. 1), whereas the two sex-linked markers instead support a turanensis-balearicus clade (Fig. 3).

The precise topology of this sub-clade, however, is inconsequential for our main conclusion: in all cases, alleles cluster by species, not by gametolog (Fig. 3). Our phylogenies confirm the fine-scale X-Y similarity of these sex chromosomes in all four species. Given the apparent absence of turnover within this group, such a pattern can only be explained by some level of X-Y recombination. Contrasting with the situation found in Hyla tree frogs (Berset-Brändli et al., 2008; Stöck et al., 2011b), our linkage analyses show that, despite dramatic sex differences in recombination rates in all four species, males do present a limited amount of recombination between some of the markers investigated (Fig. 2). One marker in particular (B223) appears farther apart from the sex-determining locus than the three others. Thus, X-Y similarity might be driven by rare male recombination. However, evidence for X-Y recombination (clustering of alleles by species; Fig. 3) was actually gathered from two markers that did not show any recombination in males in our pedigree analyses (C223 and D214). Whether the pattern of sex-chromosome homomorphy in these toads only stems from rare male recombination, or whether sex reversal (with X-Y recombination in females) is also involved, is an empirical question that deserves further examination. However, our results clearly allow excluding a role for a recent turnover in this specific case.

The rare male recombination documented here raises interesting theoretical and empirical perspectives regarding the evolution of sexually antagonistic genes and the localization of the sex-determining locus. If males do show some rare recombination over large parts of the sex chromosome, then these toads might offer an ideal system to map in detail the sex-determining gene, a move prevented in Hyla by the complete absence of male recombination over the entire chromosome (Stöck et al., 2011b).

Given the evidence for turnovers already gathered from this group (see Introduction), it seems safe to assume that the two alternative mechanisms (turnover and X-Y recombination), far from being mutually exclusive, are likely to both contribute to the overwhelming prevalence of homomorphic sex chromosomes in amphibians. In this context, it would be worth expanding this study to other species from the green toad radiation. Particularly interesting would be the population from Moldavia (at the contact zone between B. viridis and B. variabilis), seemingly characterized by a female-heterogametic system on chromosome pair 4 (Odierna et al., 2007).

We also recall that B. turanensis and B. shaartusiensis belong to the evolutionary lineages that presumably contributed to the formation of polyploids in the B. viridis complex (Mezhzherin & Pisanets, 1995; Stöck et al., 2010; Litvinchuk et al., 2011). Testing our markers on the several polyploid species of the green toad radiation (including the sexually reproducing triploid B. baturae and the tetraploid B. pewzowi) might shed light on the evolution of sex-determination mechanisms during transitions in ploidy levels, an important topic given that sex-determination mechanisms have been proposed to pose strong barrier to polyploidisation in animals (e.g. Mable, 2004).

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

This study was supported by funds to NP (Swiss National Science Foundation, grant 31003A- 129 894), partly by a Heisenberg-Fellowship (Sto 493/2-1) of the Deutsche Forschungsgemeinschaft (DFG) to MS and partly by the Swiss National Science Foundation (grant PMPDP3134142) to HJP. We thank Alessandra Sicilia, Giuseppe Fabrizio Turrisi, Mario Lo Valvo and Francesco Lillo for toads from Sicily, for samples from northern Italy and southern Switzerland: Kurt Grossenbacher; for help during the fieldwork - in Tajikistan: Stefan Michel and Bakhtiyor Rasulov and in Kyrgyzstan: Valery Eremshenko and Simon Cawsey and Ben J. Evans for a manuscript in press; Tad Kawecki's group for providing intelligent flies to raise juvenile toads. Research has been carried out according to approved guidelines under the following permits: Bundesamt für Veterinärwesen, BVET Nr. 1245/10, Bern, Switzerland, border veterinary control at Airport Frankfurt/Main, Germany (01/05/2010); and authorization No. 1798, Service de la consommation et des affaires vétérinaires, Canton de Vaud, Epalinges, Switzerland.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information
  • Abramyan, J., Ezaz, T., Marshall Graves, J.A. & Koopman, P. 2009. Z and W sex chromosomes in the cane toad (Bufo marinus). Chromos. Res. 17: 10151024.
