SEARCH

SEARCH BY CITATION

Keywords:

  • all-trans retinoic acid;
  • apoptosis;
  • E2F3;
  • glioblastoma;
  • miR-302b

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References
Thumbnail image of graphical abstract

All-trans retinoic acid (ATRA), a derivative of retinoid, is involved in the onset of differentiation and apoptosis in a wide variety of normal and cancer cells. MicroRNAs (miRNAs) are small non-coding RNAs that control gene expression. Several miRNAs were identified to participate in ATRA-mediated cell differentiation. However, no studies have demonstrated whether miRNA can enhance ATRA cytotoxicity, thereby resulting in cell apoptosis. This study investigated the effects of ATRA-mediated miRNA expression in activating apoptotic pathways in glioblastoma. First, we found that high-dose ATRA treatment significantly reduced cell viability, caspase-dependent apoptosis, endoplasmic reticular (ER) stress activation, and intracellular reactive oxygen species accumulation. From microarray data, miR-302b was analyzed as a putative downstream regulator upon ATRA treatment. Furthermore, we found that ATRA up-regulated miR-302b expression in a dose- and time-dependent manner through retinoic acid receptor α-mediated pathway. Overexpression and knockdown of miR-302b significantly influenced ATRA-mediated cytotoxicity. E2F3, an important transcriptional regulator of glioma proliferation, was validated to be a direct target gene of miR-302b. The miR-302b-reduced E2F3 levels were also identified to be associated with ATRA-mediated glioma cell death. These results emphasize that an ATRA-mediated miR-302b network may provide novel therapeutic strategies for glioblastoma therapy.

We propose that high-dose all-trans retinoic acid (ATRA) treatment, a derivative of retinoid, significantly induces glioblastoma cell apoptosis via caspase-dependent apoptosis, endoplasmic reticular (ER) stress, and intracellular reactive oxygen species (ROS) accumulation. The miR-302b overexpression enhanced by ATRA-mediated retinoic acid receptor (RAR)α pathway was also identified. The E2F3 repression, a novel target gene of miR-302b, was involved in ATRA-induced glioblastoma cell cytotoxicity.

Abbreviations used
ATRA

all-trans retinoic acid

DHR123

dihydrorhodamine 123

DMSO

dimethylsulfoxide

ER

endoplasmic reticular

GBM

Glioblastoma multiforme

NAC

N-acetylcysteine

PARP

poly ADP ribose polymerase

PBS

phosphate-buffered saline

PI

propidium iodide

RAR

retinoic acid receptor

ROS

reactive oxygen species

SDS

sodium dodecylsulfate

Glioblastoma multiforme (GBM), a grade IV glioma, is the most common and aggressive primary brain tumor with a poor prognosis in adults (Friedman et al. 2000). The median survival time in most GBM patients is <12 months. Since the malignant gliomas are highly mobile and invasive, it is difficult to completely resect through surgery (Gunther et al. 2003; Lin et al. 2012). Therefore, radiation and chemotherapy are generally used as adjuvant therapies after surgical treatment. Temozolomide, which is able to penetrate the blood–brain barrier, is an alkylating agent of the imidazotetrazine series and the major chemotherapeutic drug for clinically treating malignant gliomas. As a result of the malignant progression and widespread invasion throughout the brain by GBM, the gradually increasing drug resistance of temozolomide obviously decreases the therapeutic effects on patients. In addition, the course of temozolomide treatment lasts a lifetime which may cause financial burdens. Consequently, investigating innovative therapeutic strategies to effectively inhibit tumor formation and elongate survival times is a pressing issue in the clinical therapy of glioblastomas.

MicroRNAs (miRNAs) are a novel class of endogenous, small, non-coding RNAs that control gene expression by binding to their target messenger (m)RNAs for degradation and/or translational repression. Variant miRNA levels are involved in regulating various cellular processes including differentiation, proliferation, and apoptosis. The role of miRNAs in GBM development was recently revealed (Karsy et al. 2012; Auffinger et al. 2013). For example, miRNA-21 (miR-21), an oncogenic miRNA, was identified to protect U87 MG cells from temozolomide-induced apoptosis (Shi et al. 2010). Conversely, miR-128 downregulates E2F3a and Bim-1 expressions to inhibit glioblastoma proliferation (Cui et al. 2010). However, knowledge of the function and role of miRNAs in GBM formation is still in the nascent stage, and greater efforts are needed to obtain a better understanding of this unexplored field.

MiR-302-367 clusters, consisting of miR-302a, miR-302b, miR-302c, miR-302d, and miR-367, are the most abundant miRNAs in human embryonic stem cells (Barroso-del Jesus et al. 2009). These miRNAs were shown to regulate self-renewal and pluripotency processes, and therefore are considered potential stemness regulators of embryonic stem cells. Furthermore, increasing evidence suggests that members of the miR-302-367 cluster also play a suppressive role in regulating tumor development, especially miR-302b. The miR-302b was reported to suppress cell proliferation in hepatocellular carcinoma (Wang et al. 2013a), endometrial cancer (Yan et al. 2013), cervical carcinoma (Cai et al. 2013), and gastric adenocarcinoma (Khalili et al. 2012). Several target genes of miR-302b were also identified, including cyclin D1 and Cyclin-dependent kinase 1, which are cell–cycle regulators. Those findings suggest that miR-302b has tumor-suppressive functions in carcinogenesis. However, no studies have focused on the role of miR-302b in regulating glioblastoma formation. Furthermore, the effects of miR-302b-regulated mechanisms are still unclear in regulating glioblastoma cell proliferation.

