SEARCH

SEARCH BY CITATION

Keywords:

  • anti-ageing protein;
  • growth factor;
  • neurodegeneration;
  • Retinitis Pigmentosa

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Retinitis Pigmentosa involves a hereditary degeneration of photoreceptors by as yet unresolved mechanisms. The secretable protein α-Klotho has a function related to ageing processes, and α-Klotho-deficient mice have reduced lifespan and declining functions in several tissues. Here, we studied Klotho in connection with inherited photoreceptor degeneration. Increased nuclear immunostaining for α-Klotho protein was seen in degenerating photoreceptors in four different Retinitis Pigmentosa models (rd1, rd2 mice; P23H, S334ter rhodopsin mutant rats). Correspondingly, in rd1 retina α-Klotho mRNA expression was significantly up-regulated. Moreover, immunostaining for another Klotho family protein, β-Klotho, also co-localized with degenerating rd1 photoreceptors. The rd1 retina displayed reduced levels of fibroblast growth factor 15, a member of the fibroblast growth factor subfamily for which Klotho acts as a co-receptor. Exogenous α-Klotho protein added to retinal explant cultures did not affect cell death in rd1 retinae, but caused a severe layer disordering in wild-type retinae. Our study suggests Klotho as a novel player in the retina, with a clear connection to photoreceptor cell death as well as with an influence on retinal organization.

Abbreviations used
Akt

protein kinase B

CNS

central nervous system

DIV

days in vitro

FGF

fibroblast growth factor

FOXO

FoxO forkhead transcription factor

Gapdh

glyceraldehyde-3-phosphate dehydrogenase

GCL

ganglion cell layer

HE

hematoxylin-eosin

INL

inner nuclear layer

IS

inner segment of the photoreceptors

Lctl

Klotho/lactase-phlorizin hydrolase-related protein (γ-Klotho)

NFL

nerve fibre layer

ONL

outer nuclear layer

OS

outer segment of the photoreceptors

PARP

poly (ADP-ribose) polymerase

PBS

phosphate buffered saline

PDE6β

phosphodiesterase-6 subunit beta

PN

postnatal day

PTX

PBS-triton X100

rd1/rd2

retinal degeneration 1/2

RP

Retinitis Pigmentosa

SD

standard deviation

TUNEL

terminal deoxynucleotidyl transferase dUTP nick-end labelling

wt

wild-type

The inheritable disease Retinitis Pigmentosa (RP) leads to loss of vision via degeneration of rod and cone photoreceptors: typically rods die via mutation-induced mechanisms, after which cones degenerate secondarily (Pierce 2001). Although today over 60 genes have been linked to RP (RetNet: http://www.sph.uth.tmc.edu/RetNet), the mechanisms behind the degeneration are largely unclear, and there is currently no treatment available.

The Klotho protein – named after the Greek goddess Klotho, who spins the thread of life – is a player in longevity, and defective α-Klotho expression provokes rapid ageing and early death in mouse (Kuro-o et al. 1997). Apart from the prototypical α-Klotho, there are other Klotho family members, including β-Klotho and Klotho/lactase-phlorizin hydrolase-related protein [Lctl or γ-Klotho] (Ito et al. 2000). The Klotho gene encodes a 1014 amino acid, transmembrane protein (Matsumura et al. 1998), with homology to β-glucuronidases and is found mainly in kidney distal tubules, parathyroid gland, and brain choroid plexus, but also in other tissues including urinary bladder (Kuro-o et al. 1997) and inner ear (Kamemori et al. 2002). Both membrane and soluble forms (Imura et al. 2004) are known, with shedding of α-Klotho ectodomain (fragments) from the cell membrane via various secretases (Bloch et al. 2009). The connection between Klotho and the demise of various cell types (Kuro-o et al. 1997) warrants a consideration of an involvement also in the retina and RP. Current information on retinal Klotho is sparse. High mRNA expression levels of Lctl have been reported in adult mouse eyes (Fon Tacer et al. 2010), with α-Klotho and β-Klotho expression either absent or limited, respectively. However, a previous, microarray based study suggested elevated levels of β-Klotho mRNA in retinae of the rd1 mouse model for RP (Azadi et al. 2006).

The altered β-Klotho mRNA in rd1 retina and the α-Klotho connection to ageing and death triggered us to investigate Klotho isoforms in different RP animal models. These included the rd1 mouse, which carries a mutation in the gene coding for the β-subunit of phosphodiesterase-6 (Farber and Lolley 1974), giving a rapid degeneration, and the rd2 mouse, with a mutation in the photoreceptor disc protein peripherin-2 gene (Goldberg 2006) and in which the retinal degeneration is slower. Both models represent human RP forms (Kajiwara et al. 1991; Bayés et al. 1995). Rhodopsin mutations are frequent in RP patients, and hence we also used two rhodopsin mutant rats that display fast (S334ter; Liu et al. 1999) and slow (P23H; Sung et al. 1991) rod degeneration respectively. The rd2 mutation affects both rod and cone photoreceptors, while the other mutations are rod specific. The unique characteristics of the four models, from two different species, make them well suited to address the possible involvement of Klotho in inherited photoreceptor cell death.

Here, we demonstrate a strong up-regulation of several Klotho isoforms in degenerating retinae, as well as an effect on retinal morphology by addition of exogenous Klotho to retinal cultures. The findings suggest a link between Klotho and the process of retinal degeneration.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Animals

Animals included C3H rd1/rd1 (rd1), C3H rd2/rd2 (rd2) and control C3H wild-type (wt) mice (Sanyal and Bal 1973) and were used irrespective of gender. Homozygous P23H and S334ter rhodopsin transgenic rats of the line Tg(P23H)1Lav and Tg(S334ter)3Lav (P23H and S334ter-3), were kindly provided by Dr M. M. LaVail (University of California, San Francisco, CA, USA). Heterozygous P23H and S334ter rats were obtained by crossing with wt, CD rats (CD® IGS Rat; Charles River, Germany) to resemble autosomal dominant RP. CD rats were used as controls.

Ethics statement

All procedures were performed in accordance with permits granted by either the ‘Malmö/Lunds Djurförsöksetiska nämnd’ (rd1 and rd2, wt mice; permits # M242/07, M220/09), or the Tübingen University committee on animal protection (S334ter, P23H and CD rats). Protocols compliant with § 4 paragraph 3 of the German law on animal protection were reviewed and approved by the ‘Einrichtung für Tierschutz, Tierärztlichen Dienst und Labortierkunde’ (Anzeige/Mitteilung nach § 4 vom 28.04.08 and 29.04.10). All efforts were made to minimize the number of animals used and their suffering. Animals were kept in the animal house under standard white cyclic lighting, with free access to food and water, and were used irrespective of gender.

