SEARCH

SEARCH BY CITATION

Keywords:

  • amyotrophic lateral sclerosis;
  • NF-κB;
  • optineurin

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
Thumbnail image of graphical abstract

Mutations in more than 10 genes are reported to cause familial amyotrophic lateral sclerosis (ALS). Among these genes, optineurin (OPTN) is virtually the only gene that is considered to cause classical ALS by a loss-of-function mutation. Wild-type optineurin (OPTNWT) suppresses nuclear factor-kappa B (NF-κB) activity, but the ALS-causing mutant OPTN is unable to suppress NF-κB activity. Therefore, we knocked down OPTN in neuronal cells and examined the resulting NF-κB activity and phenotype. First, we confirmed the loss of the endogenous OPTN expression after siRNA treatment and found that NF-κB activity was increased in OPTN-knockdown cells. Next, we found that OPTN knockdown caused neuronal cell death. Then, overexpression of OPTNWT or OPTNE50K with intact NF-κB-suppressive activity, but not overexpression of ALS-related OPTN mutants, suppressed the neuronal death induced by OPTN knockdown. This neuronal cell death was inhibited by withaferin A, which selectively inhibits NF-κB activation. Lastly, involvement of the mitochondrial proapoptotic pathway was suggested for neuronal death induced by OPTN knockdown. Taken together, these results indicate that inappropriate NF-κB activation is the pathogenic mechanism underlying OPTN mutation-related ALS.

Among the genes for typical amyotrophic lateral sclerosis (ALS) phenotypes, optineurin (OPTN) is virtually the only gene in which a loss-of-function mutation is considered as the principal disease mechanism. We found that OPTN knockdown induced neuronal cell death via NF-κB activation. Furthermore, proapoptotic molecules such as p53 and Bax representing downstream targets of NF-κB are suggested to be involved in neuronal death.

Abbreviations used
ALS

amyotrophic lateral sclerosis

FUS

fused in sarcoma

OPTN

optineurin

POAG

primary open-angle glaucoma

TDP-43

Tar DNA-binding protein 43

Amyotrophic lateral sclerosis (ALS) is an adult-onset neurodegenerative disorder characterized by the progressive degeneration of motor neurons in the brain and spinal cord. The cause of sporadic ALS is unknown, and there is no effective therapy. Approximately 10% of ALS cases are familial. In 1993, superoxide dismutase 1 (SOD1) was identified as the responsible gene for some cases of familial ALS (Rosen et al. 1993); since then, many other causative genes have been reported, such as TAR DNA-binding protein 43 (TDP-43), fused in sarcoma (FUS)/translocated in liposarcomas (TLS), optineurin (OPTN), C9ORF72, and profilin 1. More than 10 genes that cause familial ALS have been identified; however, among the genes for typical ALS phenotypes, OPTN is virtually the only gene in which a loss-of-function mutation is considered the principal disease mechanism.

OPTN mutations, including a homozygous deletion, a homozygous nonsense mutation, and a heterozygous missense mutation, were initially identified in Japanese ALS families (Maruyama et al. 2010). OPTN mutations have since been reported in ALS patients from many countries, especially in Europe (Belzil et al. 2011; Del Bo et al. 2011; Millecamps et al. 2011; Tumer et al. 2012).

OPTN is involved in basic cellular functions including protein trafficking, maintenance of the Golgi apparatus (Sahlender et al. 2005), and the NF-κB pathway, and ALS-related OPTN mutants were unable to suppress NF-κB activity in cultured cells (Maruyama et al. 2010). OPTN is colocalized with inclusions in motor neurons of sporadic ALS patients as well as in SOD1-, TDP-43-, or FUS-positive inclusions (Ito et al. 2011). Therefore, OPTN could function in a common pathway for ALS pathogenesis. OPTN is also colocalized with inclusion bodies in other neurodegenerative diseases such as Alzheimer's disease and Creutzfeldt-Jakob disease, suggesting its involvement in a variety of neurodegenerative processes (Osawa et al. 2011).

Recently, it was reported that the mRNA and protein levels of the p65 subunit of NF-κB are increased in the spinal cords of sporadic ALS patients and that TDP-43, which is a major pathological protein in sporadic ALS, increases the activity of NF-κB in vitro (Swarup et al. 2011).