All-trans retinoic acid (ATRA) is a derivative of retinoic acid and can be used as a differentiating agent at a low dose (1 μM). Conversely, high-dose ATRA treatment (>40 μM) showed therapeutic effects in inhibiting solid tumor formation, including glioblastomas (Brtko 2007; Haque et al. 2007a; Kast 2008). Furthermore, alone or in combination with other therapeutic drugs, ATRA significantly enhanced glioma cell death and reduced glioblastoma formation (Haque et al. 2007a,b; Karmakar et al. 2007, 2008). In addition, several miRNAs, such as let-7c and miR-15a/16-1, were reported to be involved in ATRA-induced cell differentiation (Gao et al. 2011; Pelosi et al. 2013). However, whether ATRA can regulate miRNA expression in mediating cell death is still unclear. In the present study, we identified that ATRA induced glioblastoma U87 MG cell death via mitochondria/endoplasmic reticular (ER) stress/reactive oxygen species (ROS)-dependent apoptotic pathways. We also found that ATRA regulated miR-302b upregulation, which resulted in significant cell death. Finally, miR-302b-targeted E2F3 expression was validated to be involved in ATRA-mediated glioblastoma cell death.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

Materials

Human glioblastoma U87 MG cells classified as grade IV were purchased from the Bioresource Collection and Research Center (Hsinchu, Taiwan). Other cell culture-related reagents were purchased from GIBCO-BRL (Grand Island, NY, USA). Anti-caspase-3, caspase-8, caspase-9, poly ADP ribose polymerase (PARP), retinoic acid receptor (RAR)-α, E2F3, and β-actin antibodies were purchased from GeneTex (Hsinchu, Taiwan). The ATRA, H2DCFH-DA, rhodamine 123, annexin V, propidium iodide (PI), and N-acetylcysteine (NAC) were purchased from Sigma-Aldrich (St. Louis, MO USA). Dihydroethidium (HEt), and dihydrorhodamine 123 (DHR123) were purchased from Molecular Probes (Eugene, OR, USA). Polyvinylidene difluoride membranes and enhanced chemiluminescence solutions were purchased from Millipore (Billerica, MA, USA). Trizol® reagent, lipofectamine 2000, and secondary antibodies were purchased from Invitrogen (Carlsbad, CA, USA). The SYBR® Green PCR Master Mix, MultiScribe (tm) Reverse Transcriptase Kit, TaqMan® miR-302b, and U6B Assays were purchased from Applied Biosystems (Carlsbad, CA, USA). The Luciferase Assay System was purchased from Promega (Madison, WI, USA). Primer sets were synthesized by the Mission Biotech (Nankang, Taiwan). RARα short hairpin (sh)RNAs were purchased from the National RNAi Core Facility (Nankang, Taiwan). Unless otherwise specified, all other reagents were of analytical grade.

Cell culture, treatments, and transfections

U87 MG cells were maintained in modified Eagle's medium, and supplemented with 10% fetal bovine serum (Biological Industries, Israel), 100 units/mL penicillin, 100 μg/mL streptomycin, 1 mM sodium pyruvate, and 1 mM nonessential amino acids at 37°C in a 5% CO2 incubator. For ATRA treatment, different doses of ATRA were added to overnight-cultured U87 MG cells for the indicated times. For NAC treatment, 1 mM NAC was pretreated for 1 h, then ATRA was added to overnight-cultured U87 MG cells for another 24 h. Since ATRA and NAC were, respectively, dissolved in dimethylsulfoxide (DMSO) solution, the equal volume of DMSO solution as ATRA or NAC was used as control in each experiment. To conduct transfection experiments, U87 MG cells were seeded into a 12-well plate at a density of 105 cells/well. After achieving 70% confluence in a well, scrambled/RARα shRNAs (1 μg), 50 nM of an miR-302b mimic, 100 nM of an miR-302b inhibitor, and 200 ng of pMIRGLO-E2F3-3′UTR plasmids were, respectively, transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 24 h of incubation, U87 MG cells were lysed for further studies.

Cell viability assay

Cell viability was determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5- 4 diphenyltetrazolium bromide (MTT) assay. Cells were seeded on a 96-well plate at 8000 cells/well overnight, followed by treatment with various concentrations of ATRA for another 24 h. Before the end of the treatment, 0.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide was added to each well for 4 h. The supernatants were carefully aspirated, and formazan crystals were dissolved using DMSO. The absorbance was measured at 550 nm with a Thermo Varioskan Flash reader (Thermo Fisher Scientific Inc., Waltham, MA, USA).

Detection of apoptosis

Apoptosis was analyzed using flow cytometry with annexin V/PI double-staining to detect membrane events. In brief, after treatment with ATRA for 24 h, whole cells were collected in HEPES buffer containing 10 mM HEPES (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2. Subsequently, cells were stained with an antibody against annexin V (2.5 μg/mL) and PI (2 ng/mL) for 20 min, followed by analysis on a flow cytometer using CellQuest software (Becton, Dickinson and Company, Franklin Lakes, NJ, USA). In each flow cytometrical experiment, 10 000 cells were detected. The cytogram of the four quadrants in the figures was used to distinguish the normal (annexin V/PI), early apoptotic (annexin V+/PI), late apoptotic (annexin V+/PI+), and necrotic (annexin V/PI+) cells. The sum of early apoptosis and late apoptosis was presented as total apoptosis.

Measurement of the mitochondrial membrane potential (MMP; ΔΨm)

The MMP was measured by flow cytometry using the cationic lipophilic fluorochrome, rhodamine-123 (Molecular Probes). After treatment with ATRA for 24 h, cells were again incubated with 20 nM rhodamine-123 at 37°C for 20 min. Cells were then washed twice with phosphate-buffered saline (PBS; 3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl, pH 7.4), and the rhodamine-123 intensity was determined by flow cytometry. Fluorescence was measured on a flow cytometer using CellQuest software. Cells with reduced fluorescence (i.e., with less rhodamine-123) were counted as having lost some of their MMP.

Measurement of ROS

Intracellular levels of hydrogen peroxide (H2O2) and superoxide anion (inline image) were, respectively, detected using H2DCFH-DA and HEt probes. H2DCFH-DA and HEt are oxidized by H2O2 and inline image and then, respectively, emit green and red fluorescence. Furthermore, the DHR123 probe can enter mitochondria, and the green fluorescence represents the mitochondrial H2O2 level. Cells were collected at the appropriate time points after various treatments. After trypsinization, cells were resuspended and stained with 10 μM H2DCFH-DA, 5 μM HEt, or 5 μM DHR123 for 30 min at 37°C in the dark. The fluorescence was measured on a flow cytometer using CellQuest software. The percentage increase in the fluorescence peak was used to represent the level of ROS production.

Sub-G1 analysis

The sub-G1 distribution was determined by staining DNA with PI. Briefly, 106 cells were incubated with ATRA for 24 h. Cells were then washed in PBS and fixed in 70% ethanol. Cells were again washed with PBS and then incubated with PI (10 μg) with simultaneous treatment of RNase at 37°C for 30 min. Percentages of cells with sub-G1 DNA content were measured with a BD flow cytometer and analyzed using CellQuest software.

