SEARCH

SEARCH BY CITATION

Keywords:

  • neural cells;
  • REST ;
  • serotonin;
  • TPH2

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References

Serotonin (5-HT) is a neurotransmitter involved in many aspects of the neuronal function. The synthesis of 5-HT is initiated by the hydroxylation of tryptophan, catalyzed by tryptophan hydroxylase (TPH). Two isoforms of TPH (TPH1 and TPH2) have been identified, with TPH2 almost exclusively expressed in the brain. Following TPH2 discovery, it was reported that polymorphisms of both gene and non-coding regions are associated with a spectrum of psychiatric disorders. Thus, insights into the mechanisms that specifically regulate TPH2 expression and its modulation by exogenous stimuli may represent a new therapeutic approach to modify serotonergic neurotransmission. To this aim, a CNS-originated cell line expressing TPH2 endogenously represents a valid model system. In this study, we report that TPH2 transcript and protein are modulated by neuronal differentiation in the cell line A1 mes-c-myc (A1). Moreover, we show luciferase activity driven by the human TPH2 promoter region and demonstrate that upon mutation of the NRSF/REST responsive element, the promoter activity strongly increases with cell differentiation. Our data suggest that A1 cells could represent a model system, allowing an insight into the mechanisms of regulation of TPH2 and to identify novel therapeutic targets in the development of drugs for the management of psychiatric disorders.

Abbreviations used
5-HT

5-hydroxytryptamine

cAMP

cyclic adenosine mono phosphate

CNS

Central nervous system

FBS

fetal bovine serum

GFAP

Glial fibrillic acidic protein

HPA

hypothalamic–pituitary–adrenal axis

HPRT

hypoxantine phosphoribosyl transferase

MEM

minimal essential medium

NRSE

neuron-restrictive silencer element

NRSF/REST

neuron-restrictive silencer factor/repressor element-1-silencing transcription factor

NSE

neuron-specific enolase

PCR

polymerase chain reaction

RT-PCR

Reverse-Transcription polymerase chain reaction

SSRI

selective serotonin reuptake inhibitor

TPH

tryptophan hydroxylase

Serotonin (5-HT) is an important neurotransmitter involved in many aspects of the neuronal functions including the regulation of anxiety, depression, appetite, sleep, and circadian rhythm.

The synthesis of 5-HT is initiated by the hydroxylation of the amino acid tryptophan, which is the rate-limiting step catalyzed by tryptophan hydroxylase (TPH). Two isoforms of TPH (TPH1 and TPH2), encoded by different genes, have been identified with TPH2 almost exclusively expressed in the brain, whereas TPH1 is predominantly expressed in the pineal gland (Walther et al. 2003; Abumaria et al. 2008) and in the peripheral tissues (Malek et al. 2005; Turner et al. 2006; Nakamura and Hasegawa 2007). Genetic or epigenetic factors affecting TPH2 gene expression or catalytic properties may alter 5-HT neurotransmission and thereby modify behavioral traits, drug responses, and disease susceptibility. In fact, a loss-of-function mutation in human TPH2 gene was identified in patients with major depression (Zhang et al. 2005), and a loss-of-function mutation in mice was associated with a reduced aggressive behavior (Kulikov et al. 2005). Also, psychiatric disorders such as bipolar disorder (Lopez et al. 2007), attention deficit/hyperactivity disorder (Walitza et al. 2005), and suicidality (Zill et al. 2004), have been associated with TPH2 promoter polymorphisms. Moreover, Chen et al. also reported a functional polymorphism in the 3′ untranslated region of the TPH2 gene in rhesus macaques, which was related to differential hypothalamus–pituitary–adrenal (HPA) axis functioning, and, among peer-reared infants, was associated with the aggressive behavior (Zhang et al. 2004).

The expression of TPH2 in brain exhibits a circadian rhythm (Liang et al. 2004; Malek et al. 2005) and is influenced by specific stressors and hormones, such as sexual hormones suggesting that TPH2 gene expression may be frequently and subtly regulated under specific physiological or stress conditions. This distinctive feature of TPH2 supports the finding that 5-HT is involved in the function of the HPA axis, a critical neuroendocrine system that responds to stress and also shows a circadian rhythm. The dysfunction of this system is implicated in numerous psychiatric diseases. Thus, genetic polymorphisms or other cis-acting factors affecting TPH2 gene expression might result in the alteration of HPA axis function or other physiological processes related to 5-HT (Chamas et al. 2004; Zill et al. 2004; Clark et al. 2005; Leonard 2005; Sanchez et al. 2005; Brown et al. 2006; Hiroi et al. 2006; Chen et al. 2010).

Accordingly, mechanisms that specifically regulate TPH2 expression and its modulation by exogenous stimuli may be important for the understanding of the etiopathogenesis or management of psychiatric disorders (Chen and Miller 2012).