To minimize any bias from loss of retinal tissue because of the degeneration, comparisons of rd1 and healthy wt retinae were typically performed at post-natal day (PN) 11. At PN11 degenerating photoreceptors are frequent in rd1 retina, but outer nuclear layer (ONL) thickness is not significantly affected (Sancho-Pelluz et al. 2008). For the other models, we typically chose time-points corresponding to the respective peaks of degeneration, that is, PN19 for rd2 mice, PN15 for Rho P23H rats and PN12 for Rho S334ter rats.

Organotypic retinal explant culture

For in vitro experimentation, PN5 rd1 animals were killed by decapitation, after which retinal explants were generated and cultured in principle as detailed previously (Caffé et al. 2002; Sancho-Pelluz et al. 2010). Briefly, the enucleated eyes were dissected aseptically in a Petri dish with R16 serum-free culture medium (Invitrogen Life Technologies, Paisley, UK; 07490743A) (Caffé et al. 2002), to yield a retinal explant devoid of other eye tissue except for the retinal pigment epithelium. The retina had four cuts perpendicular to its rim, resulting in a propeller-like shape of the explant, which was then transferred to a Millicell culture dish filter insert (Millipore AB, Solna, Sweden; PIHA03050), where it was placed with the retinal pigment epithelium layer facing the culturing membrane. Inserts were put into six-well culture plates, and each well given 1.5 mL serum-free R16 medium. Plates were incubated at 37°C with medium replacement generally every second day (except for 1-day treatments described below).

Prior to treatment, PN5 explants were allowed to adjust to control culture conditions for 2 or 5 days in vitro (DIV), after which a 4- or 1-day treatment, respectively, was performed. The end point of both of these experiments (PN5 + 2DIV + 4DIV alt. PN5 + 5DIV + 1DIV) thus corresponded to PN11. Treatment used either 1 nM or 2.5 nM (stock was 1 μm in phosphate buffered saline (PBS) 50% (v/v) Glycerol and 0.1 mM EDTA, pH 6.8) of the recombinant ectodomain of Klotho protein (R&D Systems, Abingdon, UK; 1819-KL; representing 948 of 1044 amino acids of full length protein), or appropriate concentration of vehicle. These concentrations clearly exceeded the physiological levels of the circulating form in wt (100 pM) or in α-Klotho over-expressing strains (200 pM) (Kurosu et al. 2005).

In separate, long-term experiments wt retinae were cultured from PN5 for 2 days without any treatment, and subsequently treated for 15 days (PN5 + 2 DIV + 15 DIV; i.e. to PN22) with either 1 nM Klotho or vehicle.

At the end of experiments, preparations were fixed and sectioned, as described below.

Fixation, sectioning and microscopy

Mouse retinal samples were fixed in 4% paraformaldehyde for 2 h in PBS. Rat tissues were fixed in paraformaldehyde in PBS for 5 min in room temperature (20°C) and 55 min in 4°C. This was followed by thorough rinses with PBS, after which the preparations were placed in sucrose containing PBS to prepare for cryosectioning, which yielded 8 or 12 μm frozen sections, used as indicated.

Morphological observations and light/fluorescence microscopy were performed and recorded on a Zeiss Axiophot microscope with a HBO 100 W halogen lamp and a Zeiss Axiocam digital camera (Jena, Germany). Images were captured using Zeiss Axiovision 4.2 software; image overlays and contrast enhancement were done utilizing Adobe Photoshop CS (San Jose, CA, USA).

TUNEL staining

Terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) staining was performed on PBS washed sections using the In Situ Cell Death Detection Kit (TMR Red, Roche, Mannheim, Germany). Controls, including omitting the terminal deoxynucleotidyl transferase enzyme from the labelling solution (negative control), or pre-treatment of the sections with DNAse I to induce strand breaks (positive control), have been performed earlier with similar kits and preparations, giving no staining at all (negative) or general staining of all nuclei in all retinal layers (positive) (Paquet-Durand et al. 2007).

Histological staining/Immunofluorescence

Fixed sections were stained for general histological light microscopy with hematoxylin-eosin according to standard protocols, or underwent immunostaining. For the latter, the sections were washed 3 × 5 min each in PBS containing 0.25% Triton X100 (PTX) plus 1% bovine serum albumin. Blocking solution containing PTX and 5% normal serum from the secondary antibody host species was applied for 45 min. Primary antibodies were diluted in PBS with 1% bovine serum albumin and 0.25% Triton X100, and applied overnight at 4°C. Following 3 × 5 min washing in PTX, sections were incubated with appropriate secondary antibodies in PTX for 45 min, washed thrice in PBS and mounted with Vectashield DAPI containing the nuclear counterstain DAPI (4', 6-diamidino-2-phenylindole). (Vector, Burlingame, CA, USA). Controls were processed in parallel without primary antibody. Antibodies are listed in Table S1.

Some stainings required antigen retrieval processing, performed by means of Na-Citrate-Tween-20 buffer (10 mM sodium citrate, 0.05% Tween-20, pH 6.0) for up to 40 min in sub-boiling, followed by the above-mentioned protocol.

Counting of cells and tissue parameters

The number of TUNEL or α-Klotho-positive (+) cells was assessed and calculated as reported previously (Paquet-Durand et al. 2006; Sancho-Pelluz et al. 2010). For each animal at least three non-contiguous sections were quantified to yield an average value, with at least three independent animals analysed for each experimental situation. Values are given as TUNEL (+) cells relative to control ± SD.

Some hematoxylin-eosin stained sections were analysed with respect to surviving rows (perpendicular to the radius of the retina) of photoreceptors or to disorganization of the retinal structure. For the former, six pairs of treated and untreated retinae represented the samples and three non-contiguous sections per sample were analysed. In every section three random central, but non-contiguous, areas were selected, inside of which the rows of photoreceptor nuclei were manually counted in the microscope. The mean values of every section were averaged giving the number of surviving rows of photoreceptor nuclei per sample. For the disorganization analysis, the combined length (in the horizontal aspect) of disorganized retina in both of the edges of the stained sections was measured in the microscope. Normal, non-disorganized length of retina was also recorded, which together with disorganized length equalled each section's total length. Four sections were analysed on each of three non-contiguous slides for each preparation, which gave rise to an average value for that slide. The three observed slides were then averaged to yield one, final value.