RNA isolation and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from cultured cells using Trizol® according to the manufacturer's instructions. The RNA quality was checked using A260/A280 readings. Complementary (c) DNA was synthesized from 1 μg total RNA using a random primer and the MultiScribe (tm) Reverse Transcriptase Kit (Life Technologies Corporation, Carlsbad, CA, USA). To detect miRNA and U6B, cDNA was synthesized by TaqMan® MicroRNA assays. The kits (Applied Biosystems) used in the present study could specifically and separately detect miR-302b. The cDNA was diluted by 1 : 30 with PCR-grade water and then stored at −20°C. For the quantitative real-time PCR, specific primers were: E2F3-F primer TGGTACCATTGAGTTGCTGCTATT and E2F3-R primer AGCTCATGTGTTGCCCTTTATACA; and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-F primer GTGAAGGTCGGAGTCAAC and GAPDH-R primer GTTGAGGTCAATGAAGGG. The gene expression level was quantified with an ABI 7300 real-time PCR machine (Applied Biosystems) with pre-optimized conditions. Each PCR was performed in duplicate using 5 μL 2× SYBR Green PCR Master Mix, 0.2 μL primer sets, 1 μL cDNA, and 3.6 μL nucleotide-free H2O to yield a 10-μL reaction. Expression rates were calculated as the normalized CT difference between the control and sample with adjustment for the amplification efficiency relative to the expression level of the housekeeping gene, GAPDH. To quantify miR-302b expression levels, U6B was used as an internal control.

Construction of the E2F3 3′UTR reporter plasmid and mutagenesis

The PCR was performed using sets of primers specific for the E2F3 3′UTR, of which the forward primer was XhoI-site-linked and the reverse primer XbaI-site-linked. The respective forward and reverse primers were TAACTCGAGTGG CGTAGTATCTCCGGTCCATT and TAATCTAGAATTCCTTTCATTTTAAAAACA. U87 MG genomic DNA was used as the template. The 740-base pair (bp) PCR products were digested with XhoI and XbaI, and cloned downstream of the luciferase gene in the pMIRGLO-REPORT luciferase vector (Promega). This vector was sequenced and named pMIRGLO-E2F3-3′UTR. Site-directed mutagenesis of the miR-302b target site in the E2F3-3′UTR was carried out using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, Heidelberg, Germany), and the vector was named pMIRGLO-E2F3-3′UTR-mutant. The primer was AAGACAGATGACACCAGAGACCTAAACTCTTTGTGTG. For the reporter assays, cells were transiently transfected with wild-type or mutant reporter plasmids, and a miR-302b mimic using Lipofectamine 2000 (Invitrogen). A reporter assay was performed at 24 h post-transfection using the Luciferase Assay System (Promega). The dual Renilla luciferase value was used as the internal control.

Immunoblot analysis

Cells were harvested in ristocetin-induced platelet agglutination buffer [1% Nonidet P-40, 0.5% deoxycholate, and 0.1% sodium dodecylsulfate (SDS) in PBS] containing a protease inhibitor cocktail (Calbiochem, Billerica, MA, USA) and centrifuged at 13 000 g) for 10 min at 4°C. The supernatant was used as the total cell lysate. Lysates (20 μg) were denatured in 2% SDS, 10 mM dithiothreitol, 60 mM Tris-hydrochloric acid (Tris-HCl, pH 6.8), and 0.1% bromophenol blue, and loaded onto a 10%~15% polyacrylamide/SDS gel. The separated proteins were then transferred onto a polyvinylidene difluoride membrane. The membrane was blocked for 1 h at 25°C in PBS containing 5% non-fat dry milk and incubated overnight at 4°C in PBS-T (1x PBS containing 0.5% Tween-20) containing the primary antibody. The 1/1000 dilution of 1 mg/mL anti-caspase-3, caspase-8, caspase-9, poly ADP ribose polymerase (PARP), retinoic acid receptor (RAR)-α, E2F3, and β-actin antibodies (GeneTex) were, respectively, used as primary antibodies. The membrane was washed in PBS-T, incubated with the secondary antibody conjugated with horseradish peroxidase for 1 h at 25°C, and then washed in PBS-T. The enhanced chemiluminescence nonradioactive detection system was utilized to detect the antibody–protein complexes by photographing with ChemiDoc XRS System (Bio-Rad Laboratories, Hercules, CA, USA).

Statistical analysis

All data are presented as the mean ± standard deviation (SD). Significant differences among groups were determined using unpaired Student's t-test. A value of < 0.05 was taken as an indication of statistical significance. All figures shown in this article were obtained from at least three independent experiments with similar results.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

ATRA induces apoptotic death in U87 MG cells

To study the effects of high concentrations ATRA on U87 MG cells, cell viability was measured after treatment with different doses of ATRA. As shown in Fig. 1a, ATRA significantly induced U87 MG cell death in a dose- and time-dependent manner. Compared to the control, 40 and 60 μM ATRA, respectively, reduced the viability of U87 MG cells by 35% and 62% after 24 h treatment. To investigate the mode of ATRA-mediated cell death, annexin V/PI double-staining was used with a flow cytometric analysis. A dose-dependent increase in the percentage of apoptotic cells was observed after a dose course of ATRA treatment (Fig. 1b). A few necrotic cells were also found in ATRA-treated U87 MG cells. Furthermore, ATRA obviously enhanced caspase-3 activation, PARP degradation, and sub-G1 accumulation in a dose-dependent manner (Fig. 1c, d). All results showed that ATRA mediated a caspase-dependent apoptotic pathway in U87 MG cell death.

image

Figure 1. All-trans retinoic acid (ATRA) induces cell apoptosis via caspase-dependent pathways. U87 MG cells were treated with different doses of ATRA for 24 h or the indicated times. The dimethylsulfoxide (DMSO) was used as control. Cell viability (a), modes of cell death (b), apoptotic markers (c), and sub-G1 accumulation (d) were respectively measured by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometry with annexin V/propidium iodide (PI) staining, immunoblotting with anti- PARP (PARP)/anti-caspase 3/anti-β-actin antibodies, and flow cytometry with PI staining. The right panels in (b) and (d) are representative of statistical results with three independent experiments. Data are the mean ± SD of three experiments. *< 0.05.