Recent studies have identified regulatory factors of serotonergic neuronal gene expression. These include the nuclear deformed epidermal autoregulatory factor-1, the Freud-1 and -2, and the neuron-restrictive silencing factor (NRSF) also known as repressor element-1-silencing transcription factor (REST) (Patel et al. 2007; Albert and Francois 2010). Patel et al. described a functional motif in the TPH2 promoter that is a novel bipartite variant of the binding site for NRSF (Patel et al. 2007). It is well known that NRSF limits tissue expression of neuronal genes through the canonical 21-bp motif called neuron-restrictive silencer element (NRSE) and is implicated in neurogenesis (Tateno et al. 2006), neuronal differentiation (Abrajano et al. 2009), and transcriptional regulation of a network of genes. NRSF represses transcription of its target genes by recruiting a silencing complex of chromatin-remodeling proteins, variably including SIN3A, histone deacetylase, CoREST, and methyl-CpG-binding protein 2 (Schoenherr and Anderson 1995; Abrajano et al. 2009).

In this study, we addressed the issue of the modulation of endogenous TPH2 expression in undifferentiated and differentiated neural cells and, in particular, of the characterization of TPH2 human promoter and its molecular regulation. For this purpose, we used a mouse mesencephalic embryonic cell line, A1 mes-c-myc (A1) cells. A1 cells were immortalized by means of infection with c-myc carrying retroviral vector of early neural precursors (E11), thus these cells express markers belonging to different neural cell lineages including neural stem cells such as neuron-specific enolase (NSE), glial fibrillic acidic protein (GFAP), and nestin. These cells proliferate and remain undifferentiated when grown in the presence of serum, whereas they cease to proliferate and differentiate, ensuing neurite outgrowth, neuronal electrophysiological properties, and expression of neuronal markers when serum is withdrawn and cAMP is added (Colucci-D'Amato et al. 1999).

In a previous study, we characterized, by means of RT-PCR, the expression of serotonergic markers in the A1 cells before and after differentiation. In particular, we demonstrated that A1 cells express the transcripts of the two rate-limiting enzymes, TPH1 and TPH2, necessary for serotonin synthesis, and that the two enzymes were differently expressed in proliferating and differentiated cells. We also found that TPHs were modulated by fluoxetine and citalopram, two selective serotonin reuptake inhibitor (SSRI) drugs widely used in therapy (Di Lieto et al. 2007). In Fig. 1 are represented the main features of undifferentiated/proliferating A1(uA1) cells and differentiated/non-proliferating A1(dA1) cells.

image

Figure 1. Proliferating/undifferentiated A1-mes-c-myc (uA1) cells (a) and unproliferating/differentiated A1 mes-c-myc(dA1) cells (b) with their phenotypic profiles. (Colucci-D'Amato et al. 1999; Chambery et al. 2009).

Download figure to PowerPoint

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References

Cell cultures

A1 cells were generated in our laboratory immortalizing, by means of c-myc infection, a culture obtained from embryonic mesencephalon of CD1 mice at day 11 (Colucci-D'Amato et al. 1999)

A1 cells were cultured and differentiated as previously reported (Colucci-D'Amato et al. 1999). Briefly, A1 cells were cultured in minimal essential medium (MEM)/F12 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) and were differentiated by serum withdrawal and stimulation with 1 mM cAMP (Sigma Aldrich) and N2 supplement (Invitrogen).

Animals

CD1 male mice (Charles River, Milan, Italy) were used for the study as they belong to the strain used to obtain A1 cells. The animal facility was maintained at 21°C with a reversed 12 h:12 h light/dark cycle (lights off at 08.00 a.m.). After arrival, animals were habituated to the conditions for 10 days and handled daily. Animals were lightly anesthesized with isofluorane and killed between 10:00 and 11:00 a.m. Animal experiments were conducted in accordance with the European Council Directive of November 24, 1986 (86/609/ECC).

Eight CD1 male mice (18–20 weeks of age) were decapitated, brains were carefully removed, and the pineal glands were quickly removed and frozen at −80°C. Brains were dissected into two parts by cutting perpendicularly to the cortical surface, dorsal raphe nuclei (DRN) were rapidly removed and immediately frozen over liquid nitrogen and stored at −80°C until use.

RNA isolation and real-time PCR analysis

Isolation of the total RNA from cells and tissues was performed using the TotalRNA isolation Kit (Promega, Paisley, UK) according to the manufacturer's instructions. In particular, 1 × 106 adherent cells were rapidly harvested by manual scraping in the presence of RNA Lysis buffer®. Brain tissues frozen in liquid nitrogen were ground using a mortar and pestle, and RNA Lysis buffer® was added to the ground tissues.

cDNA was synthesized from 1 μg of total RNA using SuperScript II reverse transcriptase (Invitrogen) and random hexamer oligonucleotides. cDNA was then used for real-time PCR. Forward (f) and reverse (r) primers used were (5′–3′) TPH1 f GGCTTGCTTTCTTCCATCAG; r ATGGAGAGAGGGCGAGAGACA. TPH2 f GCAGCCCGCAATGATGATGT; r GCACGTTGTCTTCCCTGTAG. HPRT f CCTGCTGGATTACATTAAAGCACTG; r CCTGAAGTACTCATTATAGTCAAGG; NRSF f GTCTCAGTGGTCCAGGTAAGTA; r CCTTTTGTCCGTCTGT G.

