SEARCH

SEARCH BY CITATION

Keywords:

  • activation;
  • microglia;
  • prion protein;
  • siRNA

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The cellular prion protein (PrPC) is a glycoprotein anchored by glycosylphosphatidylinositol (GPI) to the cell surface and is abundantly expressed in the central nervous system. Numerous studies have suggested a protective function for PrPC, including protection from ischemic and excitotoxic lesions and several apoptotic insults, and recent reports have shown that PrPC has a context-dependent neuroprotective function. In this study, we investigated the effect of PPNP down-regulation on various forms of microglial activation. We first examined the mRNA expression of PRNP upon exposure to IFN-γ, IL-4, or IL-10 in BV2 microglia. We then analyzed the effect of si-RNA-mediated disruption of PRNP on different parameters of microglial activation in IFN-γ-, IL-4-, or IL-10-stimulated microglia. The results showed that PRNP mRNA expression was invariably down-regulated in microglia upon exposure to IFN-γ, IL-4, or IL-10. PRNP silencing prior to cytokines treatment reduced the responsiveness of microglia to INF-γ treatment, significantly altered IL-4-induced microglial activation phenotype, and had no effect on IL-10-induced microglial activation. Together, these results support a role of PrPC in the modulation of the shift of microglia from a quiescent state to an activated phenotype and in the regulation of the microglial response during classical and alternative activation.

Abbreviations used
Arg1

Arginase 1

ASC

Apoptosis-associated speck-like protein

IL-4Rα

Interleukin-4 receptor α

Mrc1

Mannose receptor 1

NALP3

NACHT, LRR, and PYD domains-containing protein 3

PrPC

Cellular prion protein

SOCS3

Suppressor of cytokine signaling 3

Cellular prion protein (PrPC) is a glycosyl-phosphatidylinositol–anchored glycoprotein encoded by prion protein gene (PRNP); it is expressed most abundantly in the brain, but has also been detected in other non-neuronal tissues as diverse as lymphoid cells, lung, heart, kidney, gastrointestinal tract, muscle, and mammary gland (Aguzzi et al. 2008; Linden et al. 2008; Wu et al. 2008). The abnormal processing of PrPC gives rise to pathogenic prion (PrPSc), which is the etiologic agent of several transmissible spongiform encephalopathies (Prusiner 1998). Although a great deal is known about the role of PrPSc in the disease process, the normal function of PrPC has remained elusive. A variety of functions have been proposed for mammalian PrPC, including involvement in cell death and survival, oxidative stress, immunomodulation, differentiation, metal ion trafficking, cell adhesion, and transmembrane signaling (Aguzzi et al. 2008; Linden et al. 2008).

Microglia are the principal immune effector cells in the central nervous system, and play an important role in receiving and propagating inflammatory signals in response to activation of the peripheral immune system. In the absence of inflammatory stimuli, microglia are quiescent even though they are actively involved in immune surveillance (Nimmerjahn et al. 2005; Soulet and Rivest 2008). In response to inflammatory triggers such as lipopolysaccharides (LPS) and INF-γ, microglia are activated and display macrophage-like capabilities including phagocytosis, antigen presentation, and inflammatory cytokines production (Garden and Möller 2006; Ransohoff and Perry 2009); this pro-inflammatory state is known as classical activation.

Microglia have also been shown to demonstrate an anti-inflammatory alternative activation phenotype when stimulated with IL-4 or IL-13 (Colton 2009). These alternatively activated cells produce several components associated with tissue repair and reconstruction after injury (Brodie et al. 1998; Kitamura et al. 2000; Odegaard et al. 2007; van Rossum et al. 2008).

Recently, a third subtype of microglial activation, termed acquired deactivation, has been identified (Colton 2009). This phenotype is induced by IL-10 and incorporates a mixed-phenotype population that exhibits immunosuppression and is associated with uptake of apoptotic cells.

This study investigated the role of PrPC in microglial activation and showed that the three phenotypes of microglial activation are accompanied with down-regulation of PRNP expression and that PrPC may be involved in the regulation of the microglial response during classical and alternative activation.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell culture and treatment conditions

The experiments were conducted on BV2 microglial cells. The choice of this cell line is justified by the close similarities between BV-2 and primary microglia in mechanisms mediating microglial activation (Henn et al. 2009).