In this study, we examined the effect of OPTN knockdown by siRNA in neuronal cells in terms of the NF-κB activity and cell viability. We also investigated the molecules downstream of NF-κB.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell culture and western blot analysis

Neuro2a cells, which are mouse neuroblastoma cells, were propagated in Dulbecco's modified Eagle's minimal essential medium (DMEM) supplemented with 10% fetal bovine serum. Neuro2a cells were cultured and collected 72 h after OPTN siRNA transfection and dissolved with lysis buffer [50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM EDTA, 1% TritonX, 10% glycerol, complete mini protease inhibitor (Roche, Basel, Switzerland)]. Insoluble material was removed by centrifugation at 20 400 g for 15 min. Protein concentration was determined by BCA assay (Cat No. 1859701; Thermo Scientific, Waltham, MA, USA). Supernatants of lysates (20 μg) with 2× sodium dodecyl sulfate (SDS) sample buffer [250 mM Tris-HCl (pH 6.8), 8% SDS, 10% glycerol, 0.02% BPB, 10% 2-ME] were separated on a 12% SDS-PAGE gel and transferred to a polyvinylidene difluoride membrane (Cat No. IPVH00010; Millipore, Billerica, MA, USA) . The membrane was incubated overnight at 4°C with anti-OPTN-C antibody (Cat No. 100000; Cayman Chemical, Ann Arbor, MI, USA) and anti-β-actin antibody (Cat No. A5441; Sigma, St. Louis, MO, USA). After washing with 1× TBST, the membrane was incubated with the secondary antibody [anti-rabbit horseradish peroxidase-conjugated antibody (Cat No. 32460) and anti-mouse horseradish peroxidase-conjugated antibody (Cat No. 32430); Pierce, Rockford, IL, USA) ]. Protein bands were visualized using detection reagent (Cat No. 1859701; Thermo Scientific).

RNA interference

The siRNAs were designed against murine OPTN mRNA (Gen Bank accession no. NM_181848.4). The sequence of the OPTN siRNA was 5′-GGAAACACUGAGCAUUCAATT-3′ and 5′-UUGAAUGCUCAGUGUUUCCTT-3′. The sequence of the control siRNA does not correspond to any known mRNA sequence. Cells were plated in 12-well plates at 25 to 40% confluency and transfected with siRNAs by using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.

Plasmids and transfection

Four types of complementary DNA (cDNA) of OPTN (OPTNWT, OPTNQ398X, OPTNE478G, OPTNE50K) were inserted into pcDNA3 vector (Sigma). Empty pcDNA3 vector was used for mock transfection. Cells were transfected by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

Luciferase reporter assay

NF-κB activity was measured by Luciferase reporter assay. NF-κB reporter plasmid [(Igκ)3 conA-luc plasmid] has been described previously (Le Bail et al. 1993). The reporter plasmid was transfected 24 h after OPTN siRNA or control siRNA transfection. NF-κB activity was measured 48 h after transfection of reporter plasmid by using the Dual Luciferase Reporter Assay System (Cat No. E1910; Promega, Fitchburg, WI, USA). TNFα (Cat No. 315-01A; PeproTech, Rocky Hill, NJ, USA) 50 ng/mL was added to the cell cultures 5 h before measurement of NF-κB activity.

Live cell count assay

After aspiration of the floating dead cells, live Neuro2a cells were collected into a microtube, and the cells were counted using a Scepter handheld automated cell counter (Millipore).

Trypan blue assay

Seventy-two hours after siRNA transfection, all of the Neuro2a cells including the dead cells were collected, and trypan blue dye (Cat No. T8154; Sigma) was added. Then, the stained cells were counted with a microscope. Withaferin A (Cat No. BML-CT104-0010; Enzo Life Sciences, Farmingdale, NY, USA) was added to the medium 48 h before collecting the cells.

Rescue experiment

The siRNA (blank, control siRNA, OPTN siRNA) and the vector (empty vector, GFP, OPTNWT, OPTNQ398X, OPTNE478G, OPTNE50K) were co-transfected into the Neuro2a cells by using Lipofectamine 2000 (Invitrogen). The medium was changed 6 h after transfection. To estimate cell viability, we performed a trypan blue assay 72 h after transfection.

