SEARCH

SEARCH BY CITATION

Keywords:

  • addiction;
  • alcohol;
  • ALK ;
  • conditioned place preference;
  • dependence;
  • midkine

Abstract

  1. Top of page
  2. Abstract
  3. Methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References
Thumbnail image of graphical abstract

Pleiotrophin (PTN) is a cytokine with important roles in dopaminergic neurons. We found that an acute ethanol (2.0 g/kg, i.p.) administration causes a significant up-regulation of PTN mRNA and protein levels in the mouse prefrontal cortex, suggesting that endogenous PTN could modulate behavioural responses to ethanol. To test this hypothesis, we studied the behavioural effects of ethanol in PTN knockout (PTN−/−) mice and in mice with cortex- and hippocampus-specific transgenic PTN over-expression (PTN-Tg). Ethanol (1.0 and 2.0 g/kg) induced an enhanced conditioned place preference in PTN−/− compared to wild type mice, suggesting that PTN prevents ethanol rewarding effects. Accordingly, the conditioning effects of ethanol were completely abolished in PTN-Tg mice. The ataxic effects induced by ethanol (2.0 g/kg) were not affected by the genotype. However, the sedative effects of ethanol (3.6 g/kg) tested in a loss of righting reflex paradigm were significantly reduced in PTN-Tg mice, suggesting that up-regulation of PTN levels prevents the sedative effects of ethanol. These results indicate that PTN may be a novel genetic factor of importance in alcohol use disorders, and that potentiation of the PTN signalling pathway may be a promising therapeutic strategy in the treatment of these disorders.

Ethanol up-regulates pleiotrophin (PTN), a cytokine important for dopaminergic neurons, in the prefrontal cortex. Ethanol rewarding effects are abolished in mice over-expressing PTN and enhanced in PTN−/− mice. The results suggest that up-regulation of PTN in the prefrontal cortex after ethanol administration serves to modulate ethanol effects in the reward system and other ethanol-induced pharmacological effects including sedation.

Abbreviations used
ALDH

aldehyde dehydrogenase

ALK

anaplastic lymphoma kinase

BEC

blood ethanol concentration

COMT

catechol-O-methyltransferase

CPP

conditioned place preference

LORR

loss of the righting reflex

MK

midkine

PFC

prefrontal cortex

PTN

pleiotrophin

RPTP

receptor protein tyrosine phosphatase

WT

wild type

Alcoholism is a serious condition with severe health and social consequences. A strong genetic component for pre-disposition to this disease is known (Mayfield et al. 2008; Palmer et al. 2012) and involves genes such as catechol-O-methyltransferase and aldehyde dehydrogenases ALDH2 and ALDH1B, enzymes involved in ethanol metabolism (Ducci and Goldman 2008). However, the genetics of ethanol dependence is far from being completely understood.

Two genetic factors that are regulated in different brain areas after administrations of various drugs of abuse are pleiotrophin (PTN) and midkine (MK) (Herradon et al. 2009). PTN and MK are highly redundant in function cytokines (Muramatsu 2014), survival factors for dopaminergic neurons, and capable of inducing the differentiation of stem cells to dopaminergic neurons (Herradon and Ezquerra 2009; Muramatsu 2014). Evidence suggests that drugs of abuse-induced regulation of expression of PTN and/or MK in the brain are involved in the regulation of drug-induced effects, including addictive behaviour (Gramage and Herradon 2011). It has been previously shown that PTN knockout (PTN−/−) and MK knockout (MK−/−) mice are more vulnerable to amphetamine and cocaine conditioning effects, respectively (Gramage et al. 2010b, 2013b; Martin et al. 2013), and that PTN and MK counteract amphetamine and cocaine neurotoxic effects (Gramage et al. 2008, 2010a, 2011, 2013c; Vicente-Rodriguez et al. 2013).

Interestingly, MK gene expression is known to be up-regulated in the prefrontal cortex (PFC) of long-term alcoholic subjects (Flatscher-Bader et al. 2005). Although up-regulation of MK expression has been suggested to occur to counteract cell damage and induction of apoptotic processes in the PFC (Flatscher-Bader and Wilce 2008), a possible regulation of ethanol rewarding effects by this cytokine should not be discarded, especially when PFC is known to play a pivotal role in the mesocorticolimbic dopaminergic system (Luscher and Malenka 2011; Gass and Chandler 2013). Whether or not ethanol administration also regulates the levels of expression of PTN remains to be studied.