Download figure to PowerPoint

Mitochondrial dysfunction, ER stress activation, and intracellular ROS generation are highly associated with ATRA-induced cell death

A previous study (Das et al. 2009) showed that 1 μM ATRA could induce caspase-8 activation and produce a mild effect on caspase-9 activation in U87 MG cells. To investigate whether high concentrations of ATRA could also enhance similar mechanisms as low-dose treatment, rhodamine 123 stains with a flow cytometric analysis and an immunoblotting assay were conducted. As shown in Fig. 2a, a dose-dependent decrease in the MMP (ΔΨm) was found in ATRA-treated cells. ATRA at 60 μM significantly reduced the ΔΨm by 44% compared to the control. Caspase-9 activation, Bcl2 degradation, Bax increase, and cytochrome c release were also found (Fig. 2f). Furthermore, caspase-8 activation was also involved in ATRA-mediated cell death. Taken together, ATRA-mediated cell apoptotic death via intrinsic and extrinsic pathways.

image

Figure 2. Mitochondrial dysfunction and reactive oxygen species (ROS) accumulation are involved in all-trans retinoic acid (ATRA)-induced cell death. After U87 MG cells were treated with different doses of ATRA for 24 h, the mitochondrial membrane potential (ΔΨm) (a), levels of cytosolic H2O2 (b), mtH2O2 (c), and inline image (d) were analyzed using flow cytometry with rhodamine 123, H2DCFH-DA, dihydrorhodamine 123 (DHR123), and HEt staining. The right panels in (a–d) are representative of statistical results from three independent experiments. (e) Inhibition of ROS generation attenuates ATRA-induced cell death. After pretreatment with 1 mM N-acetylcysteine (NAC) for 1 h, cells were treated with 60 μM ATRA for another 24 h. Cell viability was measured with an 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. (f) ATRA induced caspase-8/9 activation, cytochrome c release, an increase in the Bax/Bcl2 ratio, and Grp78/CHOP upregulation resulting in cell death. After cells were treated with various doses of ATRA for 24 h, the protein levels were detected by an immunoblotting assay. Data are the mean ± SD of three experiments. *< 0.05.

Download figure to PowerPoint

ER stress was reported to be triggered by ATRA treatment (Xu et al. 2007). Since ROS generation is a well-established downstream event upon ER stress activation, we next explored whether ATRA treatment could cause an increase in intracellular ROS. As shown in Fig. 2b, ATRA induced a dose-dependent increase in intracellular ROS levels. A six-fold elevation in the ROS level compared to the control was observed with 60 μM ATRA treatment (Fig. 2b right panel). Furthermore, the mitochondrial (mt)H2O2 and intracellular inline imagelevels, respectively, originating from mitochondria and ER, were also measured. ATRA significantly enhanced levels of mtH2O2 and intracellular inline image by 34% and 13%, respectively (Fig. 2c and d). To further identify the effect of ROS in ATRA-mediated cell death, a ROS scavenger, NAC, was used. NAC treatment obviously attenuated ATRA-induced cell death (Fig. 2e). Moreover, increases in both CHOP and GRP78 are well-established ER stress activation markers. We found that ATRA significantly enhanced CHOP and GRP78 expressions (Fig. 2f). Therefore, mitochondrial dysfunction, ER stress activation, and intracellular ROS generation were significantly related to ATRA-mediated cell death.

ATRA increased miR-302b expression via a RARα-mediated pathway

MiRNAs are important modulators of gene regulation. Next, we explored whether ATRA could regulate miRNA expression, which resulted in cell death. According to the microarray data of GSE17227 from the gene expression omnibus data sets data sets, miRNA signatures were conducted by a microarray-based gene expression analysis in five glioblastoma spheroid cultures with ATRA treatment. The raw data were recalculated and are shown in Table 1. Interestingly, ATRA obviously up-regulated several members of the miR-302 family, including miR-302a, miR-302b, and miR-302d. Levels of miR-302b showed the most significant increase after ATRA treatment, and several studies demonstrated that miR-302b expression was down-regulated during tumorigenesis (Khalili et al. 2012; Zhang et al. 2013). Thus, we focused on the effect of miR-302b in ATRA-mediated cell death in a further experiment.

Table 1. All-trans retinoic acid (ATRA)-induced microRNA expression profile
Up-regulatedMultiple of changeDown-regulatedMultiple of change
  1. The * indicates the miRNA expressed at low levels relative to the miRNA in the opposite arm of a hairpin.

hsa-miR-302b9.88hsa-miR-19a−5.43
hsa-miR-302a8.25hsa-miR-19b−3.67
hsa-miR-302d4.15hsa-miR-551b−3.43
hsa-miR-30a*2.93hsa-miR-101−2.70
hsa-miR-146a2.49hsa-miR-301a−2.64
HS_2822.13hsa-miR-199b-5p−2.59
hsa-miR-2242.03hsa-miR-455-5p−2.51
hsa-miR-135a1.88hsa-miR-565−2.34
hsa-miR-1371.75hsa-miR-107−2.17
hsa-miR-2121.66hsa-miR-216a−2.16
hsa-miR-628-3p1.65hsa-miR-32−2.14
HS_941.63hsa-miR-33a−2.06
hsa-miR-200c1.58hsa-miR-17-5p−1.98
hsa-miR-146b-5p1.58hsa-miR-497−1.96
hsa-miR-1361.53hsa-miR-210−1.89

To reconfirm the microarray data, intracellular miR-302b levels were measured in ATRA-treated U87 MG cells. As shown in Fig. 3a and b, both dose- and time-course increases in miR-302b expression were identified by ATRA treatment. More than a 2-fold increase in the miR-302b level compared to the control was measured after 12 h of treatment with 40 μM ATRA. Since ROS played a critical role in ATRA-mediated cell death, we then investigated whether ATRA regulated miR-302b expression via ROS generation. Surprisingly, inhibition of ROS generation by NAC treatment did not influence ATRA-mediated miR-302b expression (Fig. 3c). Because RARα-mediated gene expression is a well-known downstream regulator of ATRA, we then studied whether RARα was involved in miR-302b expression regulated by ATRA. Significantly reduced endogenous RARα levels were identified by transfection with 1 μg RARα-shRNA (Fig. 3d). Furthermore, knockdown of RARα expression obviously reduced ATRA-induced miR-302b upregulation (Fig. 3e). All of the results suggested that the ATRA-mediated RARα signaling pathway played an important role in regulating miR-302b gene expression.

image

Figure 3. All-trans retinoic acid (ATRA) upregulates miR-302b expression via a retinoic acid receptor (RAR)α-mediated pathway, but not reactive oxygen species (ROS). ATRA enhanced miR-302b levels in a dose- (a) and time-dependent (b) manner. (c) Inhibition of ROS generation did not influence ATRA-mediated miR-302b expression. After U87 MG cells were treated with different doses of ATRA for 24 h, 40 μM ATRA for the indicated times, or 40 μM ATRA with N-acetylcysteine (NAC), intracellular miR-302b levels were measured using a real-time PCR. (d) The effects of RARα shRNA on endogenous RARα levels. (e) Knockdown of RARα levels significantly reduced ATRA-regulated miR-302b expression. After cells were transfected with 1 μg of RARα shRNA or combined with ATRA treatment for 24 h, intracellular RARα and miR-302b levels were respectively measured using immunoblotting and a real-time PCR. Data are the mean ± SD of three experiments. *< 0.05.