Amplification reactions were run in triplicate in MicroAmp 96-well plates (Applied Biosystems, Carlsbad, CA, USA) containing 5 μL cDNA, 2 μL of primers mix (final primer concentration of 300 nM each), and 12.5 μL of Power SYBR Green PCR Master Mix (Applied Biosystems) in a final volume of 25 μL. Amplifications were carried out in an ABI PRISM® 7900 Sequence Detection System (from Applied Biosystems). To activate the Taq Polymerase, reactions started with two initial steps of 50°C for 2 min and 95°C for 10 min. The reaction proceeded with 40 cycles of 95°C for 15 s and 60°C for 1 min for gene amplification. A final dissociation step was always performed to obtain the melting curves (thermal profile) of the amplicons obtained in the reactions. mRNA levels were expressed as 2−ΔCt using hypoxantine phosphoribosyl transferase (HPRT) mRNA level as internal standard.

Protein analysis

Isolation of cytosolic protein was performed by scraping cells in lysis buffer (25 mM Tris HCl, pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.1 mM NaF, 0.1 mM Na3VO4). Protein concentration was determined by the Bradford method. Forty micrograms of protein extract was subjected to a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and electroblotted on nitrocellulose membranes, which were blocked at room temperature for 1 h in blocking solution [5% milk in Tris-Buffered Saline Tween 20 (TBS-T)], incubated overnight at 4°C with anti-TPH1 or anti-TPH2 antibodies (1 μg/mL; Abcam, Cambridge, UK). Membrane was incubated with peroxidase-conjugated anti-rabbit (for TPH1) and anti-goat (for TPH2) antibodies (1 : 10 000; Amersham Biosciences, Piscataway, NJ, USA). Proteins were revealed by an ECL kit (Amersham). Normalization was performed with anti-beta actin antibodies (1 μg/mL in TBS-T; Tansduction Lab., Lexington, KI, USA) for 1 h at 25°C and incubated with peroxidase-conjugated anti-mouse IgG (1 : 10 000 in TBS-T). Proteins were revealed as above. The intensity of the bands was quantified by scanning densitometry using Scion Image version 4.5 software (Scion Corp., Frederick, MD, USA).

Preparation of reporter constructs TPH2-55 and TPH2-9

A genomic clone covering the human TPH2 gene promoter region (GenBank accession No.; AC090109) was isolated from the human genomic library (Clontech, Mountain View, CA, USA). The 8.7-kb Bam HI/Bam HI fragment (−8755 to −2; adenine of the translation start codon was assigned to +1) was cloned into the Bgl II-digested pGL4.10 [luc2] (pGL4-Basic) (Promega), giving TPH2-23. Then, TPH2-23 was digested with Xho I/Afl II to generate TPH2-55 containing a 2-kb fragment upstream of the translation start site (−1990 to −2). TPH2-55 has a potential non-canonical NRSE sequence (5′-TTCAGCACCAGGGTTCTGGACAGCG CC-3′, −133 to −107) (Patel et al. 2007). To make an NRSE-disrupted mutant, TPH2-55 was used as the template for PCR using QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) and mutation primer (5′-gggaggattcgcattgctcTTCAGCAGTTTTCTGGACAGCGCCccaagc agg-3′; upper case letters indicate disrupted NRSE). The resultant mutant was referred to as TPH2-9 having a 3-bp (CAC) deletion and a 2-bp (GG to TT) substitution in the NRSE.

Transient transfection analysis of the TPH2 gene promoter activity

A modified transfection protocol was used to analyze promoter activities in differentiated A1 cells in transient transfection experiments (Troelsen et al. 2003).

A1 cells (2 × 105) were cultured in 24-well tissue culture dish containing 0.5 mL of proliferating medium (MEM/F12, 10% FBS) for 2 days. Transfection was performed by using 2 μg of the reporter construct (TPH2-55 or TPH2-9) or the molar equivalent amount of the pGL4-Basic and TransIT-Neural (Mirus, Milton Keynes, UK) reagent, and by incubating A1 cells at 37°C for 5 h according to the supplier's protocol. Then, all culture medium was removed, and 0.5 mL of fresh differentiation medium (MEM/F12, 1XN2, 1 mM cAMP) was added to each tissue culture dish. Incubation was continued for additional 43 h, 67 h, 115 h, and 163 h (namely 2, 3, 5, and 7 days after transfections) under differentiating conditions.

Medium was changed every 2 days. Cells were harvested at each time point and luciferase activities were measured using a dual luciferase assay system (Promega) with Lumicounter 700 (Microtec. Co. Ltd., Chiba, Japan). In some experiments, A1 cells (8 × 104) were cultured in 24-well dish containing 0.5 mL of proliferating medium for 2 days. After transfections as described above, 0.5 mL of fresh proliferating medium was added and A1 cells were incubated for additional 43 h (namely 2 days after transfections) under proliferating conditions to measure luciferase activities.