Immunofluorescence quantification

The FGF15 immunofluorescence in photoreceptor outer segments (OS) (Fos) was quantified using the ImageJ program following a protocol developed by Burgess (http://sciencetechblog.com/2011/05/24/measuring-cell-fluorescence-using-imagej), with some minor modifications. In brief, fluorescent areas of the whole segments, inner segments and blank (a random external area close to the tissue) were outlined, after which values corresponding to integral density (ID) and area (A) of the whole segments (IDs, As) and the inner segments alone (IDis, Ais), as well as mean value (M) of the blank, were calculated. The following equation then gave a reliable approximation of the expression of FGF15 in the OS of the photoreceptors: Fos = IDs − (As × M) − [IDis − (Ais × M)].

Western blot

PN11 retinae were prepared in dissecting buffer (10 mM Tris, 1 mM EDTA, 150 mM NaCl, 1 mM Na3VO4, 50 nM okadaic acid, pH 7.3) supplemented with protease inhibitor mixture (Complete Mini, Roche) and homogenized in sample buffer (2% sodium dodecyl sulphate, 10% glycerol, 0.0625 M Tris-HCl, pH 6.80 by mechanical force. After centrifugation for 10 min at 14 000 g, the supernatant was removed and stored at −20°C. Bio-Rad DC Protein Assay kit (Bio-Rad, Hercules, CA, USA) was used to determine protein concentrations, and either 10 or 20 μg of protein from each sample were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis on 12% gels, and blotted onto Immobilon-P polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). Membranes were incubated for 2 h in blocking buffer (5% non-fat dried milk in PBS with 0.1% Tween 20) and then kept overnight at 4°C with antibodies of interest. The membranes were then washed, treated for 1 h with horseradish peroxidase-conjugated secondary antibodies (Table S1), and immunoreactions visualized using the enhanced chemiluminescence Plus Western Blotting Detection system (Amersham Biosciences, Sunnyvale, CA, USA) and Hyperfilm (Amersham Biosciences).

Quantitative RT-PCR

After enucleation, PN11 retinae were immediately snap frozen in liquid nitrogen. Total RNA was isolated by using Trifast Reagent (Peqlab, Erlangen, Germany) according to the manufacturer's instructions. Reverse transcription of 2 μg total RNA was performed using oligo(dT)12-18 primers (Invitrogen, Karlsruhe, Germany) and SuperScriptIII Reverse Transcriptase (Invitrogen, Karlsruhe, Germany). cDNA samples were treated with RNaseH (Invitrogen, Karlsruhe, Germany). Quantitative real-time PCR was performed with the iCycler iQ™ Real-Time PCR Detection System (Bio-Rad) and iQ™ Sybr Green Supermix (Bio-Rad) according to the manufacturer's instructions.

The following primers were used (5′[RIGHTWARDS ARROW]3′ orientation):

α-Klotho fw: CCCTGTGACTTTGCTTGGG;

α-Klotho rev: CCCACAGATAGACATTCGGGT;

β-Klotho fw: TGTTCTGCTGCGAGCTGTTAC;

β-Klotho rev: TTATCCCATATTGCTTTCCCGTC;

Lctl fw: GTGACTATGCTGACCTATGCTTT;

Lctl rev: TGTGAGCCAATGCTTCACTCG;

Gapdh fw: AGGTCGGTGTGAACGGATTTG;

Gapdh rev: TGTAGACCATGTAGTTGAGGTCA;

The specificity of the PCR products was confirmed by analysis of the melting curves and by agarose gel electrophoresis. The results were derived from analyses of five independent samples per group and all PCRs were performed in duplicate. Fold changes of mRNA were calculated by the 2−ΔΔCt method using glyceraldehyde 3-phosphate dehydrogenase (Gapdh) as internal reference.

Statistical analyses

Statistical significance was tested using unpaired, two-tailed, Student's t-test, Student's paired t-test, Student's one-group t-test or two-way anova test, as indicated. When Student's one-group t-test was used, the treated/untreated ratios were compared with a ratio of 1.00. For all tests, a p < 0.05 was considered to indicate a statistically significant difference.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Klotho mRNA expression in rd1 retina

Quantitative RT-PCR analysis revealed an increase of α-Klotho mRNA levels in PN11 rd1 retinae [3.74 ± 2.49 a.u. (arbitrary units)] compared with age matched wt (wild-type) tissue (1.07 ± 0.46 a.u.; p < 0.05, after log-transformation). The mRNA levels for β-Klotho and Lctl were numerically, but not significantly, higher in rd1 than in wt samples [rd1 1.46 ± 0.69 a.u.; wt 1.14 ± 0.57 a.u., and rd1 1.29 ± 0.55 a.u.; wt 1.07 ± 0.43 a.u., respectively; mean ± SD; n = 5; n.s. (not significant)].

Immunofluorescence of Klotho proteins in RP models

α-Klotho

At PN11, at the onset of the rd1 degeneration, the α-Klotho ab18131 antibody revealed a high number of strongly positive nuclei in rd1 ONL (see Table S1 for antibodies), but not in PN11 wt ONL (Fig. 1a). The higher number of positive cells in the central rd1 retina (Data not shown) resembled the known centre to periphery degeneration in this model (Carter-Dawson et al. 1978). Co-staining with the TUNEL assay (Fig. 1a, c and d) confirmed that α-Klotho positive nuclei indeed belonged to degenerating photoreceptors. Furthermore, α-Klotho co-localized with markers for oxidatively damaged DNA and overactivation of poly (ADP-ribose) polymerase enzymes (Figure S1a and b), which are known to label dying photoreceptors (Paquet-Durand et al. 2007). Validation of the α-Klotho staining (Figure S1c and d) was done by two other antibodies (ab75023, sc-74205; Table S1).

image

Figure 1. α-Klotho and cell death in degenerating mouse retina. Immunostaining with α-Klotho antibody ab18131 (green) and Terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) cell death staining (red) of PN11 rd1 and wt (a), or PN19 rd2 and wt (b), retinal sections. Pictures are from subcentral positions, that is, close to the optic nerve exit. In wt specimens α-Klotho was only very rarely found in the outer nuclear layer (ONL), whereas a subset of photoreceptors in the rd1 and rd2 ONL showed a distinct nuclear staining. The percentages of cells positive for either TUNEL, α-Klotho or both are given in (c) (mean ± SD; n = 3–5), indicating a major TUNEL on α-Klotho overlap (c, d). Weak but noticeable α-Klotho immunoreactivity was found in inner nuclear and ganglion cell layers (INL, GCL), both in wt and rd1 retinae. The staining is representative for at least three independent animals of each type. Scale bar = 20 μm.