In this work, we show that ethanol administration increases the expression of PTN in the mouse PFC. In addition, to study the possibility that up-regulation of PTN levels in the PFC is involved in the modulation of the behavioural responses to ethanol, we have tested the effects induced by ethanol in mice with cortex- and hippocampus-specific transgenic PTN over-expression (PTN-Tg) and PTN−/− mice. The rewarding effects of ethanol have been tested in the conditioned place preference (CPP) paradigm to allow comparisons with the effects of other drugs previously described in these genotypes (e.g. Gramage et al. 2010b). In addition, it is known that drug-seeking behaviours in humans are influenced by environmental cues previously associated with reinforcing drugs (Dackis and O'Brien 2005). This conditioning can be tested in rodents in the CPP paradigm, an experimental approach that is being increasingly used to identify novel genetic factors possibly underlying drug-seeking behaviours, particularly in genetically modified mouse models (Tzschentke 2007).

Methods

  1. Top of page
  2. Abstract
  3. Methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

Animals

PTN−/− mice on a C57BL/6 background were generated by methods previously described (Amet et al. 2001). PTN-Tg mice on a C57BL/6 background were generated by pronuclear injection (Ferrer-Alcón et al. 2012). Briefly, the pCMV-sport6 vector including the PTN cDNA sequence was obtained from imaGenes (IRAVp968B05104D). This vector is designed for directional cloning of cDNA that contain NotI and SalI-compatible termini (Hartley et al. 2000). The acceptor vector used was pTSC-a2, which contained the regulatory regions responsible for tissue specific expression of Thy-1 gene, which drives neuron-specific expression of transgenes (Aigner et al. 1995; Caroni 1997) and induces the expression of the transgene mainly in neurons from cortex and hippocampus (Ferrer-Alcón et al. 2012). After plasmid amplification and purification, it was digested with PvuI and microinjected to embryos. A two- to threefold PTN mRNA specific over-expression in cortex and a two- to fourfold PTN over-expression in hippocampus was established by quantitative real time-polymerase chain reaction (qRT-PCR) and in situ hybridization, and over-expression of PTN protein levels was confirmed by western blot (Ferrer-Alcón et al. 2012). Genotype determination of PTN-Tg mice was carried out by PCR amplification of genomic DNA obtained from animal's tail using primers to PTN (5′-3′: PTN exon1 forward, CCCGCCTACCCGTCCAAATATC; 5′-3′: PTN intron reverse, CCCCAAAATTTCCTTTCGGCTG; 5′-3′: PTN exon2 reverse, TACGTTGCTGCTGATAT TGCTGGG). The genotypes of PTN−/− and wild type (WT) mice were confirmed as previously described (Vicente-Rodriguez et al. 2012). The efficiency of gene knockout in different organs including the brain of PTN−/− mice has been previously shown (Herradon et al. 2005).

For the study, we used male PTN−/−, PTN-Tg and WT animals of 9–10 weeks (20–25 g). Mice were housed under controlled environmental conditions (22 ± 1°C and a 12-h light/12-h dark cycle) with free access to food and water. Relevant to the behavioural studies presented here, there were no differences in motor activity and exploration between the different genotypes at baseline (Gramage et al. 2010b; Ferrer-Alcón et al. 2012).

All the animals used in this study were maintained in accordance with both the ARRIVE guidelines and the European Union Laboratory Animal Care Rules (86/609/ECC directive), and the protocols were approved by the Animal Research Committee of USP-CEU.

cDNA synthesis and SYBR green RT-qPCR analysis

WT mice treated with saline (10 mL/kg, i.p.) (n = 6) or ethanol (2 g/kg, i.p.; 20% v/v in isotonic saline) (n = 5) were killed 1 h after treatment and PFC was rapidly removed. Exactly, 10–15 mg tissue of frozen PFC were disrupted and homogenized by TissueLyser LT (Qiagen, Valencia, CA, USA) for 4 min at 45 Hz, and total RNA was isolated with a commercial kit (Rneasy Mini kit, Qiagen) following the manufacturer's instructions. The concentrations of RNA in each sample were measured at 260 nm, and the integrity of RNA was confirmed by 1% agarose gel electrophoresis. Complementary DNAs were synthesized from individual samples of total RNA using the iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). The SYBR green RT-qPCR method (Bio-Rad Laboratories) was used with the following primers sets (forward and reverse) in a CFX96 Real Time System (Bio-Rad Laboratories): PTN (5′-TTGGGGAGAATGTGACCTCAATAC-3′; 5′- GGCTTGGAGATGGTGACAGTTTTC-3′), hypoxanthine-guanine phosphoribosyltransferase (HPRT) (5′-CCCCAAAATGGTTAAGGTTG-3′, and 5′-CAAAGTCTGGCCTGTATCCAA-3′). As a negative control, we used the cDNA from PTN−/− mice (data not shown). The relative expression of each gene was normalized against HPRT, as described by the manufacturer's instructions of CFX96 Real Time System (Bio-Rad Laboratories). All reactions were performed in triplicate.