Quantitative real-time RT-PCR

Total RNA was extracted from cell culture using TriPure Isolation Reagent (No93876720; Roche) according to the manufacturer's instructions. The total RNA was treated with DNase (Qiagen, Valencia, CA, USA) to remove genomic DNA contamination. Quantitative real-time RT-PCR was performed with a LightCycler 480 (Roche) sequence detection system using LightCycler SYBR green 1. β-actin was used as an internal control. The following primers were used in the reactions: Bax, forward: GACA GGGGCCTTTTTGCTA, reverse: TGTCCACGTCAGCAATC ATC; Bcl2 l-1, forward: GGTCGCATCGTGGCCTTT, reverse: TCCGACTCACCAATACCTGCAT; MnSOD, forward: GCTGCACCACAGCAAGCA, reverse: TCGGTGGCGTTGAGATTGT; Myc, forward: TGAGCCCCTAGTGCTGCAT, reverse: AGC CCGACTCCGACCTCTT; p53, forward: TGAAACGCCGACCT ATCCTTA, reverse: GGCACAAACACGAACCTCAAA; TNFα, forward: CCAGACCCTCACACTCAGATCATC, reverse: CCTTGAAGAGAACCTGGGAGTAGAC; β-actin, forward: TGTTA CCAACTGGGACGA, reverse: GGGGTGTTGAAGGTCTC AAA.

Statistical analysis

All data are expressed as mean and SE. Statistical significance was assessed by one-way anova followed by Tukey's multiple comparison test, with the exception of the results in Fig. 3b and Fig. 4, for which the unpaired t-test was used. Statistical analyses were conducted with GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA), and statistical significance was set at a probability value of less than 0.05.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

OPTN knockdown increased the NF-κB activity

One of the pathological mechanisms of familial ALS is a loss-of-function mutation in OPTN. To investigate the effect of OPTN suppression on neuronal cells, we knocked down endogenous OPTN by using siRNA in a mouse neuroblastoma cell line, Neuro2a. Cell lysates were collected after OPTN siRNA transfection and subjected to western blot analysis. We successfully knocked down OPTN 48–72 h after OPTN siRNA transfection (Fig. 1a).

image

Figure 1. Elevation of NF-κB activity by optineurin (OPTN) knockdown. (a) Western blot analysis of OPTN-knockdown cell lysates. Cell lysates of Neuro2a cells were collected 48 and 72 h after OPTN siRNA or control siRNA transfection. OPTN was successfully knocked down both 48 and 72 h after transfection. (b) Luciferase activity of OPTN siRNA or OPTN plasmid-transfected cells. Luciferase activity of OPTN siRNA-transfected cells was increased compared with control siRNA. (*p < 0.05, **p < 0.01).

Download figure to PowerPoint

We investigated the NF-κB activity in OPTN-knockdown cells and found that the NF-κB activity was increased in these cells (Fig. 1b). Thus, the inhibition of NF-κB activity by endogenous OPTN was lost by OPTN knockdown. OPTNWT and glaucoma-causing mutant OPTNE50K tend to inhibit NF-κB activity, whereas ALS-causing mutant OPTNQ398X lacks these effects, which is consistent with previous reports (Maruyama et al. 2010).

After 6 h of TNFα stimulation, NF-κB activity was further increased by OPTN knockdown.

Cell death was induced by OPTN knockdown

OPTN knockdown significantly decreased cell density (Fig. 2a). The number of live cells 72 h after OPTN knockdown was significantly decreased to 2.47 ± 0.18 × 105/mL, while the number of live cells treated with control siRNA was 4.67 ± 0.11 × 105/mL (Fig. 2b). To measure the number of dead cells, we performed a trypan blue assay. At 72 h after OPTN knockdown, there were 7.3% dead cells, which was significantly greater than the 2.3% dead cells in the control siRNA cells (Fig. 2c).

image

Figure 2. Cell death induced by optineurin (OPTN) knockdown, which was suppressed by over-expression of OPTNWT or OPTNE50K. (a) Phase contrast images of Neuro2a cells after siRNA transfection. Many floating cells (dead cells) existed 72 h after OPTN siRNA transfection. The live cell density with OPTN siRNA was significantly lower than that with control siRNA. Scale bar: 100 μm. (b) Live cell counts 72 h after siRNA transfection. Live cells with OPTN siRNA were decreased as compared to those with control siRNA. (**p < 0.01). (c) Trypan blue assay after control or OPTN siRNA transfection. Cell death was induced 72 h after OPTN siRNA transfection. (*p < 0.05). (d) Trypan blue assay 72 h after simultaneous transfection of OPTN siRNA and human wild-type or mutant OPTN expression vectors. OPTNWT and OPTNE50K expression rescued the cell death induced by mouse endogenous OPTN knockdown, while mock, GFP and OPTNQ398X did not (**p < 0.01). OPTNE478G had partial rescue activity.