Download figure to PowerPoint

To determine whether the retinal α-Klotho increase represents a more generalized phenomenon, the same analyses were performed in rd2 mouse and P23H and S334ter rat retinae. Figure 1b–d shows that the other mouse model, rd2, had α-Klotho/TUNEL co-staining qualitatively similar to rd1, as did both rat models (Fig. 2a–d), suggesting a common situation across species and mutations. The more aggressive degeneration in the S334ter retina, with a higher percentage of dying cells at the peak time-point studied (Kaur et al. 2011), seemed to coincide with less α-Klotho/TUNEL co-labelling (Fig. 2c and d). This difference in α-Klotho versus TUNEL staining may relate to the fact that photoreceptor cell death in the S334ter model shows an extensive activation of caspase 3 which is not seen in P23H rats (Kaur et al. 2011) and rd1 mice (Sahaboglu et al. 2013).

image

Figure 2. α-Klotho and cell death in degenerating rat retina. Immunostaining for α-Klotho and Terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) in retinal sections from PN12 S334ter (a), and PN15 P23H (b) rats plus appropriate controls (Methods). Both models displayed strong α-Klotho labelling in outer nuclear layer (ONL) cells, as well as weak INL and GCL staining. In each situation, the ONL α-Klotho staining overlapped with TUNEL-positivity (c, d). Labels and other features are as in Fig. 1. Scale bar = 20 μm.

Download figure to PowerPoint

β-Klotho

β-Klotho staining was also increased in rd1 ONL cells (Figure S2). While the absolute number of β-Klotho positive cells was lower than seen for α-Klotho (0.85% ± 0.17; Table 1), over 90% of the β-Klotho positive cells were also TUNEL positive (Table 1; Figure S2).

Table 1. Co-localization of Klotho immunostaining with TUNEL positivity
Model; AgeTUNEL (+) cells (%)α-Klotho (+) cells (%)α-Klotho and TUNEL (+) cells (%)
rd1; PN 115.07 ± 0.962.55 ± 0.282.20 ± 0.28
rd2; PN 193.46 ± 0.831.53 ± 0.401.38 ± 0.39
S334ter; PN 1210.83 ± 0.148.17 ± 0.826.05 ± 0.79
P23H; PN 153.88 ± 0.142.59 ± 0.392.41 ± 0.40
Model; AgeTUNEL (+) cells (%)β-Klotho (+) cells (%)β-Klotho and TUNEL (+) cells (%)
rd1; PN114.57 ± 0.580.85 ± 0.170.79 ± 0.16

Western blot

In western blot tests the ab75023 antibody yielded a double band of around 116 kDa plus bands of about 65 kDa (Figure S1e). This is compatible with the expected molecular-weight range for α-Klotho, that is, two full-length protein bands around 116 kDa (with/without glycosylation; Kamemori et al. 2002), as well as some weaker bands of about 65 kDa, which may be α-Klotho fragments (Chen et al. 2007). The ab18131 consistently revealed only an approximately 30 kDa band, perhaps similar to that previously reported in mouse tissue by a different and non-commercial antibody (Chen et al. 2007). Neither antibody revealed significant differences in signal strength between the two genotypes. The cells with increased α-Klotho expression (as in the immunostainings) likely represent only a small fraction of the tissue mass of the global retina samples, and hence any increase might have been masked at the western blot level.

Cultured rd1 retinae and exogenous α-Klotho

Klotho proteins can be released (Kurosu et al. 2005; Imura et al. 2007), but western blot analysis of rd1 retinal explant conditioned medium failed to detect extracellular α-Klotho (Data not shown). Still retinal cells may respond to extracellular protein, and we therefore added recombinant α-Klotho protein to rd1 retinal explants and analysed the outcome by TUNEL staining of preparations corresponding to PN11. Early cellular responses to α-Klotho have been seen in other systems (Kurosu et al. 2005), and we thus tested a 1-day treatment with either 1 or 2.5 nM α-Klotho (PN5 + 5DIV+1DIV; culturing from PN5 for 5 days in vitro (DIV) without treatment, followed by 1 DIV treatment). However, this gave no effect on rd1 TUNEL positivity [TUNEL positive cells in treated vs. untreated (set to 1.0) = 0.96 ± 0.14 for 1 nM; 0.85 ± 0.14 for 2.5 nM, respectively; mean ± SD; n = 4; n.s.], and neither did an extension of treatment to 4 days (PN5 + 2DIV + 4DIV) (1.20 ± 0.20 for 1 nM; 1.12 ± 0.22 for 2.5 nM, respectively; n = 5; n.s.).

Cultured wt retinae and exogenous α-Klotho

We then treated wt retinal explants, which do not have a degenerative phenotype, and increased the treatment duration to encompass ages PN7 to PN22 (PN5 + 2 + 15). Such α-Klotho treatment did not affect the number of surviving rows of photoreceptors at the end of culturing (Fig. 3a: α-Klotho treated 8.5 ± 0.8, untreated 9.0 ± 0.8; mean ± SD; n = 6; n.s.).

image

Figure 3. α-Klotho treatment causes retinal disorganization. Quantification of surviving rows of wt photoreceptors after the PN5 + 2+15 α-Klotho treatment paradigm is shown in (a). No significant difference was seen (mean ± SD; n = 12.) PRs = Photoreceptors. Micrographs below the bar diagram show examples of the hematoxylin-eosin histology of the corresponding outer nuclear layer areas. The sketch in (b) depicts the typical propeller-like explant outline, with blue lines indicating approximate positions of the sections that are generally analysed in explant based experiments. The captions Left, Middle, Right indicate how the tissue in the micrographs below was situated in the explants, while the red lines indicate the approximate splitting points for these partitions. Panels in (d) show the histology of full and representative sections (split into Left, Middle and Right parts, respectively) of long-term wt retinal explants, untreated or treated with 1 nM α-Klotho. Note the treatment induced increase of disorganized area, as marked out by blue arrowed lines. The measurements of the disorganized lengths are summarized in the diagram in (c) (mean ± SD; n = 12; p < 0.01). Scale bar = 100 μm.