Download figure to PowerPoint

MiR-302b is involved in ATRA-mediated cell death

To investigate the role of miR-302b in ATRA-mediated cell death, overexpression and knockdown of miR-302b levels were, respectively, conducted using miR-302b mimic and inhibitor. Overexpression of miR-302b combined with ATRA treatment significantly enhanced ATRA-reduced cell viability (Fig. 4a), caspase-3 activation, PARP degradation (Fig. 4b), and sub-G1 accumulation (Fig. 4c and d) in U87 MG cells. Furthermore, we also found that the miR-302b mimic alone showed a mild effect of inducing cell death, suggesting that miR-302b has a tumor-suppressive function. Conversely, inhibition of miR-302b expression significantly attenuated ATRA-induced cell death, caspase-3 activation, PARP degradation, and sub-G1 accumulation (Fig. 4). All these data suggested that ATRA-mediated U87 MG cell death via miR-302b-regulated signaling pathways.

image

Figure 4. miR-302b is involved in an all-trans retinoic acid (ATRA)-induced cell apoptotic pathway. After U87 MG cells were transfected with 50 nM of an miR-302b mimic and a scrambled control mimic or 100 nM of a miR-302b inhibitor and a scrambled control inhibitor, ATRA was added for another 24 h. Cell viability (a), apoptotic markers (b), and sub-G1 accumulation (c and d) were respectively measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometry with annexin V/propidium iodide (PI) staining, and PI staining. Panel D is representative of statistical results from three independent experiments. Data are the mean ± SD of three experiments. *< 0.05.

Download figure to PowerPoint

ATRA-induced miR-302b expression regulates E2F3 levels

It was reported that aberrant E2F3 levels, a potent transcriptional inducer of cell-cycle progression, were overexpressed and highly associated with glioblastoma progression (Cui et al. 2010; Serao et al. 2011). Furthermore, ATRA significantly reduced E2F3 expression resulting in neuroblastoma cell death (Welch et al. 2007). To investigate whether ATRA could also repress E2F3 expression in mediating U87 MG cell death, the endogenous E2F3 level after ATRA treatment was measured by immunoblotting. E2F3 expression dose-dependently decreased in ATRA-treated cells (Fig. 5a). According to a TargetScan analysis (Lewis et al. 2005), miR-302b was predicted to bind to the E2F3 3′UTR (Fig. 5b). To further confirm that E2F3 is a miR-302b target gene, the E2F3 3′UTR containing the miR-302b binding site was cloned into the pMIRGlo-reporter plasmid. As shown in Fig. 5c, different concentrations of the miR-302b mimic significantly decreased luciferase activity. To further validate E2F3 as a miR-302b direct target gene, five nucleotides located in the critical binding region of the E2F3 3′UTR were mutated by site-directed mutagenesis (Fig. 5b). As shown in Fig. 5d, the miR-302b mimic did not have an effect on luciferase activity after mutating the miR-302b-targeted site. We also directly tested the effect of miR-302b on E2F3 expression and found that transient transfection of the miR-302b mimic into U87 MG cells significantly and dose-dependently decreased E2F3 mRNA and protein levels (Fig. 5e and f). Accordingly, the above experiments validated E2F3 as a miR-302b target gene. To further identify if miR-302b is actually involved in ATRA-repressed E2F3 expression, we measured E2F3 levels after transfection of the miR-302b mimic or inhibitor combined with ATRA treatment. As shown in Fig. 5g, overexpression or knockdown of miR-302b expression significantly influenced ATRA-reduced E2F3 expression levels. Taken together, E2F3 expression levels could be inhibited by ATRA-induced miR-302b upregulation.

image

Figure 5. All-trans retinoic acid (ATRA) reduced E2F3 expression through targeting miR-302b. (a) ATRA dose-dependently inhibited E2F3 levels. (b) A schematic diagram of potential miR-302b-targeted sites in the E2F3 3′UTR. (c and d) Effects of miR-302b on E2F3 3′UTR luciferase activity. To test for miR-302b's effect, different doses of miR-302b mimic were co-transfected with 500 ng pMiRGlo-E2F3 3′-UTR or mutant 3′-UTR. Luciferase activity was measured in these cells at 24 h after transfection. (e and f) MiR-302b mimic decreased E2F3 expression in a dose-dependent manner. After cells were respectively transfected with the indicated dose of the miR-302b mimic for 24 h, the relative mRNA (e) and protein (f) levels of E2F3 were analyzed using a real-time PCR and immunoblotting assay. (g) MiR-302b is involved in the ATRA-reduced E2F3 expression mechanism. After U87 MG cells were transfected with 50 nM of a miR-302b mimic and a scrambled control mimic or 100 nM of a miR-302b inhibitor and a scrambled control inhibitor, ATRA was added for another 24 h. The protein level of E2F3 was analyzed by an immunoblotting assay. Data are the mean ± SD of three experiments. *p < 0.05.