Download figure to PowerPoint

Over-expression of wild-type OPTN could rescue cell death induced by OPTN knockdown

Next, we examined whether the cell death induced by mouse endogenous OPTN knockdown would be suppressed by human wild-type or mutant OPTN transfection. We evaluated the cell death rate by trypan blue assay 72 h after the simultaneous transfection of OPTN siRNA and human wild-type or mutant OPTN expression vectors.

We expressed GFP as a negative control, and we examined the effect of expression of OPTNWT, two ALS-causing mutants, OPTNQ398X and OPTNE478G, and the primary open-angle glaucoma (POAG)-causing mutant, OPTNE50K.

OPTNWT and the POAG-causing mutant, OPTNE50K, rescued the cell death induced by endogenous OPTN knockdown, while ALS-causing mutant OPTNQ398X, as well as mock (empty vector) and GFP, did not rescue cell death (Fig. 2d). OPTNE478G had partial rescue potential, which might be because of the possible gain of toxic function to cause ALS by OPTNE478G protein.

NF-κB inhibition by withaferin A treatment reduced cell death after OPTN knockdown

To determine if the cell death induced by OPTN deletion was related to NF-κB activation, we measured the cell viability after treatment with withaferin A, which selectively inhibits NF-κB activity. We first measured the NF-κB activity in Neuro2a cells 48 h after treatment with different concentrations of withaferin A. Withaferin A inhibited NF-κB activity in a dose-dependent manner, and the concentration of withaferin A that fully suppressed NF-κB activity was 0.5 μg/mL (data not shown).

Withaferin A or vehicle (dimethylsulfoxide) was added to Neuro2a cell cultures 24 h after OPTN siRNA transfection, and the NF-κB activity was examined 48 h after the addition of vehicle or withaferin A at the concentration of 0.5 μg/mL. We confirmed that NF-κB activity was suppressed in all groups (blank, control siRNA, and OPTN siRNA) after withaferin A treatment (Fig. 3a).

image

Figure 3. Withaferin A inhibited the cell death induced by optineurin (OPTN) knockdown. (a) NF-κB activity in Neuro2a cells 72 h after siRNAs transfection and 48 h after treatment with withaferin A at the concentration of 0.5 μg/mL. Withaferin A fully inhibited the NF-κB activity at all groups. (b) Trypan blue assay of Neuro2a cells 72 h after siRNAs transfection and 48 h after treatment with withaferin A. Withaferin A treatment suppressed the cell death caused by OPTN knockdown. (*p < 0.05).

Download figure to PowerPoint

Next, we performed a trypan blue assay 48 h after the addition of withaferin A. Interestingly, withaferin A treatment suppressed the cell death caused by OPTN knockdown (Fig. 3b). In OPTN-knockdown cells, the percentage of dead cells after vehicle treatment was 7.2%, while the percentage of dead cells after withaferin A treatment was 2.4%. These results indicate that the cell death after OPTN deletion was induced by NF-κB activation.

mRNA level of NF-κB target genes, p53 and TNFα, was increased after OPTN knockdown

Our results showed that the deletion of OPTN caused neuronal cell death via the NF-κB pathway. Therefore, we searched for alterations in the mRNA level of the NF-κB-regulated genes when OPTN was knocked down. Referring to the review by Clemens (Clemens 2000), we chose the NF-κB-regulated genes that were involved in cell death and survival, and we examined these mRNA levels 72 h after OPTN knockdown. The mRNA levels of p53 and TNFα were significantly increased by OPTN knockdown. The mRNA levels of Bax, Bcl2 l-1 and MnSOD also tended to increase by OPTN knockdown (Fig. 4).

image

Figure 4. mRNA level of NF-κB target genes was increased after optineurin (OPTN) knockdown. The mRNA levels in Neuro2a cells 72 h after OPTN knock down. The mRNA level of NF-κB target genes, p53 and TNFα, was significantly increased (**p < 0.01). The mRNA levels of Bax, Bcl2 l-1, and MnSOD had a tendency to increase.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Different mutations in OPTN cause two different diseases: ALS, which results from motor neuron death, and normal pressure glaucoma, a subset of POAG (Rezaie et al. 2002), which results from the loss of retinal ganglion cells. Identification of the exact mechanisms discriminating the two allelic disorders is challenging. Based on the previous report showing that over-expression of OPTNE50K leads to retinal degeneration in mice (Chi et al. 2010), it appears that the death of RGCs by OPTNE50K, which is the most common mutation in POAG, is caused by the gain of toxic functions. However, we think that ALS is caused by the loss of OPTN function for two reasons. First, the ALS-related Q398X mutation of OPTN scarcely expresses protein because of nonsense-mediated mRNA decay. Secondly, several large deletion mutations of OPTN expected to result in null alleles were reported (Osawa et al. 2011). While there are several precedent works on OPTN knockdown in RGCs (Li et al. 2011; Sippl et al. 2011), these might not be an appropriate model for POAG, and we believe that OPTN knockdown in neuronal cells reflects pathophysiological conditions in ALS. Therefore, we used Neuro2a cells, a model cell line of motor neurons in ALS research, even though Neruo2a cells are immortal and, in some settings, the results of experiments with these cells should be carefully interpreted (LePage et al. 2005).