BV2 cells, a C57BL/6 mouse microglial cell line, were obtained from Xiehe Medical University (Beijing, China). Cells were cultured in a humidified incubator at 37°C with 5% CO2 in Dulbecco's modified Eagle's medium and F12 medium (Hyclone, Logan, UT, USA) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY, USA), 100 μg/mL streptomycin, 100 U/mL penicillin (Gibco), and 2 mmol/L glutamine. For each experiment, cells were plated into 12-well dishes for 12 h, and then stimulated with recombinant mouse IL-4, IFN-γ, or IL-10, respectively, (200 U/mL, 20 ng/mL, or 20 ng/mL, respectively, Pepro Tech, Rocky Hill, NJ, USA) for 24 h at 37°C in a 5% CO2 humidified atmosphere. The dose of each cytokine used in this study was chosen based on the available literature (Pietr et al. 2009; Dohi et al. 2010; Liu et al. 2010; Soria et al. 2011). Rabbit anti-mouse PrPC (AH6) and β-actin antibodies were acquired from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and Beyotime Biotechnology (Wuhan, Hubei, China), respectively. All experiments were performed for three times.

Small interfering RNA transfections and treatments

PRNP-targeting Small interfering (si) RNA was used to down-regulate PRNP expression, and non-related scrambled siRNA sequence (Table 1) was used as a control (Darmacon, Lafayette, CO, USA). For siRNA transfection, cells were plated at 0.7 ×  105 cells/well in a 12-well plate, and transfected the next day in accordance with the manufacturer's instructions. Briefly, on the day of transfection, 5 μM siRNA was diluted in siNRA buffer. In separate tubes, the siRNA and the appropriate DharmaFECT transfection reagent were diluted with serum-free medium. The tube was gently mixed by pipetting carefully, incubated for 5 min at 20°C, and then mixed for a total volume of 200 μL. After 20 min incubation at 20°C, the mixed solution was added to 800 μL of antibiotic-free complete medium. Culture medium from the wells of the 12 well plate was removed, and 1 mL of the appropriate transfection medium was added to each well. The final concentration of siRNA was 25 nM. The efficiency of siRNA-mediated disruption was evaluated 30 h and 48 h after siRNA transfection by quantitative PCR and western blot analysis, respectively.

Table 1. Sequences of PRNP-targeting siRNA and scramble siRNA
NameSequence (5′[RIGHTWARDS ARROW]3′)
PRNP-mediated siRNA: 
Target Sequence 1:GUGACUAUGUGGACUGAUGdTdT
Target Sequence 2:GUGCACGACUGCGUCAAUAdTdT
Target Sequence 3:GUGAAAACAUGUACCGCUAdTdT
Target Sequence 4:GCAGGCCCAUGGUCCAUUUdTdT
Scramble siRNA:

CGAACGAGUACCGUACACUdTdT

AGUGUACGGUACUCGUUCGdTdT

RNA isolation, complementary DNA synthesis, and quantitative PCR

Total RNA was extracted using the SV Total RNA Isolation System (Promega, Madison, WI, USA), and reverse transcribed into cDNA using cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, USA) in accordance with the manufacturer's instructions, in a final volume of 20 μL, containing RNA template (1 μg), dNTP's (0.5 mM), oligo-dT primers (1 μM), RT buffer and nuclease-free water. Mixture was incubated 60 min at 42°C and enzyme was inactivated at 70°C for 5 min.

Quantitative PCR (qPCR) was performed using SYBR Green Ι Master Mix (Bio-Rad, Hercules, CA, USA) and a thermal cycler (DNA Engine Opticon 2 system; MJ Research, Waltham, MA, USA) with the primers shown in Table 2. The qPCR amplification reaction was performed in a final volume of 20 μL, containing 10 μL Master Mix, 0.5 μL of each primer (10 μmol/L), 30 ng of cDNA and water added to 20 μL. The qPCR amplification was as follows: after denaturation at 94°C for 2 min, 40 PCR cycles of 94°C for 5 s, 57°C or 59°C for 20 s, 72°C for 30 s, followed by 1 cycle at 84°C for 1 s appended for a single fluorescence measurement above the melting temperature of possible primer-dimers. Finally, a melting step was performed consisting of 10 s at 70°C and slow heating at a rate of 0.1 per second up to 100°C with continuous fluorescence measurement. Quantification was performed using the comparative CT method (2−ΔΔCT) (Wong and Medrano 2005). All samples were analyzed in triplicate.