Download figure to PowerPoint

Effects of E2F3 in ATRA-mediated cell death

To investigate the role of miR-302b in ATRA-repressed E2F3 expressions, we prepared the expression vectors named pc-E2F3-3U (E2F3 cDNA with 3′UTR) and pc-E2F3-M3U (E2F3 cDNA with 3′UTR containing mutated miR-302b-binding site) (Fig. 6a). As shown in Fig. 6b, without the miR-302b-binding site in E2F3 3′UTR, ATRA significantly abolished the ability to reduce E2F3 expression levels. These suggested that without miR-302b binding site in E2F3 3′UTR significantly influenced ATRA-inhibited E2F3 expressions. To further explore the effects of E2F3 on ATRA cytotoxicity, the pc-E2F3 vectors (E2F3 cDNA without 3′UTR) (Fig. 6a) and E2F3 shRNA were used to conduct overexpression and knockdown of E2F3 experiments, respectively (Fig. 6c upper inset). Variant E2F3 expression levels significantly influenced ATRA-mediated cell viability (Fig. 6c lower inset), caspase 3 activation, and PARP degradation (Fig. 6d). All the results suggested that miR-302b-inhibited E2F3 expression involved in ATRA cytotoxicity.

image

Figure 6. The effects of E2F3 on all-trans retinoic acid (ATRA)-mediated cell death. (a) The E2F3 cDNA with 3′ UTR (pc-E2F3-3U), 3′ UTR containing mutant miR-302b-binding site (pc-E2F3-M3U), or without 3′UTR (pc-E2F3) were respectively cloned into pcDNA 3.1 (+) expression vector. (b) To mutate the miR-302b-binding site in E2F3 3′UTR abolished ATRA-repressed E2F3 levels. After cells were respectively transfected with 1 μg pcDNA, pc-E2F3-3U, and pc-E2F3-M3U for 24 h, 40 μM ATRA was added for another 24 h. The protein level of E2F3 was analyzed by an immunoblotting assay. (c and d) Overexpression and knockdown of E2F3 expression significantly influenced ATRA-mediated cell viability, Caspase 3 activation, and PARP (PARP) degradation. After cells were respectively transfected with 1 μg pcDNA, pc-E2F3, scrambled shRNA and E2F3 shRNA for 24 h, 40 μM ATRA was added for another 24 h. The cell viability and protein level of E2F3 was respectively analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and immunoblotting analysis. Data are the mean ± SD of three experiments. *p < 0.05.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

This study provides evidence that ATRA induces glioblastoma cell death via caspase-dependent apoptotic pathways. Mitochondrial dysfunction, including loss of membrane potential, caspase-9 activation, cytochrome c release, and an increase in the Bax/Bcl2 ratio are significantly involved in ATRA-mediated cell death. Caspase-8 activation was also found, suggesting that both the intrinsic and extrinsic apoptotic pathways play important roles in ATRA-induced cell death. Except for mitochondrial dysfunction, ER stress was significantly activated upon ATRA treatment. Both mitochondrial dysfunction and ER stress generated numerous intracellular ROS to trigger apoptotic pathway activation. In addition, we also found that ATRA obviously enhanced miR-302b gene expression via a RARα-mediated pathway. Overexpression and knockdown of miR-302b expression significantly influenced ATRA-induced cell death. Moreover, E2F3 was validated as a novel target gene of miR-302b. E2F3 downregulation as inhibited by miR-302b was also identified to participate in ATRA-induced glioblastoma cell death. All of the results demonstrate that ATRA can induce glioblastoma cell death via mitochondrial dysfunction, ER stress, and ROS generation. MiR-302b-inhibited E2F3 expression is involved in ATRA-mediated cell death pathways.

It is well-known that ATRA has multiple functions in mediating cell physiology. In addition to differentiation, ATRA has been reported to induce apoptosis in variant cell lines via mitochondrial-dependent pathways, including melanoma (Zhang et al. 2003), Leydig's (Tucci et al. 2008), acute promyelocytic leukemia (Wang et al. 2014), and myeloid cells (Schmidt-Mende et al. 2006). Since the low-dose treatment (of < 1 μM) of ATRA did not induce significant cell death in glioblastomas, many studies focused on the combined effects of ATRA with other drugs such as taxol (Karmakar et al. 2007) and interferon-γ (Das et al. 2009). They all found that low-dose treatment with ATRA enhanced sensitivity to taxol and interferon-γ for increasing glioblastoma apoptosis through caspase- and non-caspase-dependent apoptotic pathways. However, no studies demonstrated the molecular mechanisms by high concentrations of ATRA treatment (> 40 μM) in inducing glioblastoma cell death. Interestingly, treatment with a high dose of ATRA alone also induced mitochondrial dysfunction, ROS generation, and caspase-8 activation in glioblastomas. Furthermore, a previous study demonstrated that ATRA treatment enhances ER stress-mediated death in hepatocellular carcinoma cells (Xu et al. 2007). Similarly, we found that ER stress was also involved in ATRA-induced glioblastoma cell death. Although such high concentrations of ATRA treatment could not be directly used in the clinic, a complete understanding of ATRA-mediated gene networks may provide novel targets for glioblastoma therapy.

Several studies identified that ATRA can regulate miRNA gene expressions that result in enhancing cell differentiation. For example, ATRA up-regulated let-7a (Garzon et al. 2007), let-7c (Pelosi et al. 2013), miR-663 (Jian et al. 2011), and miR-15a/16-1 (Gao et al. 2011) expressions to enhance leukemic cell differentiation. MiR10a/10b (Foley et al. 2011), miR-340 (Das et al. 2013), miR-152 (Das et al. 2010), and mir-125b (Le et al. 2009) were validated as potent inducers of ATRA-induced neuroblastoma cell differentiation. Furthermore, Xu et al. 2007 demonstrated that upregulation of miR-125b attenuated ATRA-mediated apoptosis in glioblastoma U343 cells. However, no studies reported TRA-enhanced miRNA expressions in inducing glioblastoma cell death. In this study, we first identified that ATRA significantly up-regulated miR-302b gene expression. Changes in endogenous miR-302b levels obviously influenced ATRA-induced cell death, suggesting that miR-302b possesses tumor suppressive functions in inhibiting tumor cell proliferation.

The miR-302b gene is located in a miRNA gene cluster, which respectively encodes five miRNAs consisting of miR-302a/b/c/d and miR-367. The MiR-302-367 cluster plays important roles in early embryonic development and somatic cell reprogramming (Brautigam et al. 2013). It also showed inhibitory effects leading to disruption of tumorigenic properties of cancer progenitor cells (Lin et al. 2010; Fareh et al. 2012). Increasing evidence suggests that overexpression of miR-302b induces cancer cell apoptosis and cell cycle arrest (Zhu et al. 2012; Wang et al. 2013a; Zhang et al. 2013; Yan et al. 2014). Several target genes of miR-302b were also identified. For example, both epidermal growth factor receptor and AKT2 were determined to be direct targets of miR-302b in suppressing human hepatocellular carcinoma cell proliferation (Wang et al. 2013a,b). Interestingly, how the miR-302b has the controversial role in deciding the cell fate in different cell types? We suppose that miR-302b could regulate distinct protein expressions in different cells for modulating the responsiveness of cells to external signals. For example, miR-302b could inhibit cyclin D1 and CDK4 expression, which results in maintaining embryonic stem cell self-renewal (Barroso-del Jesus et al. 2009). In contrast, miR-302b could also down-regulate both cyclin D1 and AKT1 expressions, leading to the suppression of cervical cancer cell proliferation (Cai et al. 2013). Except miR-302b, other miRNAs such as let-7 and miR-128 showed similar effects in both stemness regulation of embryonic stem cells and tumorigenicity inhibition of cancerous cells. Herein, we demonstrated that ATRA-regulated miR-302b expression was involved in glioblastoma cell apoptosis via reducing E2F3 expression. In addition, previous studies reported that miR-128 and miR-195 targeted E2F3 resulting in inhibition of glioma cell proliferation (Zhang et al. 2009, 2012). All of the findings show that miRNA regulation deeply influences E2F3 gene expression in glioblastoma development. We suggest that miR-302b-inhibited E2F3 expression may provide another novel mechanism for future glioblastoma studies.