OPTN knockdown in mouse neuroblastoma cells increased the NF-κB activity, and cell death was induced in OPTN-knockdown cells. The rate of live cell loss was larger than the dead cell count after OPTN knockdown. There are two reasons for this apparent discrepancy. First, the trypan blue assay counts only morphologically discernible dead cells, not degraded or fragmented cell debris. Thus, the trypan blue assay might underestimate the number of dead cells. Secondly, as OPTN affects cell growth in RGC-5 cells and PC-12 cells (Li et al. 2011), the results might reflect both the cell death and the slow growth rate of Neuro2a cells.

ALS-related OPTN mutants increased NF-κB activity, but it is unknown whether increased NF-κB activity is the direct cause of the neuronal death caused by OPTN mutants. Our experiments with withaferin A clearly showed that NF-κB works in the pathway for OPTN-induced neuronal death.

NF-κB is a transcription factor that regulates hundreds of genes involved in innate immunity, cell survival and death, and inflammation, and it is involved in the production of many cytokines. We examined the NF-κB-regulated genes that were involved in cell death and survival to determine how OPTN deletion leads to neuronal death. As a result, we found that the mRNA levels of p53 and TNFα were significantly up-regulated after OPTN knockdown.

p53 is a tumor suppressor and regulates apoptosis. p53 is abnormally elevated in central nervous system lesions in sporadic ALS (Martin 2000). p53 regulates the expression of proteins found in the intrinsic mitochondrial death pathway, transcriptionally activating pro-apoptotic genes such as Bax (Miyashita and Reed 1995). We also found a tendency for Bax up-regulation after OPTN knockdown. In mutant SOD1 transgenic mice, a mouse model of ALS, Bax deletion protects motor neuron death (Gould et al. 2006). Therefore, we speculate that up-regulation of NF-κB activity after OPTN knockdown induces neuronal death via the p53-dependent mitochondrial death pathway.

TNFα is a pro-inflammatory cytokine and is increased in the blood of patients with sporadic ALS (Poloni et al. 2000). In spinal cords of mutant SOD1 transgenic mice, the mRNA and protein levels of TNFα are increased, suggesting neuroinflammation involvement for motor neuron death (Yoshihara et al. 2002; Hensley et al. 2003). The mRNA level of TNFα was up-regulated after OPTN knockdown, which may reflect neuroinflammation in vivo.

In this study, we found that neuronal cell death was induced by OPTN knockdown, which lead to NF-κB activation. Proapoptotic molecules such as p53 and Bax representing downstream targets of NF-κB are suggested to be involved in neuronal death. These results suggest that NF-κB suppression is a promising strategy for the treatment of ALS.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We thank Dr. Shoji Yamaoka for the generous gift of the (Igκ)3 conA-luc plasmid. We thank Ms. Ai Tanigaki and Ms. Rie Hikawa for technical assistance. This study was supported in part by grants-in-aid for scientific research from the Japan Society for the Promotion of Science (grant number 24300132).