Western blot

WT mice and PTN-Tg mice treated with saline (10 mL/kg, i.p.) or ethanol (2 g/kg, i.p.; 20% v/v in isotonic saline) were killed 1 h after treatment and PFC (n = 4/group) was rapidly removed and frozen in dry ice and stored to −80°C until the protein extraction procedure. Protein extraction and quantification was performed as previously described (Vicente-Rodriguez et al. 2013). Equilibrated protein samples were loaded onto 15% polyacrylamide gels, transferred to nitrocellulose membranes, and then probed with anti-PTN (1 : 500) antibodies (R&D systems, Minneapolis, MN, USA). Membranes were then reprobed with anti-actin antibodies at a 1 : 5000 dilution (Chemicon, Temecula, CA, USA). After incubation with appropriate secondary antibodies (1 : 5000) conjugated with horseradish peroxidase, the immunoreactive proteins were visualized using the ECL method according to the manufacturer's instructions (Amersham, San Francisco, CA, USA). PTN levels were quantified by densitometry in each animal sample using Image Lab image acquisition and analysis software (Bio-Rad Laboratories) and normalized with actin protein levels.

Conditioned place preference

A biased apparatus was used as previously described (Gramage et al. 2013b). One compartment had black floor and walls, and the other had black floor and white walls. The phases included pre-conditioning (Pre-C, day 1), conditioning (days 2–4) and testing (CPP, day 5). During Pre-C, mice were free to explore the two compartments for a 15-min period; their behaviour was monitored by a videotracking system (SD Instruments, San Diego, CA, USA) to calculate the time spent in each compartment. As expected, the compartment with white walls in this work was the non-preferred compartment by all mouse genotypes (~ 30% stay of total time in the Pre-C phase). This ‘biased’ apparatus and subject assignment in which mice are paired with the drug in the non-preferred compartment, was previously used to study genotype differences in amphetamine- and cocaine-induced CPP (Gramage et al. 2010b, 2013b). The conditioning phase consisted of double conditioning sessions (Gramage et al. 2013b). The first one involved a morning session starting at 8 am, in which all animals received a single injection of saline i.p. (10 mL/kg) and were confined to the initially preferred compartment for 5 min. In the evening session starting at 3 pm, the animals were injected (i.p.) with 1.0 g/kg ethanol (n = 20–22/group) or 2.0 g/kg ethanol (n = 15–18/group), or 10 mL/kg saline (n = 5–8/group) as a conditioning control, and confined to the initially non-preferred compartment for 5 min. The procedure used in days 3 and 4 was the same but the order of the treatments (morning/evening) was changed to avoid the influence of circadian variability. In the testing phase on day 5, mice received a drug-free, 15-min preference test. The percentage of time spent (stay) in the non-preferred (drug-paired) compartment was calculated in all cases. The increase in the stay in the drug-paired compartment in day 5 compared to day 1 was considered as indicative of the degree of conditioning induced by ethanol.

Rotarod test

We used the rotarod test (Panlab, Barcelona, Spain) to assess the effects of ethanol administration on motor coordination and balance in WT (n = 8), PTN−/− (n = 9) and PTN-Tg (n = 8) mice. Mice were trained in two sessions in two consecutive days by placing them on the rotarod rotating drum (rod), and allowing them to run/climb under continuous acceleration (2–18 rpm) for at least 30 s. The next day, animals were re-trained, injected with 2.0 g/kg ethanol and then placed on the rotarod. The time to fall was recorded and mice were placed back on the rotarod every 10 min until 100 min after ethanol administration.

Loss of the righting reflex

WT (n = 6), PTN−/− (n = 7) and PTN-Tg (n = 8) mice were injected i.p. with 3.6 g/kg ethanol, placed on their backs and tested for the ability to right themselves. It was considered that mice had lost the righting reflex if they could not right themselves three times within 30 s and regained the righting reflex if they could fully right themselves three times within 30 s (Lasek et al. 2012). The duration of loss of the righting reflex (LORR) was determined as the difference between the time when the reflex was lost and when it was regained.