  • Berset-Brändli, L., Jaquiéry, J., Broquet, T., Ulrich, Y. & Perrin, N. 2008. Extreme heterochiasmy and nascent sex chromosomes in European tree frogs. Proc. R. Soc. B. 275: 15771585.
  • Betto-Colliard, C., Sermier, R., Perrin, N. & Stöck, M. in press. Development and cross-amplification of thirty microsatellite loci in five diploid and polyploid Central Asian species of Palearctic green toads (Bufo viridis subgroup). Conserv. Genet. Res. doi: 10.1007/s12686-012-9779-2
  • Bogart, J.P. 1972. Karyotypes. In: Evolution of the genus Bufo. (W.F. Blair, ed), pp. 171232. Univ. Texas Press, Austin, Texas.
  • Campos-Ramos, R., Harvey, S.C. & Penman, D.J. 2009. Sex-specific differences in the synaptonemal complex in the genus Oreochromis (Cichlidae). Genetica 135: 325332.
  • Changxiang, W., Qun, L. & Wei, X. 1983. Studies of chromosome banding and sister chromatid exchange in Bufo bufo gargarizans. Acta Gen Sinica 10: 291297.
  • Cnaani, A., Lee, B.Y., Zilberman, N., Ozouf-Costaz, C., Hulata, G. & Ron, M. 2008. Genetics of sex determination in Tilapiine species. Sex Dev 2: 4354.
  • Colliard, C., Sicilia, A., Moritz, C., Perrin, N. & Stöck, M. 2009. New polymorphic microsatellite markers and development of mitotyping primers for West-Mediterranean green toad species (Bufo viridis subgroup). Mol. Ecol. Res. 9: 11381140.
  • Colliard, C., Sicilia, A., Turrisi, G.F., Arculeo, M., Perrin, N. & Stöck, M. 2010. Strong reproductive barriers in a narrow hybrid zone of West-Mediterranean green toads (Bufo viridis subgroup) with Plio-Pleistocene divergence. BMC Evol. Biol. 10: 232.
  • Devlin, R. & Nagahama, Y. 2002. Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquacult. 208: 191364.
  • Drummond, A.J., Ho, S.Y.W., Phillips, M.J. & Rambaut, A. 2006. Relaxed phylogenetics and dating with confidence. PLoS Biol. 4: 699710.
  • Drummond, A.J., Rawlence, N. & Rambaut, A. 2007. A rough guide to BEAST 14 Available at: http://codegooglecom/p/beast-mcmc/downloads/list.
  • Dufresnes, C., Betto-Colliard, C., Perrin, N. & Stöck, M. 2011. Thirteen polymorphic microsatellite markers for the European green toad Bufo viridis viridis, a declining amphibian species. Cons. Gen. Res. 3: 311313.
  • Eggert, C. 2004. Sex determination: The amphibian model. Reprod. Nutr. Dev. 44: 539549.
  • Evans, B.J., Pyron, R.A. & Wiens, J.J. 2012. Polyploidization and sex chromosome evolution in amphibians. In: Polyploidy and Genome Evolution (P.S. Soltis & D.E. Soltis, eds), pp. 385410. Springer, Heidelberg, Berlin.
  • Gouy, M., Guindon, S. & Gascuel, O. 2010. SeaView version 40: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Phylogen. Evol. 27: 221224.
  • Green, P., Falls, K. & Crooks, S. 1990. Documentation for Crimap, vers. 24. University School of Medicine: St. Louis, MO, Washington.
  • Hillis, D.M. & Green, D.M. 1990. Evolutionary changes of heterogametic sex in the phylogenetic history of amphibians. J. Evol. Biol. 3: 4964.