Table 2. Primers used for quantitative PCR
NameSequence (5′[RIGHTWARDS ARROW]3′)
Arg1GCATATCTGCCAAAGACATCG
CCATCACCTTGCCAATCCC
Mrc1GCAGTGGGCTGGAGGAA
TGCTGAGGGAATGATAAATGG
TNF-αCCCTTCCTCCGATGGCTAC
CGCCTCCTTCTTGTTCTGG
NOS2GAGCGAGTTGTGGATTGTC
GGCAGCCTCTTGTCTTTG
PrPATCGGTGGCAGGACTC
CCAGTAGCCAAGGTTCG
NALP3TCGCAGCAAAGATCCACACAG
ATTACCCGCCCGAGAAAGG
ASCCTGGTCCACAAAGTGTCCTG
GCAACTGCGAGAAGGCTAT
SOCS3GAGATTTCGCTTCGGGACT
GCTGAGCAGCAGGTTCG
IL-4RαCCCAGTGGTAATGTGAAGC
TCCAGGTGCCAGTGAGTA
β-actinCCTTCTGACCCATTCCCACC
GCTTCTTTGCAGCTCCTTCG

Extraction of cytoplasmic protein and western blotting

After siRNA transfection, the cell culture medium was discarded, and the cytoplasmic proteins were extracted using a protein extract kit (Cytoplasmic and Nuclear Protein Extraction Kit; Wuhan Boster Biotech, Wuhan, Hubei, China). Each lane was loaded with 50 μg protein, and proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis on 12% gels. The separated proteins were transferred onto a nitrocellulose membrane. Non-specific binding sites were blocked with 5% fat-free dried milk in Tris-buffered saline (TBST: 10 mmol/L Tris, 0.15 mol/L NaCl, 0.05% Tween-20, pH of the solution adjusted to 7.5). Rabbit anti-PrPC was added and incubated at 4°C overnight. Membranes were washed with TBST, and then incubated with the secondary antibody, goat anti-rabbit IgG horseradish peroxidase-conjugated antibody (1 : 6000). Bands of immunoreactive protein were visualized after membrane incubation with enhanced chemifluorescence (ECF) reagent for 5 min, on an image system (Versadoc, Bio-Rad, Hercules, CA, USA). The blot was stripped and reprobed with anti-β-actin to estimate the total amount of protein loaded in gel.

Statistical analysis

Each experiment was done on three separate occasions. Results are expressed as means ± SD. All comparisons of data were made using one-way anova followed by post-hoc Turkey's test or Student's t-test. SPSS software (Chicago, IL, USA) was used, and < 0.05 was considered significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Microglial activation led to the downregulation of PRNP mRNA expression in microglia

To examine the role of PrPC in microglial activation, we first examined the expression pattern of PRNP in microglia submitted to three different treatments with cytokines known to stimulate different phenotypes of microglial activation.

As shown in Fig. 1, the mRNA expression of PRNP was invariably down-regulated upon exposure to IFN-γ, IL-4, or IL-10. The down-regulation was time dependent, with the most pronounced effect observed 24-post-treatment for each of the three cytokines.

image

Figure 1. Time course of PRNP mRNA expression upon exposure to IFN-γ, IL-4, or IL-10 in BV2 microglia. Cells were treated with IFN-γ, IL-4, or IL-10 (200 U/mL, 20 ng/mL, or 20 ng/mL, respectively) for three different time periods (6 h, 12 h, and 24 h). Total mRNA was isolated and reverse transcribed. The mRNA level of PRNP was measured by qPCR. Expression of PRNP at each time point is expressed as fold change relative to the mRNA level in control cells exposed to phosphate-buffered saline (PBS) only. All data are mean ± SD of triplicate samples and are representative of an experimental n of 3 or 4. *p < 0.05.