All authors declare no conflict of interest.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Belzil V. V., Daoud H., Desjarlais A., Bouchard J. P., Dupre N., Camu W., Dion P. A. and Rouleau G. A. (2011) Analysis of OPTN as a causative gene for amyotrophic lateral sclerosis. Neurobiol. Aging 32, 555.e13555.e14.
  • Chi Z. L., Akahori M., Obazawa M. et al. (2010) Overexpression of optineurin E50K disrupts Rab8 interaction and leads to a progressive retinal degeneration in mice. Hum. Mol. Genet. 19, 26062615.
  • Clemens J. A. (2000) Cerebral ischemia: gene activation, neuronal injury, and the protective role of antioxidants. Free Radic. Biol. Med. 28, 15261531.
  • Del Bo R., Tiloca C., Pensato V. et al. (2011) Novel optineurin mutations in patients with familial and sporadic amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 82, 12391243.
  • Gould T. W., Buss R. R., Vinsant S., Prevette D., Sun W., Knudson C. M., Milligan C. E. and Oppenheim R. W. (2006) Complete dissociation of motor neuron death from motor dysfunction by Bax deletion in a mouse model of ALS. J. Neurosci. 26, 87748786.
  • Hensley K., Fedynyshyn J., Ferrell S. et al. (2003) Message and protein-level elevation of tumor necrosis factor alpha (TNF alpha) and TNF alpha-modulating cytokines in spinal cords of the G93A-SOD1 mouse model for amyotrophic lateral sclerosis. Neurobiol. Dis. 14, 7480.
  • Ito H., Fujita K., Nakamura M. et al. (2011) Optineurin is co-localized with FUS in basophilic inclusions of ALS with FUS mutation and in basophilic inclusion body disease. Acta Neuropathol. 121, 555557.
  • Le Bail O., Schmidt-Ullrich R. and Israel A. (1993) Promoter analysis of the gene encoding the I kappa B-alpha/MAD3 inhibitor of NF-kappa B: positive regulation by members of the rel/NF-kappa B family. EMBO J. 12, 50435049.
  • LePage K. T., Dickey R. W., Gerwick W. H., Jester E. L. and Murray T. F. (2005) On the use of neuro-2a neuroblastoma cells versus intact neurons in primary culture for neurotoxicity studies. Crit. Rev. Neurobiol. 17, 2750.
  • Li H., Ao X., Jia J., Wang Q. and Zhang Z. (2011) Effects of optineurin siRNA on apoptotic genes and apoptosis in RGC-5 cells. Mol. Vis. 17, 33143325.
  • Martin L. J. (2000) p53 is abnormally elevated and active in the CNS of patients with amyotrophic lateral sclerosis. Neurobiol. Dis. 7, 613622.
  • Maruyama H., Morino H., Ito H. et al. (2010) Mutations of optineurin in amyotrophic lateral sclerosis. Nature 465, 223226.
  • Millecamps S., Boillee S., Chabrol E. et al. (2011) Screening of OPTN in French familial amyotrophic lateral sclerosis. Neurobiol. Aging 32, 557.e11557.e13.
  • Miyashita T. and Reed J. C. (1995) Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293299.
  • Osawa T., Mizuno Y., Fujita Y., Takatama M., Nakazato Y. and Okamoto K. (2011) Optineurin in neurodegenerative diseases. Neuropathology 31, 569574.
  • Poloni M., Facchetti D., Mai R. et al. (2000) Circulating levels of tumour necrosis factor-alpha and its soluble receptors are increased in the blood of patients with amyotrophic lateral sclerosis. Neurosci. Lett. 287, 211214.
  • Rezaie T., Child A., Hitchings R. et al. (2002) Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science 295, 10771079.
  • Rosen D. R., Siddique T., Patterson D. et al. (1993) Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 5962.
  • Sahlender D. A., Roberts R. C., Arden S. D., Spudich G., Taylor M. J., Luzio J. P., Kendrick-Jones J. and Buss F. (2005) Optineurin links myosin VI to the Golgi complex and is involved in Golgi organization and exocytosis. J. Cell Biol. 169, 285295.
  • Sippl C., Bosserhoff A. K., Fischer D. and Tamm E. R. (2011) Depletion of optineurin in RGC-5 cells derived from retinal neurons causes apoptosis and reduces the secretion of neurotrophins. Exp. Eye Res. 93, 669680.
  • Swarup V., Phaneuf D., Dupre N., Petri S., Strong M., Kriz J. and Julien J. P. (2011) Deregulation of TDP-43 in amyotrophic lateral sclerosis triggers nuclear factor kappaB-mediated pathogenic pathways. J. Exp. Med. 208, 24292447.
  • Tumer Z., Bertelsen B., Gredal O., Magyari M., Nielsen K. C., LuCamp, Gronskov K. and Brondum-Nielsen K. (2012) A novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS. Neurobiol. Aging 33, 208.e1208.e5.
  • Yoshihara T., Ishigaki S., Yamamoto M., Liang Y., Niwa J., Takeuchi H., Doyu M. and Sobue G. (2002) Differential expression of inflammation- and apoptosis-related genes in spinal cords of a mutant SOD1 transgenic mouse model of familial amyotrophic lateral sclerosis. J. Neurochem. 80, 158167.