  • Hotz, H., Uzzell, T. & Berger, L. 1997. Linkage groups of protein-coding genes in Western Palearctic water frogs reveal extensive evolutionary conservation. Genetics 147: 255270.
  • Inoue, H., Fukumori, Y. & Hiroyoshi, T. 1983. Mapping of autosomal male-determining factors of the housefly, Musca domestica L., by means of sex-reversal. Japan. J. Genet. 58: 451461.
  • Kawamura, T., Nishioka, M. & Ueda, H. 1980. Inter- and intraspecific hybrids among Japanese, European and American toads. Sci. Rep. Lab. Amphib. Biol. Hiroshima. Univ. 4: 1125.
  • Kondo, M., Nagao, E., Mitani, H. & Shima, A. 2001. Differences in recombination frequencies during female and male meioses of the sex chromosomes of the medaka, Oryzias latipes. Genet. Res. 78: 2330.
  • Litvinchuk, S.N., Mazepa, G.O., Pasynkova, R.A., Saidov, A., Satorov, T., Chikin, Y.A. et al. 2011. Influence of environmental conditions on the distribution of Central Asian green toads with three ploidy levels. J. Zool. Syst. Evol. Res. 9: 177255.
  • Lynn, A., Schrump, S., Cherry, J., Hassold, T. & Hunt, P. 2005. Sex, not genotype, determines recombination levels in mice. Am. J. Hum. Genet. 77: 670675.
  • Mable, B.K. 2004. Why polyploidy is rarer in animals than in plants: myths and mechanisms. Biol. J. Linn. Soc. 82: 543466.
  • Malone, J.H. & Fontenot, B.E. 2008. Patterns of reproductive isolation in toads. PLoSone 12: e3900.
  • Matsuba, C., Alho, J. & Merilä, J. 2010. Recombination rate between sex chromosomes depends on phenotypic sex in the common frog. Evol. 64: 36343637.
  • Matsuda, M., Sotoyama, S., Hamaguchi, S. & Sakaizumi, M. 1999. Male-specific restriction of recombination frequency in the sex chromosomes of the medaka, Oryzias latipes. Genet. Res. 73: 225231.
  • Mezhzherin, S.V. & Pisanets, E.M. 1995. Genetic structure and origin of the tetraploid toad Bufo danatensis Pisanets, 1978 (Amphibia, Bufonidae) from Central Asia: differentiation of geographic forms and genetic relationship between diploid and tetraploid species. Genetika 31: 342352. (in Russian).
  • Miura, I. 2007. An evolutionary witness: the frog Rana rugosa underwent change of heterogametic sex from XY male to ZW female. Sex. Dev. 1: 323331.
  • Morton, N.E. 1956. The detection and estimation of linkage between the genes for elliptocytosis and the Rh blood type. Amer. J. Hum. Genet. 8: 8096.
  • Nakamura, M. 2009. Sex determination in amphibians. Stem. Cell. Dev. Biol. 20: 271282.
  • Odierna, G., Aprea, G., Capriglione, T., Castellano, S. & Balletto, E. 2007. Cytological evidence for population-specific sex chromosome heteromorphism in Palaearctic green toads (Amphibia, Anura). J. Biosci. 32: 763768.
  • Perrin, N. 2009. Sex reversal: A fountain of youth for sex chromosomes? Evol. 63: 30433049.
  • Ponse, K. 1941. La proportion sexuelle dans la descendance issue des oeufs produits par l'organe de Bidder des crapauds femelles. Rev. Suisse Zool. 48: 541544.
  • Ross, J.A., Urton, J.R., Boland, J., Shapiro, M.D. & Peichel, C.L. 2009. Turnover of sex chromosomes in the stickleback fishes. PLoS Gen 5: e1000391.
  • Sarre, S.D., Ezaz, T. & Georges, A. 2011. Transitions between sex-determining systems in reptiles and amphibians. Ann. Rev. Genomics. Hum. Genet. 12: 391406.