Measurement of blood ethanol concentration

Blood ethanol concentration (BEC) was measured in mice used in the LORR experiment 1 week after the LORR test. Mice (n = 5–6/group) were injected with 3.6 g/kg of ethanol i.p. and 20 μL of blood was obtained via tail vein puncture at 30, 60 and 120 min post-injection. BECs were determined using an NAD-ADH enzymatic assay (Sigma, Madrid, Spain).

Statistical analysis

PTN mRNA expression analysis was performed by Student's t-test. PTN protein expression analysis was performed by two-way anova followed by Bonferroni's post hoc tests, considering treatment and genotype as variables. CPP data were analysed by two-way anova with repeated measures followed by Bonferroni's post hoc tests, considering experimental phase and genotype as variables. LORR data were analysed by one-way anova followed by Tukey's post hoc tests. Rotarod data were analysed by two-way anova with repeated measures followed by Bonferroni's post hoc tests, considering genotype and time as variables. A p value < 0.05 was considered a statistically significant difference. All statistical analyses were performed using Graphpad prism 5 program (GraphPad Software, La Jolla, CA, USA).

Results

  1. Top of page
  2. Abstract
  3. Methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

In this work, we demonstrate for the first time that an acute administration of ethanol (2.0 g/kg, i.p.) causes a significant increase (~ 25%) of PTN mRNA levels in the PFC of WT mice (Fig. 1). In addition, we observed a ~ 50% increase of PTN protein levels in the PFC of WT mice treated with 2g/kg ethanol compared to saline-treated WT mice (Fig. 2). In those experiments we also confirmed a four- to fivefold up-regulation of PTN protein levels in the PFC of PTN-Tg mice compared to WT mice (Fig. 2). However, 2 g/kg ethanol administration did not alter PTN protein levels in the PFC of PTN-Tg mice (Fig. 2). To test the possibility that PTN could modulate ethanol rewarding effects, we performed conditioning studies. First, we used a low dose of ethanol (1.0 g/kg, i.p.) which has been reported to be unable to induce CPP in mice (Marchand et al. 2006) or to produce moderate conditioning effects (Houchi et al. 2005; Tzschentke 2007). Accordingly, we found that 1.0 g/kg ethanol did not cause a significant CPP in WT and PTN-Tg mice (Fig. 3). In contrast, 1.0 g/kg ethanol caused a significant CPP in PTN−/− mice suggesting an important role of PTN on the modulation of ethanol conditioning effects. To further test this hypothesis, we performed conditioning experiments with a higher dose of ethanol (2.0 g/kg) using WT mice, PTN−/− and PTN-Tg mice. A total of 2.0 g/kg ethanol has been consistently shown to induce CPP in mice (Cunningham et al. 1998; Bechtholt et al. 2004; Houchi et al. 2005; Tzschentke 2007). We found that 2.0 g/kg ethanol induced a robust CPP in WT mice and a significantly increased CPP in PTN−/− mice compared to WT mice (Fig. 4a). In contrast, we found that the conditioning effects of ethanol (2.0 g/kg) were completely blocked in PTN-Tg mice (Fig. 4a). Saline conditioning did not show significant changes on place preference compared to Pre-C values of all genotypes (Fig. 4b). The data confirm an important role of PTN in the regulation of the rewarding effects of ethanol.

image

Figure 1. Ethanol regulates expression of pleiotrophin (PTN). qPCR showing an 25% increase in PTN mRNA expression in prefrontal cortex (PFC) of wild type mice treated with 2.0 g/kg ethanol (i.p.) compared to saline (control) injected mice (n = 5–6/group). Total RNA was isolated from PFC and cDNA synthesized for analysis by RT-PCR. *< 0.05 versus saline. HPRT was used as housekeeping gene and used for normalization.

Download figure to PowerPoint

image

Figure 2. Pleiotrophin protein levels in PFC of wild type (WT) and pleiotrophin (PTN)-Tg mice treated with ethanol. Western blot data showing an 50% increase in PTN expression in prefrontal cortex (PFC) of WT mice treated with 2.0 g/kg ethanol (i.p.) compared to saline (control) injected mice (= 0.059). PTN protein levels in saline (Sal)- and ethanol (Eth, 2.0 g/kg)-treated WT and PTN-Tg mice were determined by western blot with anti-PTN antibodies. Actin amounts were determined using anti-actin antibodies. Graph shows the ratio PTN/Actin of optical density (OD) measurements corresponding to the total PTN and actin protein levels, respectively. Data show mean ± SEM (a.u.) of the four individual samples from every experimental group. Two-way anova showed a significant effect of genotype [F(1, 12) = 78.65, < 0.001].