Each reporter construct was cotransfected with 0.1 μg of the phRL-TK (Promega) to correct transfection efficiencies. Total amount of transfected DNA was adjusted to 2.1 μg by adding pUC 19, if required. TPH2 promoter activities are expressed as fold changes relative to luciferase activities in cells transfected with pGL4-Basic (set at 1.0) and represent mean ± SEM of five separate experiments; each was performed in duplicate.

In all the experiments, statistical significance was determined using the two-tailed t-test.

RNA silencing

dA1 cells were transfected with NRSF shRNA and scrambled shRNA (OriGene, Rockville, MD, USA), using Turbofection8 solution according to the manufacturer indications. Transfected cells were cultivated in MEM-F12 10% FBS and incubated in 5% CO2 incubator for 48 h before harvesting for RNA analysis.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References

TPH1 and TPH2 are differentially expressed in uA1 or dA1 cells

In this study, we investigate TPH1 and TPH2 expression in A1 cells as both mRNA and protein levels, by means of quantitative real-time PCR and western blotting, respectively.

As shown in Fig. 2, real-time PCR analysis shows that TPH1 mRNA expression is higher in uA1 cells as compared with dA1 cells. On the other hand, TPH2 mRNA is more expressed in dA1 cells as compared with uA1. TPH protein expression, performed by western blotting analysis on the total protein extracts obtained from uA1 and dA1 cells, confirmed that TPH1 is significantly more expressed in uA1 cells as compared with dA1 cells (Fig. 3). As far as TPH2, we also show that it is more expressed in dA1 than uA1 cells (Fig. 3). These results were quantitatively confirmed by densitometric analysis of the protein signals normalized to beta-actin expression. Protein extracts from mouse dorsal raphe nuclei and mouse pineal glands were used as positive controls and protein extracts from NIH3T3 cells were used as negative controls (Fig. 3).

image

Figure 2. Tryptophan hydroxylase (TPH)-1 and TPH-2 are differentially expressed in uA1 or dA1 cells, respectively. The real-time PCR assay has been performed in triplicate on three independent samples per cell type. In figure, the means ± SEM of the three experiments are reported. *p < 0.05.

Download figure to PowerPoint

image

Figure 3. Differential expression of Tryptophan hydroxylase (TPH)-1 and TPH2 proteins in uA1 or dA1 cells. The figure represents analysis by western blotting of the presence of the proteins TPH1 and TPH2 in uA1 cells, dA1 cells, dorsal raphe nuclei (DRN), pineal gland (PiG), and NIH3T3 fibroblasts. (a) representative of three western blotting assays are shown. (b) a graph of the densitometric analysis of the signal intensities of all the three assays. Results are represented as means ± SEM of the three experiments. *p < 0.05.

Download figure to PowerPoint

NRSF mRNA is more expressed in uA1 than dA1 cells, and the TPH2 gene promoter activity increased in dA1 cells

To better understand how TPH2 expression is regulated in A1 cells, we analyzed, by means of real-time PCR, the expression of NRSF, a zinc-finger transcription factor involved in the repressions of the neuronal genes in neuronal progenitor cells (Schoenherr and Anderson 1995). As shown in Fig. 4a, we observed that NRSF is significantly more expressed in uA1 cells as compared with dA1 cells. To further clarify NRSF role in the regulation of TPH2 gene expression in uA1 and dA1 cells, we cloned a 2-kb fragment upstream of the translation start site of the human TPH2 gene into pGL4-Basic, giving TPH2-55. It was recently reported that the promoter fragment of 2-kb length relative to the transcription start site (corresponding to −141) conferred almost complete specificity to serotonergic neurons (Chen et al. 2009; Chen et al. 2009). This suggests that TPH2-55 (−1991 to −2) has essential control sequences for the expression of the human TPH2 gene in serotonergic neurons. Moreover, it was reported that TPH2 gene has a functional NRSE in the vicinity of its transcription start site (Benzekhroufa et al. 2009, Patel et al. 2007). On the basis of these findings, we generated an NRSE-disrupted construct TPH2-9 to efficiently analyze the NRSF-mediated regulation of the TPH2 gene promoter activity (Fig. 4b).