Download figure to PowerPoint

The explant culturing regularly leads to a slight disorganization of the retinal layering at the very edges of the preparations, and cell row and TUNEL analyses etc., are therefore regularly performed using the more central parts of the specimens. While lacking any effect on central cell rows (Fig 3a), the treatment of wt explants consistently caused a disorganization at the edges of the retinal explants, that was much more extensive than in the untreated specimens (Fig. 3c and d; disorganized edge lengths: α-Klotho treated 1506 ± 708 μm, untreated 780 ± 340 μm; mean ± SD; n = 12; p < 0.01; Student's paired t-test). The total length of an explant section usually ranges between 4000 and 5000 μm, but this parameter was not different between treated and untreated specimens (ratio total length; treated/untreated: 0.98 ± 0.05; n = 12; n.s., Student's one-group t-test).

Immunostaining for rhodopsin showed compromised photoreceptors throughout the disorganized area of the α-Klotho treated wt retinae (Fig. 4). Moreover, immunoreactivity for bipolar cells (phosphorylated PKCα/βII; Zhang and Yeh 1991) was dramatically decreased in the same area. The α-Klotho treatment thus affected both inner and outer retina integrity. However, TUNEL positive cells were seen predominantly at the outermost part of the edges, suggesting that not all cells in the disorganized area were actively undergoing cell death (Fig. 4).

image

Figure 4. Markers for rods and bipolar cells and Terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) staining in α-Klotho peptide treatment of wt retinae. The disorganized retinal areas (right side of white vertical bars in a to d), can be seen by hematoxylin-eosin staining (a), and shows a lack of ordered rhodopsin staining (b, rod photoreceptors) and severe reduction of phosphorylated protein kinase Cα and βII (c, bipolar cells) staining, underscoring the disturbance of both outer and inner retina. The frequency of TUNEL positive cells decreased from the very edges towards the central parts of the explant (d), and there were (with the exception of ganglion cells) only very few TUNEL positive cells close to the border between the normal and disorganized retina. Staining results are representative of at least six independent samples. Layer labels are as in Fig. 1. Scale bar = 100 μm.

Download figure to PowerPoint

FGF 15 in rd1 retina

An interesting feature of both α- and β-Klotho proteins is that they can associate with the four fibroblast growth factor (FGF) receptors (FGFR1-4), to act as co-receptors for the FGF19 subfamily members (FGF15/19, FGF21 and FGF23) (Kurosu et al. 2006; Liu et al. 2008). The Klotho proteins increase the atypical FGFs otherwise low FGFR affinity (Zhang et al. 2006) and enable activation of FGFR and downstream components (Kurosu et al. 2006; Wu et al. 2007). FGF15 represents the mouse orthologue to human FGF19, which has neuroprotective properties on adult mammalian photoreceptors (Siffroi-Fernandez et al. 2008), and is expressed by various cell types in the developing mouse retina (Kurose et al. 2004). We therefore studied the expression of FGF15 in post-natal wt and rd1 retinae. PN11 retinae displayed FGF15 immunostaining in both the nerve fibre layer (Data not shown) and the photoreceptor OS (Fig. 5; Figure S3). With respect to the temporal dynamics, the expression of FGF15 in OS was in PN7 and PN9 specimen low in both wt and rd1 genotypes, after which it increased, but then preferentially in the wt retinae. The comparably low expression in rd1 OS at PN10 and PN11 suggests that low FGF15 expression in rd1 photoreceptors may have caused an imbalance in any possible Klotho-FGF interactions. The rd2 retina also shows a weaker FGF15 staining than corresponding wt, although the lack of OS here makes the analysis difficult (Figure S3).

image

Figure 5. Expression of fibroblast growth factor (FGF)15 is reduced in degenerating retina. Immunostaining of retinal tissue sections for FGF15 in the OS of wt and rd1 retinae during the PN7-13 period. While wt FGF15 expression shows a strong increase after PN10, FGF15 in the rd1 situation remains at low levels. The PN11 sections were 8 μm, all others 12 μm. Values are given as mean ± SD and represent analyses of three independent samples; arb. un. = arbitrary units. Statistical significance was tested using two way anova test (*p < 0.05; **< 0.01). OS, outer segments; IS, inner segments. Scale bar = 20 μm.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The Klotho protein is recognized as an important factor for cellular ageing and survival (Kuro-o et al. 1997; Kurosu et al. 2005), but a clear connection between high Klotho expression and neuronal cell death, as shown here, has to our knowledge not been demonstrated before. Our results also suggest that over-expression of Klotho proteins, particularly α-Klotho, serves as a marker for hereditary photoreceptor cell death, and that the protein as such may act towards disorganization of photoreceptors and other retinal cells.

Klotho expression in the retina

Immunostaining using three independent antibodies identified a sub-population of photoreceptors in the rd1 retina with a highly increased nuclear α-Klotho protein expression. Nuclear Klotho has previously been shown in both brain (e.g. Purkinje cells; German et al. 2012) and inner ear sensory cells (Takumida et al. 2009). α-Klotho is known to assist the atypical FGF family in binding to the FGFRs. FGFRs are membrane proteins, although alternative spliced transcripts may lose the hydrophobic transmembrane domain and can then also be found as soluble forms, of which at least the soluble FGFR1 has also been shown to be able to enter retinal cell nuclei (Guilonneau et al. 1998). Since FGFR4 could be detected in photoreceptor and other retinal cell nuclei of wt and rd1 retinae alike (Figure S3), one of the possible Klotho interaction partners during retinal degeneration may reside in this compartment.

The degeneration also affected α-Klotho mRNA, which was higher in rd1 retinal samples than in wt material. This increase may have occurred over a low steady-state transcription of the α-Klotho gene, since a screen for Klotho mRNA showed its expression to be low or not detectable in several (adult) mouse tissues, including the eye (Fon Tacer et al. 2010). In contrast to immunostainings and mRNA measurements, our comparisons at the western blot level did not show an rd1 versus wt difference. However, the western data suggested wt retinal α-Klotho protein levels to be sustained at a detectable level at the PN11 age, and an increase in a small, select number of cells, as in the rd1 situation, would then be difficult to distinguish in a global sample.