Download figure to PowerPoint

PRNP disruption reduced the responsiveness of microglia to IFN-γ stimulation

To investigate the role of PrPC in classical microglial activation, we analyzed the effect of si-RNA-mediated PRNP disruption on IFN-γ-induced microglial activation. The efficiency of siRNA-mediated disruption was evaluated 30 h and 48 h after siRNA transfection by quantitative PCR (Fig. 2a) and western blot analysis (Fig. 2b), respectively. The expression of PRNP was significantly down-regulated (p < 0.05) both at mRNA (70%) and protein levels upon siRNA transfection.

image

Figure 2. Silencing of cellular prion protein. BV2 cells were transfected with either control non-targeting siRNA (N-si) or PRNP -targeting siRNA (PrP-si). (a) Quantitative PCR analysis of PRNP mRNA expression in BV2 microglia upon transfection. (b) Western blot analysis of the prion protein expression in BV2 cells upon transfection. *p < 0.05, significantly different from control under the same experimental conditions.

Download figure to PowerPoint

Stimulation of microglia with interferon gamma (IFN-γ) is known to induce multiple cytoactive factors such as TNF-α, NO and IL-1, which serve as markers of the classical activation of microglia (Gordon 2003; Mosser 2003; Colton 2009). In this study, we investigated the effect of PRNP down-regulation on IFN-γ-induced microglial classical activation by examining its effect on the expression of TNF-α, NO, and IL-1β. The latter was indirectly examined by examining the expression of NALP3 and ASC, which are the two major components of the molecular platform responsible for the activation of IL-1β, known as inflammasome (Franchi et al. 2009; Martinon et al. 2009; Latz 2010; Schroder and Tschopp 2010; Davis et al. 2011).

Treatment with 200 U/mL IFN-γ for 24 h significantly up-regulated the mRNA level of TNF-α and NOS2 in BV2 microglia, with 9.2- and 321-fold increase over control, respectively (Fig. 3a).

image

Figure 3. Effect of PRNP down-regulation on IFN-γ-induced microglial activation. Cells were first transfected or not with PRNP-targeting siRNA and then treated with 20 ng/mL IFN-γ for 24 h. Total mRNA was isolated and reverse transcribed. Quantitative PCR was used to determine TNF-α and NOS2 mRNA level in intact (a) or PRNP-disrupted BV2 microglia (b). The mRNA level of each cytokine is expressed as fold change compared with control cells which were exposed to phosphate-buffered saline (PBS) only. Data are means ± SD of triplicate samples *< 0.05.

Download figure to PowerPoint

The siRNA-mediated disruption of PRNP prior to IFN-γ treatment significantly reduced the responsiveness of microglia to IFN-γ, as indicated by the lower fold increase in TNF-α and NOS2 mRNA level in PRNP-disrupted cells compared with that in intact cells (Fig. 3b). It similarly reduced the extent of IFN-γ-induced up-regulation of the mRNA level of NALP3 and ASC (Fig. 4).

image

Figure 4. Effect of PRNP down-regulation on the mRNA expression of NACHT, LRR, and PYD domains-containing protein 3 (NALP3) and apoptosis-associated speck-like protein (ASC) in IFN-γ-induced microglia. Cells were first transfected or not with PRNP-targeting siRNA and then treated with 200 U/mL IFN-γ for 24 h. Total mRNA was isolated and reversetranscribed. The mRNA levels of NALP3 and ASC were measured by Quantitative PCR and are expressed as fold change relative to the mRNA level in control cells exposed to phosphate-buffered saline (PBS) only. Data are means ± SD of triplicate samples, *< 0.05.

Download figure to PowerPoint

Importantly, the siRNA-mediated silencing of PRNP, though it reduced the responsiveness of microglia to IFN-γ, did not alter the resulting activation phenotype since the mRNA level of the studied pro-inflammatory cytokines was significantly higher in PRNP-disrupted microglia treated with IFN-γ than in intact microglia treated with phosphate-buffered saline (PBS).