Download figure to PowerPoint

image

Figure 3. Ethanol (1.0 g/kg)-induced place preference. Results are presented as the mean ± SEM of the percentage of the time spent by wild type (WT), PTN−/−, and pleiotrophin (PTN)-Tg mice in the ethanol (1.0 g/kg)-paired (non-preferred) compartment during pre-conditioning (Pre-C, day 1) and testing phases [conditioned place preference (CPP), day 5]. ***< 0.001 CPP versus Pre-C. ###< 0.001 PTN−/− versus WT.

Download figure to PowerPoint

image

Figure 4. Ethanol (2.0 g/kg)-induced place preference. (a) Results are presented as the mean ± SEM of the percentage of the time spent by wild type (WT), PTN−/− and pleiotrophin (PTN)-Tg mice in the ethanol (2.0 g/kg)-paired (non-preferred) compartment during pre-conditioning (Pre-C, day 1) and testing phases [conditioned place preference (CPP), day 5]. Two-way anova showed a significant interaction genotype x phase [F(2, 47) = 29.21, < 0.001]. ***< 0.001 versus Pre-C. #< 0.05 versus WT. +++< 0.001 versus PTN-Tg. (b) Results from control experiments in which WT (n = 6), PTN−/− (n = 8) and PTN-Tg mice (n = 5) were only treated with saline during conditioning.

Download figure to PowerPoint

To test the possibility that PTN could modulate other acute behavioural responses to ethanol we performed experiments to assay the ataxic and sedative effects of ethanol in the different genotypes. First, we tested the recovery of the different genotypes from the ataxic effects induced by a dose of ethanol (2.0 g/kg) known to produce moderate ataxic effects in mice (den Hartog et al. 2013). The motor incoordinating effects of ethanol were measured using the rotarod test. Acute administration of 2.0 g/kg ethanol produced motor ataxia in all the three genotypes of mice illustrated by a significant reduction in time spent on the rotarod [two-way RM anova: effect of time, F(10, 220) = 30.38, < 0.0001; Fig. 5]. In agreement with studies reported by others (den Hartog et al. 2013), performance improved over time in all the three genotypes in a similar manner. In addition, we examined PTN−/− and PTN-Tg mice for their behavioural response to ethanol in a LORR test using a sedating dose of ethanol (3.6 g/kg). anova revealed significant effects of genotype (< 0.01). The data show that the amount of time needed for WT and PTN−/− mice to recover the righting reflex after ethanol injection was effectively similar (Fig. 6a). In contrast, PTN-Tg mice show a significant decrease in the amount of time to recover the righting reflex after injection of the sedating dose of ethanol (Fig. 6a). To determine if the difference in the LORR recovery time was due to alterations in ethanol metabolism and clearance in PTN-Tg mice, we examined BECs at different time points after an injection of 3.6 g/kg ethanol (Fig. 6b). Two-way repeated measures anova showed a significant effect of time [F(2, 28) = 17.55]. However, no differences in the BEC were observed between genotypes [F(2, 28) = 0.1895]. These data indicate that endogenous PTN is not key for the sedative effects of ethanol and does not affect ethanol clearance in mice. However, the data demonstrate that cortical and/or hippocampal genetic PTN over-expression efficiently prevents the sedative effects of ethanol without affecting ethanol metabolism and clearance in mice.

image

Figure 5. Ethanol (2.0 g/kg)-induced ataxia. Time (mean ± SEM) spent on a rotarod following injection of 2.0 g/kg ethanol in wild type (WT), PTN−/− and pleiotrophin (PTN)-Tg mice. Performance of mice from the three genotypes improved over time in a similar manner (two-way RM anova: effect of genotype, F(2, 220) = 1.995).

Download figure to PowerPoint

image

Figure 6. Pleiotrophin (PTN)-Tg mice show decreased sedation in response to Ethanol. (a) Loss of righting reflex (LORR) test in WT, PTN−/− and PTN-Tg at 3.6 g/kg ethanol. Shown is the time of recovery from sedation. Results are presented as the mean ± SEM of the time to recovery from sedation. +< 0.05 versus PTN-Tg. (b) Blood ethanol concentration (BEC) in PTN−/− and PTN-Tg mice after an injection of 3.6 g/kg ethanol indicating no difference compared to wild type (WT) controls. Results are presented as the mean ± SEM of the BEC in mg% over time.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