Klotho and cell death

Each of the three α-Klotho antibodies revealed an extensive co-localisation with dying, TUNEL positive photoreceptors in the rd1 retina. This confirms that the antibodies identified the same population of cells, and suggests that the α-Klotho increase connects with the rd1 degeneration process. Moreover, this connection was not restricted to a certain model or species, since comparable co-localisation results were readily detected in the rd2 mouse and in the P23H and S334ter rats. Taken together, these data argue for α-Klotho up-regulation as an integrated and general event of photoreceptor degeneration, regardless of how the pathological processes start. Interestingly, this notion extends also to the β-Klotho protein, which showed increased expression, and broad TUNEL co-localisation, in a subset of rd1 photoreceptors. We could not identify a significant increase in β-Klotho mRNA in rd1 samples compared with control tissue, even though this was suggested in a previous microarray study (Azadi et al. 2006). The discrepancy might be attributed to the distinctive technologies used (microarray vs. qRT-PCR) or to other methodological differences. At any rate, Klotho expression is unequivocally associated with photoreceptor cell death and may thus serve as a novel diagnostic marker for RP and related neurodegenerative diseases.

Is Klotho protective or destructive?

α-Klotho is linked to anti-ageing and has potential cellular protection capacities. In this role it may act extracellularly either on its own or as a co-receptor for members of the FGF19 subfamily, such as FGF23 (Wang and Sun 2009), although intracellular effects have also been described (Liu et al. 2011). Lack of α-Klotho appears to promote senescence (Kuro-o et al. 1997) and weaken the oxidative stress defence (Nagai et al. 2002). Conversely, oxidative stress, old age, inflammation, and cellular senescence lead to, or coincide with, reduced α-Klotho levels (Mitani et al. 2002; Mitobe et al. 2005; Takumida et al. 2009; Thurston et al. 2010; Liu et al. 2011). Furthermore, α-Klotho gene over-expression or addition of α-Klotho protein may counteract or reduce oxidative stress, inflammation, cellular senescence, cellular dysfunction, or even cell death in various systems (Saito et al. 2000; Yamamoto et al. 2005; Haruna et al. 2007; Sugiura et al. 2010; Liu et al. 2011). Since oxidative stress, in particular DNA oxidation, is involved in rd1 degeneration (Paquet-Durand et al. 2007) the up-regulation of α-Klotho in photoreceptors could thus be part of a protective response to such insults. However, α-Klotho has been reported to confer resistance to oxidative stress through the expression of manganese superoxide dismutase, led by FoxO forkhead transcription factors, a downstream effector of the insulin intracellular signalling (Yamamoto et al. 2005). The activation of FoxO forkhead transcription factors is negatively regulated by Akt (also known as PKB)-dependent phosphorylation. Akt has been shown to be overactivated in rd1 retinae (Johnson et al. 2005), and it is therefore possible that this has counteracted the ability of α-Klotho to induce expression of manganese superoxide dismutase, and hence to confer protection in the degenerating retina.

As an alternative scenario, α-Klotho could instead be part of the neurodegeneration mechanism as such. This notion appears novel, since many investigations rather suggest α-Klotho to counteract neurodegeneration, in that α-Klotho reduction leads to signs of neurodegeneration and/or loss of cells in several areas of the CNS (Kuro-o et al. 1997; Nagai et al. 2002; Anamizu et al. 2005; Shiozaki et al. 2008; Kosakai et al. 2011). However, these reports identify neurodegeneration in a situation of experimentally altered α-Klotho, whereas we detected altered α-Klotho in a situation of disease-induced neurodegeneration, which represents a completely different setting. Judging from the distinct co-localisation of α-Klotho (and β-Klotho) with TUNEL, that is, a clear connection with cell death, we are tempted to speculate that Klotho proteins may be involved in the later stages of the degeneration process. The fact that photoreceptor degeneration was not promoted by exogenous α-Klotho would then point to a preferential intracellular degeneration involvement of α-Klotho, although the lack of effect might also be a result of Klotho co-effectors (e.g. FGF15) being low in rd1 photoreceptors.

In any event our study implies that degenerating photoreceptors experience a distinct imbalance in the Klotho-FGF system, which is interesting not the least because of the benign effects of FGF19 signalling on photoreceptor survival and maintenance (Siffroi-Fernandez et al. 2008). Perhaps future experimental manipulation of the interaction(s) between α- and/or β-Klotho and FGF15/19 protein family can shed light on the exact importance of the Klotho/FGF axis for the retinal degeneration process.

Klotho and post-natal retinal development

Interestingly, exogenously added α-Klotho protein resulted in a structural disorganization of both inner and outer retinal elements at the edges of the preparations. For one thing this underlines that the lack of effect by Klotho on the degeneration was not likely to be because of methodological problems in those experiments. Furthermore, with respect to the mechanisms behind the disorganization, the treatment of the explants started at a time-point when the retina is still undergoing development in a centre-to-periphery fashion (Young 1985), making it possible that Klotho interfered with normal tissue development. Since retinal precursors are present in the retinal margin (Willbold and Layer 1992), one should also not disregard the possibility that these may have been re-activated and contributed for instance to the loss of markers such as PKCα/βII. However, since the treatment did not increase the size of the treated explants, a re-activation and significant growth of such stem cells seem not to have occurred.