PRNP disruption alters the IL-4 induced microglial activation phenotype

Stimulation of peripheral macrophages and microglia with IL-4 is known to antagonize pro-inflammatory classical activation and to induce alternative activation associated with tissue repair and reconstruction. Alternatively, activated macrophages and microglia are characterized both by the absence and by the presence of specific genes whose expression levels change during the switch from a pro-inflammatory to an anti-inflammatory state after injury or infection. Up-regulation of mannose receptor (Mrc1) and arginase 1 (Arg1) and lack of NOS2 are characteristic features of microglial alternative activation (Mosser 2003; Colton 2009; Martinez et al. 2009; Latz 2010). We therefore examined the effect of PRNP silencing on the expression of these three factors in IL-4 induced microglia.

Not surprisingly, IL-4 treatment significantly up-regulated the mRNA level of Mrc1 and Arg1 (2.1- and 3.3-fold increase, respectively) and down-regulated the expression of NOS2 (48%, Fig. 5a).

image

Figure 5. Effect of PRNP down-regulation on IL-4-induced microglial activation. Cells were first transfected or not with PRNP-targeting siRNA and then treated with 20 ng/mL IL-4 for 24 h. The mRNA levels of Arg1, Mrc1, and NOS2 in intact (a) or PRNP-disrupted BV2 microglia (b) were measured by quantitative PCR, and are expressed as fold change compared with control cells which were exposed to phosphate-buffered saline (PBS) only. Data are means ± SD of triplicate samples. *< 0.05.

Download figure to PowerPoint

The si-RNA-mediated PRNP disruption significantly abrogated IL-4-induced up-regulation of Mrc1 and Arg1, (72% and 59% lower than in IL-4-stimulated-intact cells, respectively), and significantly up-regulated NOS2 (fivefold increase compared with IL-4-stimulated-intact cells, Fig. 5b).

PRNP disruption does not have a significant effect on IL-10-induced microglial activation phenotype

Exposure to IL-10 has been linked to a newly described form of macrophage and microglial activation characterized by immuno-suppression, inhibition of pro-inflammatory, and increased expression of scavenger receptors. Interleukin-4 receptor α (IL-4Rα), and suppressor of cytokine signaling 3 (SOCS3) have been identified as specific markers of IL-10-induced-microglial activation phenotype known as acquired deactivation (Gordon 2003; Garden and Möller 2006).

Our results showed that treatment with IL-10 significantly up-regulated the expression of IL-4Rα and SOCS3 in microglia (2.3- and 3.5-fold increase, respectively, Fig. 6a). Interestingly, The si-RNA-mediated PRNP disruption slightly but not significantly amplified the IL-10-induced up-regulation of IL-4Rα and SOCS3 (Fig. 6b).

image

Figure 6. Effect of PRNP down-regulation on IL-10-induced microglial activation. Cells were first transfected or not with PRNP-targeting siRNA and then treated with 20 ng/mL IL-10 for 24 h. The mRNA levels of suppressor of cytokine signaling 3 (SOCS3) and IL-4Rα in intact (a) or PRNP-disrupted BV2 microglia (b) were measured by quantitative PCR, and are expressed as fold change compared with control cells which were exposed to phosphate-buffered saline (PBS) only. Data are means ± SD of triplicate samples. n.s., no significant. *< 0.05.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

To clarify the role of PrPC during different phases of neuroinflammatory response, we submitted microglia to three different treatments with cytokines known to stimulate different phenotypes of microglial activation. We then examined the effect of each treatment on the expression of PRNP, and the effect of PRNP down-regulation on the stimulated phenotypes.

We found (i) that various phenotypes of microglial activation are invariably accompanied with PRNP down-regulation; (ii) that PRNP disruption prior to microglial treatment reduced microglia responsiveness to IFN-γ stimulation, altered IL4-induced phenotype of microglial activation, and had no significant effect on IL-10-induced phenotype.

The first finding suggests that PrPC may be directly involved in the maintenance of microglia in quiescent state, and that the down-regulation of PRNP would be necessary for the shift of microglia from a quiescent to an activated state. This interpretation is consistent with recent findings in our lab, which showed a PRNP down-regulation in LPS-stimulated microglia (R. Tan, M. Kouadir, unpublished results). It is also compatible with the well-known neuroprotective function of prion protein, for the involvement of prion protein in the maintenance of microglia activation may indirectly help to protect against the neurotoxic factors released during microglial activation.