  • Schartl, M. 2004. Sex chromosome evolution in non-mammalian vertebrates. Curr. Opin. Gen. Dev. 14: 634641.
  • Schmid, M. 1978. Chromosome banding in Amphibia. I. Constitutive heterochromatin and nucleolus organizer regions in Bufo and Hyla. Chromosoma (Berl.) 66: 361388.
  • Schmid, M. & Steinlein, C. 2001 Sex chromosomes, sex-linked genes, and sex determination in the vertebrate class Amphibia. In: Scherer G (M. Schmid, ed), pp. 143176. Genes and mechanisms in vertebrate sex determination. Birkhäuser Verlag, Basel, Switzerland.
  • Schmid, M., Nanda, I., Steinlein, C., Kausch, K., Epplen, J.T. & Haaf, T. 1991 Sex-determining mechanisms and sex chromosomes in amphibia. In: Amphibian cytogenetics and evolution (D.M. Green & S.K. Sessions, eds), pp. 393430. Academic Press, San Diego, California.
  • Smith, J.J. & Voss, R.R. 2009. Amphibian sex determination: segregation and linkage analysis using members of the tiger salamander species complex (Ambystoma mexicanum and A t. tigrinum). Heredity 102: 542548.
  • Stöck, M., Steinlein, C., Lamatsch, D.K., Schartl, M. & Schmid, M. 2005. Multiple origins of tetraploid taxa in the Eurasian Bufo viridis subgroup. Genetica (Springer) 124: 255272.
  • Stöck, M., Moritz, C., Hickerson, M., Frynta, D., Dujsebayeva, T., Eremchenko, V. et al. 2006. Evolution of mitochondrial relationships and biogeography of Palearctic green toads (Bufo viridis subgroup) with insights in their genomic plasticity. Mol. Phylogen. Evol. 41: 663689.
  • Stöck, M., Sicilia, A., Belfiore, N., Buckley, D., Lo Brutto, S., Lo Valvo, M et al. 2008. Post-Messinian evolutionary relationships across the Sicilian channel: Mitochondrial and nuclear markers link a new green toad from Sicily to African relatives. BMC Evol. Biol. 8: 56.
  • Stöck, M., Ustinova, J., Lamatsch, D., Schartl, M., Perrin, N. & Moritz, C. 2010. A vertebrate reproductive system involving three ploidy levels: Hybrid origin of triploids in a contact zone of diploid and tetraploid Palearctic green toads (Bufo viridis subgroup). Evol. 64: 944959.
  • Stöck, M., Croll, D., Dumas, Z., Biollay, S., Wang, J. & Perrin, N. 2011a. A cryptic heterogametic transition revealed by sex-linked DNA markers in Palearctic green toads. J. Evol. Biol. 24: 10641070.
  • Stöck, M., Horn, A., Grossen, C., Lindtke, D., Sermier, R., Betto-Colliard, C. et al. 2011b. Ever-young sex-chromosomes in European tree frogs. PLoS Biol. 9: e1001062.
  • Tanaka, K., Takehana, Y., Naruse, K., Hamaguchi, S. & Sakaizumi, M. 2007. Evidence for different origins of sex chromosomes in closely related Oryzias fishes: substitution of the master sex-determining gene. Genetics 177: 20752081.
  • Ueda, H. 1990. Offspring of sex-reversed males in Bufo viridis. Sci. Rep. Lab. Amphib. Biol. Hiroshima. Univ. 10: 155164.
  • Volff, J., Nanda, I., Schmid, M. & Schartl, M. 2007. Governing sex determination in fish: regulatory putsches and ephemeral dictators. Sex. Dev. 1: 8599.
  • Wallace, H., Wallace, B.M.N. & Badawy, G.M.I. 1997. Lampbrush chromosomes and chiasmata of sex reversed crested newts. Chromosoma 106: 526533.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
jeb12086-sup-0001-TableS1.xlsapplication/msexcel91KTable S1 Transmission patterns of sex-linked microsatellite markers in 10 families of green toads.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.