Genetic pre-disposition, as well as adaptive changes in expression of drug-sensitive genes, is thought to contribute to alcohol dependence (Rietschel and Treutlein 2013). One of the genes significantly up-regulated in the PFC of patients after chronic alcohol intake is MK (Flatscher-Bader et al. 2005; Flatscher-Bader and Wilce 2008). We now demonstrate that PTN, the only other member of the PTN/MK developmentally regulated gene family (Herradon et al. 2005), is significantly up-regulated in the mouse PFC after acute administration of a rewarding dose of ethanol. PTN is also found up-regulated after administration of other drugs of abuse, such as amphetamine (Le Greves 2005). Interestingly, PTN genetically deficient (PTN−/−) mice have been found to be uniquely vulnerable to the neurotoxic effects of amphetamine in the nigrostriatal pathways (Gramage et al. 2010a), to show deficits in the extinction of amphetamine conditioning effects (Gramage et al. 2010b), and to have increased cognitive deficits induced by amphetamine (Gramage et al. 2013a). Therefore, we hypothesized that up-regulation of PTN after amphetamine administration constitutes a protective mechanism against amphetamine-induced neurotoxic and neuroadaptative effects (Herradon and Perez-Garcia 2014). Whether or not this is the case with other drugs known to increase the expression of PTN in the brain, such as ethanol, remains to be studied.

We now demonstrate that genetic deletion of PTN in mice significantly enhances ethanol-induced CPP, suggesting PTN is a novel genetic factor that modulates ethanol rewarding effects. This suggestion was confirmed when the conditioning effects of ethanol were found to be abolished in PTN-Tg mice. The cortical PTN over-expression in PTN-Tg mice, particularly the four- to fivefold up-regulation of PTN protein levels in PFC compared to WT mice, is most likely key to the differences in ethanol-induced conditioning effects in PTN-Tg mice. The PFC is part of the mesolimbic system and crucial for drug reward. The ventral tegmental area form most of the mesolimbic and mesocortical projections involved in reward through its dopaminergic neurons which send their axons to nucleus accumbens, the striatum and PFC. In addition, it has to be noted that PTN is an established modulator of the functions of dopaminergic neurons (Herradon and Perez-Garcia 2014). In contrast, although the possibility that hippocampal PTN over-expression in PTN-Tg mice is involved in the modulation of ethanol-induced behavioural effects cannot be ruled out, it has to be noted that hippocampus is not part of the mesolimbic system and is only indirectly related to it. However, in addition to the cerebral cortex, hippocampus is one of the main areas affected by chronic ethanol-induced neurodamage (Tajuddin et al. 2014), indicating that the PTN-Tg mouse could also be useful to dissect the possible roles of PTN in ethanol-induced neurodamage.

It has to be noted that PTN-Tg mice show normal motor and exploratory abilities but have been shown to exert high anxiety-related behaviour in the elevated plus maze and light–dark box tests (Ferrer-Alcón et al. 2012) which could influence their response in a CPP procedure. Particularly, PTN-Tg mice spent less time in light in the light–dark box test which could partially resemble the biased CPP apparatus we used in our assays. However, it has to be noted that mice from the three genotypes started the CPP procedure with a similar degree of initial preference to the compartment with black walls. The use of a biased design in place conditioning studies is appropriate and the results can be interpreted in terms of rewarding drug effects if an absolute preference for the drug-paired compartment is induced in the control subjects (Tzschentke 2007; Gramage et al. 2013b). Thus, although we cannot discard the possibility of a conditioned reduction in aversion to the non-preferred compartment because of the known anxiolytic effects of alcohol, the data presented here more likely reflect the rewarding effects of ethanol in our CPP paradigm.

The modulatory role of PTN on the rewarding effects of ethanol cannot be generalized to all types of behavioural responses to ethanol. The data obtained in the rotarod test suggest that the ataxic effects induced by ethanol are not modulated by PTN. On the other hand, we found that the sedative effects of ethanol are similar in WT and PTN−/− mice, suggesting that normal endogenous PTN expression is not important in the modulation of the sedative effects of ethanol. However, over-expression of PTN exerts important effects on ethanol-induced LORR as proven by the significant decrease in LORR in PTN-Tg mice.