In conclusion, the present report introduces α-Klotho as a novel player in the context of retinal health and disease, and particularly in inherited retinal degeneration. While Klotho proteins are increased in degenerating rd1 photoreceptors, FGF15 is reduced, suggesting an imbalanced α-Klotho-FGF axis as part of the disease characteristics. Furthermore, the disorganization of the developing mouse retina by α-Klotho is compatible with a role for this protein in retinal cell differentiation and/or layer formation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors declare no conflict of interest. This study has been supported financially by grants from Torsten och Ragnar Söderbergs Stiftelser, Kronprinsessan Margaretas Arbetsnämnd för synskadade, Stiftelsen Olle Engkvist Byggmästare, The Swedish Research Council 2009-3855, Stiftelsen för Synskadade i f.d. Malmöhus län, Ögonfonden, Charlotte and Tistou Kerstan Foundation, Deutsche Forschungsgemeinschaft (DFG; PA1751/4-1). We like to extend our thanks to Dragana Trifunović for help with retinal samples for mRNA measurements, and to Birgitta Klefbohm and Hodan Abdshill for expert technical assistance regarding retinal explant experiments.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • Anamizu Y. K. H., Seichi A., Yamaguchi S., Kawakami E., Kanda N., Matsubara S., Kuro-o M., Nabeshima Y., Nakamura K. and Oyanagi K. (2005) Klotho insufficiency causes decrease of ribosomal RNA gene transcription activity, cytoplasmic RNA and rough ER in the spinal anterior horn cells. Acta Neuropathol. 109, 457466.
  • Azadi S., Paquet-Durand F., Medstrand P., van Veen T. and Ekström P. A. R. (2006) Up-regulation and increased phosphorylation of protein kinase C (PKC) δ, μ and θ in the degenerating rd1 mouse retina. Mol. Cell. Neurosci. 31, 759773.
  • Bayés M., Giordano M., Balcells S. et al. (1995) Homozygous tandem duplication within the gene encoding the β-subunit of rod phosphodiesterase as a cause for autosomal recessive retinitis pigmentosa. Hum. Mutat. 5, 228234.
  • Bloch L., Sineshchekova O., Reichenbach D., Reiss K., Saftig P., Kuro-o M. and Kaether C. (2009) Klotho is a substrate for α-, β- and γ-secretase. FEBS Lett. 583, 32213224.
  • Caffé A. R., Ahuja P., Holmqvist B., Azadi S., Forsell J., Holmqvist I., Söderpalm A. K. and van Veen T. (2002) Mouse retina explants after long-term culture in serum free medium. J. Chem. Neuroanat. 22, 263273.
  • Carter-Dawson L. D., LaVail M. M. and Sidman R. L. (1978) Differential effect of the rd mutation on rods and cones in the mouse retina. Invest. Ophthalmol. Vis. Sci. 17, 489498.
  • Chen C. D., Podvin S., Gillespie E., Leeman S. E. and Abraham C. R. (2007) Insulin stimulates the cleavage and release of the extracellular domain of Klotho by ADAM10 and ADAM17. Proc. Natl Acad. Sci. USA 104, 1979619801.
  • Farber D. B. and Lolley R. N. (1974) Cyclic guanosine monophosphate: elevation in degenerating photoreceptor cells of the C3H mouse retina. Science 186, 449451.
  • Fon Tacer K., Bookout A. L., Ding X. et al. (2010) Research resource: comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol. Endocrinol. 24, 20502064.
  • German D. C., Khobahy I., Pastor J., Kuro-O. M. and Liu X. (2012) Nuclear localization of Klotho in brain: an anti-aging protein. Neurobiol. Aging 33, 1483.e25–30.
  • Goldberg A. F. (2006) Role of peripherin/rds in vertebrate photoreceptor architecture and inherited retinal degenerations. Int. Rev. Cytol. 253, 131175.
  • Guilonneau X., Régnier-Ricard F., Laplace O., Jonet L., Bryckaert M., Courtois Y. and Mascarelli F. (1998) Fibroblast growth factor (FGF) soluble receptor 1 acts as a natural inhibitor of FGF2 neurotrophic activity during retinal degeneration. Mol. Biol. Cell 9, 27852802.
  • Haruna Y., Kashihara N., Satoh M., Tomita N., Namikoshi T., Sasaki T., Fujimori T., Xie P. and Kanwar Y. (2007) Amelioration of progressive renal injury by genetic manipulation of Klotho gene. Proc. Natl Acad. Sci. USA 104, 23312336.
  • Imura A., Iwano A., Tohyama O., Tsuji Y., Nozaki K., Hashimoto N., Fujimori T. and Nabeshima Y. I. (2004) Secreted Klotho protein in sera and CSF: implication for post-translational cleavage in release of Klotho protein from cell membrane. FEBS Lett. 565, 143147.
  • Imura A., Tsuji Y., Murata M. et al. (2007) α-Klotho as a regulator of calcium homeostasis. Science 316, 16151618.
  • Ito S., Kinoshita S., Shiraishi N., Nakagawa S., Sekine S., Fujimori T. and Nabeshima Y. I. (2000) Molecular cloning and expression analyses of mouse βklotho, which encodes a novel Klotho family protein. Mech. Dev. 98, 115119.
  • Johnson L., van Veen T. and Ekström P. A. R. (2005) Differential Akt activation in the photoreceptors of normal and rd1 mice. Cell Tissue Res. 320, 213222.
  • Kajiwara K., Hahn L., Mukai S., Travis G., Berson E. and Dryja T. (1991) Mutations in the human retinal degeneration slow gene in autosomal dominant retinitis pigmentosa. Nature 354, 480483.
  • Kamemori M., Ohyama Y., Kurabayashi M., Takahashi K., Nagai R. and Furuya N. (2002) Expression of Klotho protein in the inner ear. Hear. Res. 171, 103110.
  • Kaur J., Mencl S., Sahaboglu A., Farinelli P., van Veen T., Zrenner E., Ekström P., Paquet-Durand F. and Arango-Gonzalez B. (2011) Calpain and PARP activation during photoreceptor cell death in P23H and S334ter rhodopsin mutant rats. PLoS ONE 6, e22181.
  • Kosakai A., Ito D., Nihei Y., Yamashita S., Okada Y., Takahashi K. and Suzuki N. (2011) Degeneration of mesencephalic dopaminergic neurons in klotho mouse related to vitamin D exposure. Brain Res. 1382, 109117.
  • Kuro-o M., Matsumura Y., Aizawa H. et al. (1997) Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 390, 4551.
  • Kurose H., Bito T., Adachi T., Shimizu M., Noji S. and Ohuchi H. (2004) Expression of Fibroblast growth factor 19 (Fgf19) during chicken embryogenesis and eye development, compared with Fgf15 expression in the mouse. Gene Expr. Patterns 4, 687693.
  • Kurosu H., Yamamoto M., Clark J. D. et al. (2005) Suppression of aging in mice by the hormone Klotho. Science 309, 18291833.