However, our results on the effect of si-RNA-mediated disruption of PRNP on the stimulation of different phenotypes of microglial activation suggest that PrPC role may not be limited to regulate the shift of microglia from quiescent to activated state, and that its role goes beyond that by an active participation in the regulation of microglia during the activation process.

As introduced above, various microglial activation phenotypes have been described including classical activation, alternative activation, and acquired deactivation (Garden and Möller 2006).

The classical activation corresponds to the first phase, also known as the killing phase, of an innate immune response to acute stimuli and is characterized by the induction of a specific gene profile and the subsequent production of multiple cytoactive factors such as TNF-α, NO and IL-1 that protect against tissue invaders (Adams and Hamilton 1984; Hume et al. 2002; Nguyen et al. 2002; Nimmerjahn et al. 2005; Colton 2009). It is also characterized by the involvement of interferon gamma (IFN-γ), a cytokine produced by Th-1 that coordinates induction signals by initiation of the “killing” phase of macrophage and microglial activation (Franchi et al. 2009; Davis et al. 2011). In this study, we showed that PRNP disruption reduced the responsiveness of microglia to IFN-γ stimulation, as indicated by the resulting down-regulation of the mRNA expression of the four parameters examined. Although the reduced responsiveness of PRNP-disrupted microglia to IFN-γ stimulation may suggest a possible regulatory role of PrPC during IFN-γ-induced classical activation, these results are inconclusive asIFN-γ-induced microglial activation phenotype was not altered by si-RNA-mediated disruption of PRNP, making it difficult to draw any conclusion regarding the function of prion protein in the context of IFN-γ-induced classical activation of microglia.

The most interesting effect of PRNP disruption was observed in the context of IL-4-induced microglial alternative activation. IL-4 stimulation is known to induce a specific gene profile, which provides an anti-inflammatory balance to an acute, pro-inflammatory response, and is involved in tissue repair and extracellular matrix remodeling (Nimmerjahn et al. 2005; Franchi et al. 2009; Davis et al. 2011). Our results showed that PRNP disruption, by down-regulating the expression of Mrc1 and Arg1 and up-regulating the mRNA of NOS2, significantly alters the IL-4-induced microglial activation phenotype, suggesting that prion protein actively participates in the signaling pathways that lead to IL-4-induced alternative activation in microglia. As neurodegenerative diseases, such as Alzheimer diseases, are characterized by coexpression of alternative activation and classical activation (Colton et al. 2006; Colton 2009), our results suggest that prion protein may be involved in the regulation of the balance between the opposite poles of pro-inflammation and increased self-toxicity and anti-inflammation and longer tissue survival in activated microglia in neurodegenerative diseases. Although more studies are needed to confirm this initial finding, and to elucidate the mechanisms of the participation prion protein in microglial alternative activation, our results may open new avenue for the modulation of microglia-associated neuroinflammation during neurodegenerative diseases through the modulation of the function of prion protein.

We finally showed that PRNP disruption does not affect IL-10-induced activation phenotype in microglia, suggesting that prion protein may not have a key role in the biological events associated with the acquired deactivation phenotype in microglia.

In conclusion, our results suggest that PrPC may have a dual regulatory role by modulating the shift of microglia from a quiescent state to an activated one, and by regulating the balance between the opposite poles of pro-inflammation and increased self-toxicity and anti-inflammation and longer tissue survival in activated microglia.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This work was supported by the Natural Science Foundation of China (Project No. 31001048 and No. 31172293), Specialized Research Fund for the Doctoral Program of Higher Education and (SRFDP,Project No. 20100008120002), the Foundation of Chinese Ministry of Science and Technology (Project No. 2011BAI15B01), and the Program for Cheung Kong Scholars and Innovative Research Team in University of China (No. IRT0866). FSS LFY and MK conceived and designed the experiments; FSS, YY, TJD, and JHW performed the experiments; FSS and MK analyzed the data; XMZ, XMY, and DMZ contributed reagents/materials. These authors declare no conflicts of interest.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References