The important role of PTN in the regulation of the behavioural responses to ethanol is supported by its mechanism of action. PTN binds the receptor protein tyrosine phosphatase (RPTP) β/ζ (Meng et al. 2000). The interaction of RPTP β/ζ with PTN inactivates the intrinsic tyrosine phosphatase activity of RPTP β/ζ, thus resulting in increased phosphorylation of the substrates of RPTP β/ζ. Interestingly, two of these substrates, anaplastic lymphoma kinase (ALK) (Perez-Pinera et al. 2007) and Fyn Kinase (Pariser et al. 2005) are known to play important roles in behavioural responses to ethanol. It has been shown that Fyn kinase and its substrate the NR2B subunit of the NMDA receptor are part of a signalling pathway that is specifically activated during alcohol exposure and contributes to the molecular mechanisms underlying the maintenance of alcohol self-administration (Wang et al. 2007). In addition, gene targeting studies have shown that Fyn modulates the acute sedative effects of ethanol (Miyakawa et al. 1997; Yaka et al. 2003). Importantly, it has been recently hypothesized that distinct Fyn-depending expression networks within PFC, which presumably could be altered by over-expression of the upstream regulator of Fyn in PTN-Tg mice, may be important determinants of the LORR because of acute ethanol (Farris and Miles 2013). On the other hand, increased ALK expression in the brain negatively correlates with ethanol-induced ataxia and ethanol consumption in mice (Lasek et al. 2012). Additional studies are needed to dissect the possible contribution of ALK and/or Fyn kinase to the mechanisms triggered by PTN in the modulation of the behavioural responses to ethanol.

In summary, the data demonstrate a differential regulation of specific behavioural responses to ethanol by PTN and suggest potentiation of the PTN signalling pathway as a promising therapeutic strategy in the treatment of alcohol use disorders.

Acknowledgments and conflict of interest disclosure

  1. Top of page
  2. Abstract
  3. Methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References

This work has been supported by grant SAF2009-08136, and CENIT CEN-20101023, from Ministerio de Ciencia e Innovación of Spain and S2010-BMD2423 from Government of Comunidad de Madrid.

All experiments were conducted in compliance with the ARRIVE guidelines. The authors have no conflict of interest to declare.