image

Figure 4. Neuron-restrictive silencer factor (NRSF)-mediated regulation of the Tryptophan hydroxylase (TPH)-2 gene expression in A1 cells. (a) NRSF mRNA is more expressed in uA1 cells. The figure represents the real-time PCR analysis of the expression of NRSF mRNA in uA1 and dA1 cells, respectively. The real-time PCR assay has been performed in triplicate on three different samples per cell type. In figure, the means ± SEM of the nine data obtained per cell type are reported. *p < 0.05. (b) Schematic representation of the human TPH2 gene promoter–luciferase constructs containing wild-type and mutated neuron-restrictive silencer element (NRSE) sequences. A part of the human TPH2 gene (5'-flanking region, exon 1 and a part of intron 1) including the position of relevant restriction sites and potential TATA box (open oval) and NRSE (open square) is shown (upper panel). A 2-kb fragment (corresponding to Afl II/Bam HI segment (-1990 to -2); +1 was assigned at adenine of ATG codon) upstream of the translation start site of the TPH2 gene was cloned into pGL4-Basic to prepare the promoter–luciferase reporter construct (middle panel). Boxed nucleotides indicate the result of site-directed mutagenesis (3-bp (CAC) deletion and 2-bp (GG to TT) substitution) converting the wild-type NRSE (TPH2-55) to mutated NRSE (TPH2-9) (lower panel). (c) The human TPH2 gene promoter activity increased in differentiated A1 cells. A1 cells were transfected with reporter constructs using TransIT-Neural under proliferating conditions and incubated under either proliferating (for 2 days; 2#) or differentiating (for 2–7 days; 2, 3, 5, and 7) conditions to measure luciferase activity. Each reporter construct was cotransfected with 0.1 μg of the phRL-TK to correct transfection efficiencies. TPH2 promoter activities are expressed as fold changes relative to luciferase activities in cells transfected with pGL4-Basic (set as 1.0) and represent mean ± SEM of five separate experiments; each was performed in duplicate. *p < 0.05 compared with the luciferase activity of cells cultured for 2 days under differentiating conditions after transfections by the two-tailed t-test. White bars represent TPH2-55 activity, gray bars represent TPH2-9 activity. (d) NRSF knock down enhances TPH2 expression in uA1 cells. Real-time PCR analysis of the expression of NRSF and TPH2 mRNA in uA1 transfected with NRSF shRNA (dark gray) and scrambled shRNA (light gray), respectively. The real-time PCR assay has been performed in triplicate on three different samples per cell type. In figure, the means ± SEM of the nine data obtained per cell type. *p < 0.05 are reported.

Download figure to PowerPoint

Reporter constructs were transfected in proliferating conditions and then A1 cells were further incubated either in proliferating (for 2 days) or differentiating (for 2, 3, 5, and 7 days) conditions to measure luciferase activities (Fig. 4c). TPH2-55 gave a luciferase activity about 1.5-fold higher than that of pGL4-Basic, suggesting that the promoter activity of TPH2-55 was distinct but low. The luciferase activity of TPH2-55 remained nearly constant for the whole period of observation (2–7 days of differentiation). Concomitantly, TPH2-9 gave about three-fold higher activity as compared with pGL4-Basic in proliferating conditions (Fig. 4c, 2#), and the luciferase activity of TPH2-9 progressively increased in differentiating conditions, reaching about a five-fold higher activity at 7 days after induction of differentiation (Fig. 4c, 2–7). Finally, to definitely clarify the role of NRSF in the regulation of TPH2 expression, we performed NRSF knock down in uA1 cells by means of shRNA transfection. As shown in Fig. 4d, NRSF knock down in uA1 cells is able to enhance TPH2 mRNA expression, whereas the transfection with a scrambled shRNA did not affect TPH2 mRNA expression in uA1 cells.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References

In this study, we confirm by different approaches and extend the findings that A1 cells, a neuronal immortalized cell line from embryonic mouse mesencephalon, express the rate-limiting step enzymes necessary for 5-HT synthesis: TPH1 and TPH2. In particular, in this article we show, by means of real-time PCR and western blotting analysis that A1 cells are able to express both TPH1 and TPH2 mRNAs and proteins, and that this expression is dependent on cell proliferation/differentiation status. TPH1 is more expressed in undifferentiated cells, whereas TPH2 expression is higher in differentiated cells. This finding is in line with the well-known observation that TPH2 is almost exclusively expressed in the brain, whereas TPH1 is predominantly expressed in the pineal gland and the peripheral tissues (Malek et al. 2005; Turner et al. 2006). Thus, our findings demonstrate that A1 cells in their differentiated status are able to turn enzyme expression from non-neural TPH1 isoform to the neuron-specific TPH2 isoform.

Actually, TPH1 is expressed preferentially during the late developmental stages in the mouse brain, whereas TPH2 is expressed in the adult brain (Nakamura et al. 2006). Importantly, undifferentiated and differentiated A1 cells reproduce this alternative pattern of expression of TPH1 and TPH2 enzymes. Therefore, A1 cells, with their opposite regulation of TPH1 and TPH2 expression, may provide a useful tool to study the relevance and the molecular mechanisms underlying this switch.