  • Kurosu H., Ogawa Y., Miyoshi M. et al. (2006) Regulation of fibroblast growth factor-23 signaling by klotho. J. Biol. Chem. 281, 61206123.
  • Liu C., Li Y., Peng M., Laties A. M. and Wen R. (1999) Activation of caspase-3 in the retina of transgenic rats with the rhodopsin mutation S334ter during photoreceptor degeneration. J. Neurosci. 19, 47784785.
  • Liu S., Vierthaler L., Tang W., Zhou J. and Quarles L. D. (2008) FGFR3 and FGFR4 do not mediate renal effects of FGF23. J. Am. Soc. Nephrol. 19, 23422350.
  • Liu F., Wu S., Ren H. and Gu J. (2011) Klotho suppresses RIG-I-mediated senescence-associated inflammation. Nat. Cell Biol. 13, 254262.
  • Matsumura Y., Aizawa H., Shiraki-Iida T., Nagai R., Kuro-o M. and Nabeshima Y. I. (1998) Identification of the human klotho gene and its two transcripts encoding membrane and secreted Klotho protein. Biochem. Biophys. Res. Commun. 242, 626630.
  • Mitani H., Ishizaka N., Aizawa T. et al. (2002) In vivo klotho gene transfer ameliorates angiotensin II-induced renal damage. Hypertension 39, 838843.
  • Mitobe M., Yoshida T., Sugiura H., Shirota S., Tsuchiya K. and Nihei H. (2005) Oxidative stress decreases klotho expression in a mouse kidney cell line. Nephron Exp. Nephrol. 101, e67e74.
  • Nagai T., Yamada K., Kim H. C., Kim Y. S., Noda Y., Imura A., Nabeshima Y. I. and Nabeshima T. (2002) Cognition impairment in the genetic model of aging klotho gene mutant mice: a role of oxidative stress. FASEB J. 17, 5052.
  • Paquet-Durand F., Azadi S., Hauck S. M., Ueffing M., van Veen T. and Ekström P. (2006) Calpain is activated in degenerating photoreceptors in the rd1 mouse. J. Neurochem. 96, 802814.
  • Paquet-Durand F., Silva J., Talukdar T., Johnson L. E., Azadi S., van Veen T., Ueffing M., Hauck S. M. and Ekström P. A. R. (2007) Excessive activation of poly(ADP-ribose) polymerase contributes to inherited photoreceptor degeneration in the retinal degeneration 1 mouse. J. Neurosci. 27, 1031110319.
  • Pierce E. A. (2001) Pathways to photoreceptor cell death in inherited retinal degenerations. BioEssays 23, 605618.
  • Sahaboglu A., Paquet-Durand O., Dietter J., Dengler K., Bernhard-Kurz S., Ekström P. A. R., Hitzmann B., Ueffing M. and Paquet-Durand F. (2013) Retinitis Pigmentosa: Rapid neurodegeneration is governed by slow cell death mechanisms. Cell Death Dis. 4, e488.
  • Saito Y., Nakamura T., Ohyama Y., Suzuki T., Iida A., Shiraki-Iida T., Kuro-o M., Nabeshima Y. I., Kurabayashi M. and Nagai R. (2000) In vivo klotho gene delivery protects against endothelial dysfunction in multiple risk factor syndrome. Biochem. Biophys. Res. Commun. 276, 767772.
  • Sancho-Pelluz J., Arango-Gonzalez B., Kustermann S., Romero F., van Veen T., Zrenner E., Ekström P. and Paquet-Durand F. (2008) Photoreceptor cell death mechanisms in inherited retinal degeneration. Mol. Neurobiol. 38, 253269.
  • Sancho-Pelluz J., Alavi M., Sahaboglu A., Kustermann S., Farinelli P., Azadi S., van Veen T., Romero F., Paquet-Durand F. and Ekström P. (2010) Excessive HDAC activation is critical for neurodegeneration in the rd1 mouse. Cell Death Dis. 1, e24.
  • Sanyal S. and Bal A. K. (1973) Comparative light and electron microscopic study of retinal histogenesis in normal and rd mutant mice. Z. Anat. Entwicklungsgesch. 142, 219238.
  • Shiozaki M., Yoshimura K., Shibata M., Koike M., Matsuura N., Uchiyama Y. and Gotow T. (2008) Morphological and biochemical signs of age-related neurodegenerative changes in klotho mutant mice. Neuroscience 152, 924941.
  • Siffroi-Fernandez S., Felder-Schmittbuhl M. P., Khanna H., Swaroop A. and Hicks D. (2008) FGF19 exhibits neuroprotective effects on adult mammalian photoreceptors in vitro. Invest. Ophthalmol. Vis. Sci. 49, 16961704.
  • Sugiura H., Yoshida T., Mitobe M., Yoshida S., Shiohira S., Nitta K. and Tsuchiya K. (2010) Klotho reduces apoptosis in experimental ischaemic acute kidney injury via HSP-70. Nephrol. Dial. Transplant. 25, 6068.
  • Sung C. H., Schneider B. G., Agarwal N., Papermaster D. S. and Nathans J. (1991) Functional heterogeneity of mutant rhodopsins responsible for autosomal dominant retinitis pigmentosa. Proc. Natl Acad. Sci. USA 88, 88408844.
  • Takumida M., Ishibashi T., Hamamoto T., Hirakawa K. and Anniko M. (2009) Age-dependent changes in the expression of klotho protein, TRPV5 and TRPV6 in mouse inner ear. Acta Otolaryngol. 129, 13401350.
  • Thurston R. D., Larmonier C. B., Majewski P. M. et al. (2010) Tumor necrosis factor and interferon-γ down-regulate Klotho in mice with colitis. Gastroenterology 138, 13841394.
  • Wang Y. and Sun Z. (2009) Current understanding of klotho. Ageing Res. Rev. 8, 4351.
  • Willbold E. and Layer P. G. (1992) (1992) A hidden retinal regenerative capacity from the chick ciliary margin is reactivated in vitro, that is accompanied by down-regulation of butyrylcholinesterase. Eur. J. Neurosci. 4(3), 210220.
  • Wu X., Ge H., Gupte J. et al. (2007) Co-receptor requirements for fibroblast growth factor-19 signaling. J. Biol. Chem. 282, 2906929072.
  • Yamamoto M., Clark J. D., Pastor J. V. et al. (2005) Regulation of oxidative stress by the anti-aging hormone klotho. J. Biol. Chem. 280, 3802938034.
  • Young R. (1985) Cell differentiation in the retina of the mouse. Anat. Rec. 212, 199205.
  • Zhang D. and Yeh H. (1991) Protein kinase C-like immunoreactivity in rod bipolar cells of the rat retina: a developmental study. Vis. Neurosci. 6, 429437.
  • Zhang X., Ibrahimi O. A., Olsen S. K., Umemori H., Mohammadi M. and Ornitz D. M. (2006) Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family. J. Biol. Chem. 281, 1569415700.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
FilenameFormatSizeDescription
jnc12353-sup-0001-FigS1-S3_TableS1.pdfapplication/PDF453K

Figure S1. α-Klotho co-localizes with stress markers.

Figure S2. Expression of β-Klotho in wt and rd1 retina.

Figure S3. FGF15/19 and FGFR4 expression in mouse mutants.

Table S1. List of antibodies and dilutions (n.a. = not applicable)

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.