In summary, we show that ATRA activates a caspase-dependent apoptotic pathway in inducing glioblastoma cell death. Both mitochondrial dysfunction and ER stress generated elevated intracellular ROS levels, which were significantly involved in ATRA-mediated cytotoxicity. Our findings may provide beneficial insights into developing new treatment strategies for brain tumors by targeting mitochondria and the ER. In addition, ATRA-up-regulated miR-302b expression via a RARα-mediated pathway was demonstrated. E2F3, a novel target gene of miR-302b, was identified to participate in ATRA-enhanced cell death. No previous studies had reported the role of miR-302b in glioblastoma development or the relationship between ATRA and miR-302b. Although both ATRA and miR-302b have functions in regulating differentiation of stem cells, whether ATRA could enhance miR-302b expression in stem cells is still needed to be elucidated in future works. Furthermore, miR-302b is recognized as tumor-suppressive miRNA, and E2F3 is identified as a direct target gene of miR-302b in inhibiting tumor formation. Thus, miR-302b and its direct target genes could be important targets of disease therapy in the future.

Acknowledgments and conflict of interest disclosure

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

This work was supported by grants from the National Science Council, Taiwan (grant nos. NSC102-2320-B-038-006 and NSC102-2320-B-038-042) and Taipei Medical University (intramural grant no. TMU101-AE1-B23).