Furthermore, it is also conceivable that A1 cells could represent an ideal model system to study 5-HT enzymatic pathway. Indeed, expression of recombinant protein in Escherichia coli is indispensable and has been widely used to obtain purified TPH1 and TPH2 in large quantities for further detailed structural and functional analysis. However, mammalian cell culture systems can provide conditions for protein expression, which are closer to the in vivo environment. To date, pheochromocytoma PC12 cells have been established as a model system to study TPH2 regulation and function when TPH2 is exogenously expressed (Wang et al. 2002). Moreover, TPH2, as well as other members of the superfamily of aromatic amino acid hydroxylases, forms homotetramers. Previous studies using recombinant TPH1 revealed a tendency of the purified proteins to form aberrant oligomers and aggregates, a phenomenon which may or may not occur in vivo (Yang and Kaufman 1994; Clark et al. 2008). Therefore, the use of mammalian cell systems that endogenously express TPH2 can provide a rapid functional analysis mimicking the in vivo condition. In contrast to the growing number of genetic association studies, little is known about the regulation of TPH2 expression. Limited in vivo studies suggest that TPH2 mRNA levels are decreased following stress corticosteroids (Lunyak and Rosenfeld 2005; Clark et al. 2005) and increased by ovarian steroids (Sanchez et al. 2005; Bethea et al. 2011), or hypotensive stress (Brown et al. 2006). For this reason, we focused our attention on TPH2 in A1 cells and aimed to better clarify the mechanisms underlying its expression in A1 cells.

Recently, Patel et al. identified a functional bipartite NRSE in the TPH2 gene promoter and observed that this particular NRSE permits TPH2 gene transcriptional repression by NRSF and that TPH2 mRNAs were up-regulated by dominant-negative NRSF in rat C6 glioma cells (Patel et al. 2007).

We analyzed the expression of the NRSF and TPH2 mRNAs by real-time PCR in A1 cell system. We show that NRSF mRNA is more expressed in uA1 cells than dA1 cells and, inversely, TPH2 mRNA is more expressed in dA1 than uA1 cells (Figs 2 and 4a). These results suggest that NRSF-mediated repression of the endogenous TPH2 gene transcription was, at least partly, relieved via a decrease in NRSF levels.

To further clarify the role of NRSF in the regulation of TPH2 gene promoter activity in uA1 and dA1 cells, we prepared an NRSE-intact (TPH2-55) and an NRSE-disrupted (TPH2-9) reporter construct to efficiently analyze the NRSF-mediated regulation of the TPH2 gene promoter activity. If endogenous TPH2 gene expression is regulated by NRSF binding to NRSE, TPH2-55 reporter activity is expected to be directly correlated with changes in endogenous TPH2 gene expression levels in dA1 cells. As shown in Fig. 4c, however, the luciferase activity of TPH2-55 remained low, even though higher than that of pGL4-Basic, and nearly constant in spite of a decrease in NRSF levels, implying that the reporter promoter activity does not necessarily correlate with the endogenous TPH2 gene expression. At this moment, the cause of this apparent discrepancy remains unclear, but might relate to the fact that the transiently transfected DNA lacks its proper chromatin structure and is thought to be more accessible to binding of factors (Hebbar and Archer 2008). We also could not exclude the possibility that additional as yet unidentified long-range regulatory elements may be involved in the regulation of the endogenous TPH2 gene transcription in dA1 cells.

It should be emphasized that luciferase activity of the NRSE-disrupted construct TPH2-9 progressively increased depending on A1 cell differentiation (Fig. 4c). These results show that dA1 cells indeed express transcription factors necessary for an activation of the TPH2 gene promoter in a differentiation-dependent fashion. These results also support the idea that A1 cells are useful to identify these potential transcription factors, which may play a pivotal role in regulation of the TPH2 gene expression in central serotonergic neurons.

More importantly, we demonstrated that NRSF knock down in uA1 cells are able to enhance TPH2 mRNA expression, definitely clarifying the role of NRSF in the regulation of TPH2 expression (Fig. 4d). Recently, it was reported that NRSF mRNA expression in dorsal raphe neurons was significantly increased in female subjects affected by major depressive disorder compared with matched controls, indicating that an alteration in NRSF expression may be associated with diminished 5-HT neurotransmission and the higher incidence of depression in women (Goswami et al. 2007).

It is now evident that genetic or epigenetic factors affecting TPH2 gene expression or catalytic properties may alter 5-HT neurotransmission and thereby modify behavioral traits, drug responses, and disease susceptibility. In particular, based on genetic studies, there is accumulating evidence that altered function of TPH2 in the brain plays a role in anxiety- and depression-related personality traits (Zhang et al. 2005). Findings from psychophysiological and functional imaging studies are indicative of various TPH2 polymorphisms directly influencing serotonergic function and thus impacting on mood disorders and on the response to antidepressant treatment (Zill et al. 2004; Walitza et al. 2005; Lopez et al. 2007).

Moreover, it is worth noting that, we have recently published the proteomic profiling of both uA1 and dA1 cells (Chambery et al. 2009). Data mining and comparative proteome analysis can be used to identify protein networks involved in TPH2 regulation and may provide a tool to discover molecular biomarkers of drug action and novel therapeutic targets.

In conclusion, our data suggest that A1 cells could represent a model system able to allow a deep insight into the mechanisms of regulation of TPH2 gene expression and to identify novel therapeutic targets in the development of more useful drugs for the management of psychiatric disorders.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References

We thank Dr. Antonio Di Lieto (Napoli) for helpful comments, Dr. Elvira de Leonibus (Napoli) for providing mice, Mafalda Giovanna Reccia (Caserta) and Yoko Okada (Kawasaki) for technical support.

Financial disclosure

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References

This work was supported by “Fondi di Ateneo”, Second University of Naples to LCD and by Grant-in-Aid for Scientific Research(C) (16591170) to HM.

The authors reported no biomedical financial interests or potential conflicts of interest with regards to this manuscript.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Financial disclosure
  8. References
  • Abrajano J. J., Qureshi I. A., Gokhan S., Zheng D., Bergman A. and Mehler M. F. (2009) Differential deployment of REST and CoREST promotes glial subtype specification and oligodendrocyte lineage maturation. PLoS ONE 4, e7665.
  • Abumaria N., Ribic A., Anacker C., Fuchs E. and Flugge G. (2008) Stress upregulates TPH1 but not TPH2 mRNA in the rat dorsal raphe nucleus: identification of two TPH2 mRNA splice variants. Cell. Mol. Neurobiol. 28, 331342.
  • Albert P. R. and Le Francois B. (2010) Modifying 5-HT1A receptor gene expression as a new target for antidepressant therapy. Front. Neurosci. 4, 17.
  • Benzekhroufa K., Liu B. H., Teschemacher A. G. and Kasparov S. (2009) Targeting central serotonergic neurons with lentiviral vectors based on a transcriptional amplification strategy. Gene Ther. 16, 681688.
  • Bethea C. L., Smith A. W., Centeno M. L. and Reddy A. P. (2011) Long-term ovariectomy decreases serotonin neuron number and gene expression in free ranging macaques. Neuroscience 192, 675688.
  • Brown H. J., Henderson L. A. and Keay K. A. (2006) Hypotensive but not normotensive haemorrhage increases tryptophan hydroxylase-2 mRNA in caudal midline medulla. Neurosci. Lett. 398, 314318.
  • Chamas F. M., Underwood M. D., Arango V., Serova L., Kassir S. A., Man J. J. and Sabban E. L. (2004) Immobilization stress elevates tryptophan hydroxylase mRNA and protein in the rat raphe nuclei. Biol. Psychiatry 55, 278283.
  • Chambery A., Colucci-D'Amato L., Vissers J. P., Scarpella S., Langridge J. I. and Parente A. (2009) Proteomic profiling of proliferating and differentiated neural mes-c-myc A1 cell line from mouse embryonic mesencephalon by LC-MS. J. Proteome Res. 8, 227238.
  • Chen G. L. and Miller G. M. (2012) Advences in tryptophan hydroxylase-2 gene expression regulation: new insight into serotonin-stress interaction and clinical implication. Am. J. Med. Genet. Part B 159B, 152171.
  • Chen Z. F., Paquette A. J. and Anderson D. J. (1998) NRSF/REST is required in vivo for repression of multiple neuronal target genes during embryogenesis. Nat. Genet. 20, 136142.
  • Chen G. L., Vallender E. J. and Miller G. M. (2008) Functional characterization of the human TPH2 5' regulatory region: untranslated region and polymorphisms modulate gene expression in vitro. Hum. Genet. 122, 645657.
  • Chen G. L., Novak M. A., Meyer J., Kelly B. J., Vallender E. J. and Miller G. M. (2010) The effect of rearing experience and TPH2 genotype on HPA axis function and aggression in rhesus monkeys: a retrospective analysis. Horm. Behav. 57, 184191.
  • Clark J. A., Pai L. Y., Flick R. B. and Rohrer S. P. (2005) Differential hormonal regulation of tryptophan hydroxylase-2 mRNA in the murine dorsal raphe nucleus. Biol. Psychiatry 57, 943946.
  • Clark J. A., Flick R. B., Pai L. Y., Szalayova I., Key S., Conley R. K., Deutch A. Y., Hutson P. H. and Mezey E. (2008) Glucocorticoid modulation of tryptophan hydroxylase-2 protein in raphe nuclei and 5-hydroxytryptophan concentrations in frontal cortex of C57/Bl6 mice. Mol. Psychiatry 13, 498506.
  • Colucci-D'Amato G. L., Tino A., Pernas-Alonso R. and ffrench-Mullen J.M., di Porzio U. (1999) Neuronal and glial properties coexist in a novel mouse CNS immortalized cell line. Exp. Cell Res. 252, 383391.
  • Di Lieto A., Leo D., Volpicelli F., di Porzio U. and Colucci-D'Amato L. (2007) FLUOXETINE modifies the expression of serotonergic markers in a differentiation-dependent fashion in the mesencephalic neural cell line A1 mes c-myc. Brain Res. 27, 110.
  • Goswami D. B., May W. L., Stckmeier C. A. and Austin M. C. (2010) Transcriptional expression of serotonergic regulators in laser-captured microdissected dorsal raphe neurons of subjects with major depressive disorder:sex-specific differences. J. Neurochem. 112, 397409.
  • Hebbar P. B. and Archer T. K. (2008) Altered histone H1 stoichiometry and an absence of nucleosome positioning on transfected DNA. J. Biol. Chem. 283, 45954601.