All experiments were conducted in compliance with the ARRIVE guidelines. The authors have no conflict of interest to declare.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References
  • Auffinger B., Thaci B., Ahmed A., Ulasov I. and Lesniak M. S. (2013) MicroRNA targeting as a therapeutic strategy against glioma. Curr. Mol. Med. 13, 535542.
  • Barroso-del Jesus A., Lucena-Aguilar G. and Menendez P. (2009) The miR-302-367 cluster as a potential stemness regulator in ESCs. Cell Cycle 8, 394398.
  • Brautigam C., Raggioli A. and Winter J. (2013) The Wnt/beta-catenin pathway regulates the expression of the miR-302 cluster in mouse ESCs and P19 cells. PLoS ONE 8, e75315.
  • Brtko J. (2007) Role of retinoids and their cognate nuclear receptors in breast cancer chemoprevention. Cent. Eur. J. Public Health 15, 36.
  • Cai N., Wang Y. D. and Zheng P. S. (2013) The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA 19, 8595.
  • Cui J. G., Zhao Y., Sethi P., Li Y. Y., Mahta A., Culicchia F. and Lukiw W. J. (2010) Micro-RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation. J. Neurooncol. 98, 297304.
  • Das A., Banik N. L. and Ray S. K. (2009) Molecular mechanisms of the combination of retinoid and interferon-gamma for inducing differentiation and increasing apoptosis in human glioblastoma T98G and U87MG cells. Neurochem. Res. 34, 87101.
  • Das S., Foley N., Bryan K., Watters K. M., Bray I., Murphy D. M., Buckley P. G. and Stallings R. L. (2010) MicroRNA mediates DNA demethylation events triggered by retinoic acid during neuroblastoma cell differentiation. Cancer Res. 70, 78747881.
  • Das S., Bryan K., Buckley P. G. et al. (2013) Modulation of neuroblastoma disease pathogenesis by an extensive network of epigenetically regulated microRNAs. Oncogene 32, 29272936.
  • Fareh M., Turchi L., Virolle V. et al. (2012) The miR 302-367 cluster drastically affects self-renewal and infiltration properties of glioma-initiating cells through CXCR4 repression and consequent disruption of the SHH-GLI-NANOG network. Cell Death Differ. 19, 232244.
  • Foley N. H., Bray I., Watters K. M., Das S., Bryan K., Bernas T., Prehn J. H. and Stallings R. L. (2011) MicroRNAs 10a and 10b are potent inducers of neuroblastoma cell differentiation through targeting of nuclear receptor corepressor 2. Cell Death Differ. 18, 10891098.
  • Friedman H. S., Kerby T. and Calvert H. (2000) Temozolomide and treatment of malignant glioma. Clin. Cancer Res. 6, 25852597.
  • Gao S. M., Yang J., Chen C., Zhang S., Xing C. Y., Li H., Wu J. and Jiang L. (2011) miR-15a/16-1 enhances retinoic acid-mediated differentiation of leukemic cells and is up-regulated by retinoic acid. Leuk. Lymphoma 52, 23652371.
  • Garzon R., Pichiorri F., Palumbo T. et al. (2007) MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene 26, 41484157.
  • Gunther W., Pawlak E., Damasceno R., Arnold H. and Terzis A. J. (2003) Temozolomide induces apoptosis and senescence in glioma cells cultured as multicellular spheroids. Br. J. Cancer 88, 463469.
  • Haque A., Banik N. L. and Ray S. K. (2007a) Emerging role of combination of all-trans retinoic acid and interferon-gamma as chemoimmunotherapy in the management of human glioblastoma. Neurochem. Res. 32, 22032209.
  • Haque A., Das A., Hajiaghamohseni L. M., Younger A., Banik N. L. and Ray S. K. (2007b) Induction of apoptosis and immune response by all-trans retinoic acid plus interferon-gamma in human malignant glioblastoma T98G and U87MG cells. Cancer Immunol. Immunother. 56, 615625.
  • Jian P., Li Z. W., Fang T. Y., Jian W., Zhuan Z., Mei L. X., Yan W. S. and Jian N. (2011) Retinoic acid induces HL-60 cell differentiation via the upregulation of miR-663. J. Hematol. Oncol. 4, 20.
  • Karmakar S., Banik N. L., Patel S. J. and Ray S. K. (2007) Combination of all-trans retinoic acid and taxol regressed glioblastoma T98G xenografts in nude mice. Apoptosis 12, 20772087.
  • Karmakar S., Banik N. L. and Ray S. K. (2008) Combination of all-trans retinoic acid and paclitaxel-induced differentiation and apoptosis in human glioblastoma U87MG xenografts in nude mice. Cancer 112, 596607.
  • Karsy M., Arslan E. and Moy F. (2012) Current progress on understanding MicroRNAs in glioblastoma multiforme. Genes Cancer 3, 315.
  • Kast R. E. (2008) Potential for all-trans retinoic acid (tretinoin) to enhance interferon-alpha treatment response in chronic myelogenous leukemia, melanoma, myeloma and renal cell carcinoma. Cancer Biol. Ther. 7, 15151519.
  • Khalili M., Sadeghizadeh M., Ghorbanian K., Malekzadeh R., Vasei M. and Mowla S. J. (2012) Down-regulation of miR-302b, an ESC-specific microRNA, in Gastric Adenocarcinoma. Cell J. 13, 251258.
  • Le M. T., Xie H., Zhou B. et al. (2009) MicroRNA-125b promotes neuronal differentiation in human cells by repressing multiple targets. Mol. Cell. Biol. 29, 52905305.
  • Lewis B. P., Burge C. B. and Bartel D. P. (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, 1520.
  • Lin S. L., Chang D. C., Ying S. Y., Leu D. and Wu D. T. (2010) MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways. Cancer Res. 70, 94739482.
  • Lin C. J., Lee C. C., Shih Y. L., Lin T. Y., Wang S. H., Lin Y. F. and Shih C. M. (2012) Resveratrol enhances the therapeutic effect of temozolomide against malignant glioma in vitro and in vivo by inhibiting autophagy. Free Radic. Biol. Med. 52, 377391.
  • Pelosi A., Careccia S., Lulli V. et al. (2013) miRNA let-7c promotes granulocytic differentiation in acute myeloid leukemia. Oncogene 32, 36483654.
  • Schmidt-Mende J., Gogvadze V., Hellstrom-Lindberg E. and Zhivotovsky B. (2006) Early mitochondrial alterations in ATRA-induced cell death. Cell Death Differ. 13, 119128.
  • Serao N. V., Delfino K. R., Southey B. R., Beever J. E. and Rodriguez-Zas S. L. (2011) Cell cycle and aging, morphogenesis, and response to stimuli genes are individualized biomarkers of glioblastoma progression and survival. BMC Med. Genomics 4, 49.
  • Shi L., Chen J., Yang J., Pan T., Zhang S. and Wang Z. (2010) MiR-21 protected human glioblastoma U87MG cells from chemotherapeutic drug temozolomide induced apoptosis by decreasing Bax/Bcl-2 ratio and caspase-3 activity. Brain Res. 1352, 255264.
  • Tucci P., Cione E., Perri M. and Genchi G. (2008) All-trans-retinoic acid induces apoptosis in Leydig cells via activation of the mitochondrial death pathway and antioxidant enzyme regulation. J. Bioenerg. Biomembr. 40, 315323.
  • Wang L., Yao J., Shi X., Hu L., Li Z., Song T. and Huang C. (2013a) MicroRNA-302b suppresses cell proliferation by targeting EGFR in human hepatocellular carcinoma SMMC-7721 cells. BMC Cancer 13, 448.
  • Wang L., Yao J., Zhang X. et al. (2013b) miRNA-302b Suppresses Human Hepatocellular Carcinoma by Targeting AKT2. Mol. Cancer Res., 12, 190202.
  • Wang C. Y., Yang T. T., Chen C. L., Lin W. C. and Lin C. F. (2014) Reactive oxygen species-regulated glycogen synthase kinase-3beta activation contributes to all-trans retinoic acid-induced apoptosis in granulocyte-differentiated HL60 cells. Biochem. Pharmacol., 88, 8694.
  • Welch C., Chen Y. and Stallings R. L. (2007) MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene 26, 50175022.
  • Xu Y. Y., Lu Y., Fan K. Y. and Shen Z. H. (2007) Apoptosis induced by all-trans retinoic acid in N-acetylglucosaminyltransferase V repressed human hepatocarcinoma cells is mediated through endoplasmic reticulum stress. J. Cell. Biochem. 100, 773782.
  • Yan G. J., Yu F., Wang B., Zhou H. J., Ge Q. Y., Su J., Hu Y. L., Sun H. X. and Ding L. J. (2013) MicroRNA miR-302 inhibits the tumorigenicity of endometrial cancer cells by suppression of Cyclin D1 and CDK1. Cancer Lett., 345, 3947.
  • Yan G. J., Yu F., Wang B., Zhou H. J., Ge Q. Y., Su J., Hu Y. L., Sun H. X. and Ding L. J. (2014) MicroRNA miR-302 inhibits the tumorigenicity of endometrial cancer cells by suppression of Cyclin D1 and CDK1. Cancer Lett. 345, 3947.
  • Zhang H., Satyamoorthy K., Herlyn M. and Rosdahl I. (2003) All-trans retinoic acid (atRA) differentially induces apoptosis in matched primary and metastatic melanoma cells – a speculation on damage effect of atRA via mitochondrial dysfunction and cell cycle redistribution. Carcinogenesis 24, 185191.
  • Zhang Y., Chao T., Li R. et al. (2009) MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a. J. Mol. Med. (Berl) 87, 4351.
  • Zhang Q. Q., Xu H., Huang M. B., Ma L. M., Huang Q. J., Yao Q., Zhou H. and Qu L. H. (2012) MicroRNA-195 plays a tumor-suppressor role in human glioblastoma cells by targeting signaling pathways involved in cellular proliferation and invasion. Neuro Oncol. 14, 278287.
  • Zhang Y., Hu H., Song L., Cai L., Wei R. and Jin W. (2013) Epirubicin-mediated expression of miR-302b is involved in osteosarcoma apoptosis and cell cycle regulation. Toxicol. Lett. 222, 19.
  • Zhu R., Yang Y., Tian Y. et al. (2012) Ascl2 knockdown results in tumor growth arrest by miRNA-302b-related inhibition of colon cancer progenitor cells. PLoS ONE 7, e32170.