  • Hiroi R., McDevitt R. A. and Neumaier J. F. (2006) Estrogen selectively increases tryptophan hydroxylase-2 mRNA expression in distinct subregions of rat midbrain raphe nucleus: association between gene expression and anxiety behavior in the open Weld. Biol. Psychiatry 60, 288295.
  • Kulikov A. V., Osipova D. V., Naumenko V. S. and Popova N. K. (2005) Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav. 4, 482485.
  • Leonard B. E. (2005) The HPA and immune axes in stress: the involvement of the serotonergic system. Eur. Psychiatry 20(Suppl 3), S302S306.
  • Liang J., Wessel J. H., 3rd, Iuvone P. M., Tosini G. and Fukuhara C. (2004) Diurnal rhythms of tryptophan hydroxylase 1 and 2 mRNA expression in the rat retina. NeuroReport 15, 14971500.
  • Lopez V.A., Detera-Wadleigh S., Cardona I., Kassem L., The National Institute of Mental Health Genetics Initiative Bipolar Disorder Consortium and McMahon F.J. (2007) Nested association between genetic variation in tryptophan hydroxylase II, bipolar affective disorder, and suicide attempts. Biol. Psychiatry 61, 181186.
  • Lunyak V. V. and Rosenfeld M. G. (2005) No rest for REST: REST/NRSF regulation of neurogenesis. Cell 121, 499501.
  • Malek Z. S., Dardente H., Pevet P. and Raison S. (2005) Tissue-specific expression of tryptophan hydroxylase mRNAs in the rat mid-brain: anatomical evidence and daily profiles. Eur. J. Neurosci. 22, 895901.
  • Nakamura K. and Hasegawa H. (2007) Developmental role of tryptophan hydroxylase in the nervous system. Mol. Neurobiol. 35, 4554.
  • Nakamura K., Sugawara Y., Sawabe K. et al. (2006) Late developmental stage-specific role of tryptophan hydroxylase 1 in brain serotonin levels. J. Neurosci. 26, 530534.
  • Patel P. D., Bochar D. A., Turner D. L., Meng F., Mueller H. M. and Pontrello C. G. (2007) Regulation of tryptophan hydroxylase-2 gene expression by a bipartite REST/NRSF binding motif. J. Biol. Chem. 282, 2671726724.
  • Sanchez R. L., Reddy A. P., Centeno M. L., Henderson J. A. and Bethea C. L. (2005) A second tryptophan hydroxylase isoform, TPH-2 mRNA, is increased by ovarian steroids in the raphe region of macaques. Brain Res. Mol. Brain Res. 135, 194203.
  • Schoenherr C. J. and Anderson D. J. (1995) The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. Science 267, 13601363.
  • Tateno M., Ukai W., Hashimoto E., Ikeda H. and Saito T. (2006) Implication of increased NRSF/REST binding activity in the mechanism of ethanol inhibition of neuronal differentiation. J. Neural Transm. 113, 283293.
  • Troelsen J. T., Olsen J., Møller J. and Sjöström H. (2003) An upstream polymorphism associated with lactase persistence has increased enhancer activity. Gastroenterology 125, 16861694.
  • Turner E. H., Loftis J. M. and Blackwell A. D. (2006) Serotonin a la carte: supplementation with the serotonin precursor 5-hydroxytryptophan. Pharmacol. Ther. 109, 325338.
  • Walitza S., Renner T. J., Dempfle A. et al. (2005) Transmission disequilibrium of polymorphic variants in the tryptophan hydroxylase-2 gene in attention-deficit/hyperactivity disorder. Mol. Psychiatry 10, 11261132.
  • Walther D. J., Peter J. U., Bashammakh S., Hörtnagl H., Voits M., Fink H. and Bader M. (2003) Synthesis of serotonin by a second tryptophan hydroxylase isoform. Science 299, 76.
  • Wang L., Erlandsen H., Haavik J., Knappskog P. M. and Stevens R. C. (2002) Three-dimensional structure of human tryptophan hydroxylase and its implications for the biosynthesis of the neurotransmitters serotonin and melatonin. Biochemistry 41, 1256912574.
  • Yang X. J. and Kaufman S. (1994) High-level expression and deletion mutagenesis of human tryptophan hydroxylase. Proc. Natl Acad. Sci. USA 91, 66596663.
  • Zhang X., Beaulieu J. M., Sotnikova T. D., Gainetdinov R. R. and Caron M. G. (2004) Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science 305, 217.
  • Zhang X., Gainetdinov R. R., Beaulieu J. M., Sotnikova T. D., Burch L. H., Williams R. B., Schwartz D. A., Krishnan R. R. and Caron M. G. (2005) Loss-of-function mutation in tryptophan hydroxylase-2 identified in unipolar major depression. Neuron 45, 1116.
  • Zill P., Buttner A., Eisenmenger W., Moller H. J., Bondy B. and Ackenheil M. (2004) Single nucleotide polymorphism and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene in suicide victims. Biol. Psychiatry 56, 581586.