References

  1. Top of page
  2. Abstract
  3. Methods
  4. Results
  5. Discussion
  6. Acknowledgments and conflict of interest disclosure
  7. References
  • Aigner L., Arber S., Kapfhammer J. P., Laux T., Schneider C., Botteri F., Brenner H. R. and Caroni P. (1995) Overexpression of the neural growth-associated protein GAP-43 induces nerve sprouting in the adult nervous system of transgenic mice. Cell 83, 269278.
  • Amet L. E., Lauri S. E., Hienola A., Croll S. D., Lu Y., Levorse J. M., Prabhakaran B., Taira T., Rauvala H. and Vogt T. F. (2001) Enhanced hippocampal long-term potentiation in mice lacking heparin-binding growth-associated molecule. Mol. Cell. Neurosci. 17, 10141024.
  • Bechtholt A. J., Smith R., Raber J. and Cunningham C. L. (2004) Enhanced ethanol-, but not cocaine-induced, conditioned place preference in Apoe(-/-) mice. Pharmacol. Biochem. Behav. 77, 783792.
  • Caroni P. (1997) Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71, 39.
  • Cunningham C. L., Henderson C. M. and Bormann N. M. (1998) Extinction of ethanol-induced conditioned place preference and conditioned place aversion: effects of naloxone. Psychopharmacology 139, 6270.
  • Dackis C. and O'Brien C. (2005) Neurobiology of addiction: treatment and public policy ramifications. Nat. Neurosci. 8, 14311436.
  • Ducci F. and Goldman D. (2008) Genetic approaches to addiction: genes and alcohol. Addiction 103, 14141428.
  • Farris S. P. and Miles M. F. (2013) Fyn-dependent gene networks in acute ethanol sensitivity. PLoS ONE 8, e82435.
  • Ferrer-Alcón M., Uribarri M., Díaz A. et al. (2012) A new non-classical transgenic animal model of Depression Program No. 776.04/FF9 Neuroscience Meeting Planner. New Orleans, LA: Society for Neuroscience, 2012. Online.
  • Flatscher-Bader T. and Wilce P. A. (2008) Impact of Alcohol Abuse on Protein Expression of Midkine and Excitatory Amino Acid Transporter 1 in the Human Prefrontal Cortex. Alcohol. Clin. Exp. Res. 32, 18491858.
  • Flatscher-Bader T., van der Brug M., Hwang J. W., Gochee P. A., Matsumoto I., Niwa S. and Wilce P. A. (2005) Alcohol-responsive genes in the frontal cortex and nucleus accumbens of human alcoholics. J. Neurochem. 93, 359370.
  • Gass J. T. and Chandler L. J. (2013) The plasticity of extinction: contribution of the prefrontal cortex in treating addiction through inhibitory learning. Front. Psychiatry 4, 46.
  • Gramage E. and Herradon G. (2011) Connecting Parkinson's disease and drug addiction: common players reveal unexpected disease connections and novel therapeutic approaches. Curr. Pharm. Des. 17, 449461.
  • Gramage E., Alguacil L. F. and Herradon G. (2008) Pleiotrophin prevents cocaine-induced toxicity in vitro. Eur. J. Pharmacol. 595, 3538.
  • Gramage E., Rossi L., Granado N., Moratalla R. and Herradon G. (2010a) Genetic inactivation of pleiotrophin triggers amphetamine-induced cell loss in the substantia nigra and enhances amphetamine neurotoxicity in the striatum. Neuroscience 170, 308316.
  • Gramage E., Putelli A., Polanco M. J., Gonzalez-Martin C., Ezquerra L., Alguacil L. F., Perez-Pinera P., Deuel T. F. and Herradon G. (2010b) The neurotrophic factor pleiotrophin modulates amphetamine-seeking behaviour and amphetamine-induced neurotoxic effects: evidence from pleiotrophin knockout mice. Addict. Biol. 15, 403412.
  • Gramage E., Martin Y. B., Ramanah P., Perez-Garcia C. and Herradon G. (2011) Midkine regulates amphetamine-induced astrocytosis in striatum but has no effects on amphetamine-induced striatal dopaminergic denervation and addictive effects: functional differences between pleiotrophin and midkine. Neuroscience 190, 307317.
  • Gramage E., Del Olmo N., Fole A., Martin Y. B. and Herradon G. (2013a) Periadolescent amphetamine treatment causes transient cognitive disruptions and long-term changes in hippocampal LTP depending on the endogenous expression of pleiotrophin. Addict. Biol. 18, 1929.
  • Gramage E., Perez-Garcia C., Vicente-Rodriguez M., Bollen S., Rojo L. and Herradon G. (2013b) Regulation of extinction of cocaine-induced place preference by midkine is related to a differential phosphorylation of peroxiredoxin 6 in dorsal striatum. Behav. Brain Res. 253, 223231.
  • Gramage E., Herradon G., Martin Y. B., Vicente-Rodriguez M., Rojo L., Gnekow H., Barbero A. and Perez-Garcia C. (2013c) Differential phosphoproteome of the striatum from pleiotrophin knockout and midkine knockout mice treated with amphetamine: correlations with amphetamine-induced neurotoxicity. Toxicology 306, 147156.
  • Hartley J. L., Temple G. F. and Brasch M. A. (2000) DNA cloning using in vitro site-specific recombination. Genome Res. 10, 17881795.
  • den Hartog C. R., Beckley J. T., Smothers T. C., Lench D. H., Holseberg Z. L., Fedarovich H., Gilstrap M. J., Homanics G. E. and Woodward J. J. (2013) Alterations in ethanol-induced behaviors and consumption in knock-in mice expressing ethanol-resistant NMDA receptors. PLoS ONE 8, e80541.
  • Herradon G. and Ezquerra L. (2009) Blocking receptor protein tyrosine phosphatase beta/zeta: A potential therapeutic strategy for Parkinson's disease. Curr. Med. Chem. 16, 33223329.
  • Herradon G. and Perez-Garcia C. (2014) Targeting midkine and pleiotrophin signaling pathways in addiction and neurodegenerative disorders: Recent progress and perspectives. Br. J. Pharmacol. 171, 837848.
  • Herradon G., Ezquerra L., Nguyen T., Silos-Santiago I. and Deuel T. F. (2005) Midkine regulates pleiotrophin organ-specific gene expression: evidence for transcriptional regulation and functional redundancy within the pleiotrophin/midkine developmental gene family. Biochem. Biophys. Res. Commun. 333, 714721.
  • Herradon G., Ezquerra L., Gramage E. and Alguacil L. F. (2009) Targeting the pleiotrophin/receptor protein tyrosine phosphatase beta/zeta signaling pathway to limit neurotoxicity induced by drug abuse. Mini Rev. Med. Chem. 9, 440447.
  • Houchi H., Babovic D., Pierrefiche O., Ledent C., Daoust M. and Naassila M. (2005) CB1 receptor knockout mice display reduced ethanol-induced conditioned place preference and increased striatal dopamine D2 receptors. Neuropsychopharmacology 30, 339349.
  • Lasek A. W., Lim J., Kliethermes C. L. et al. (2012) An evolutionary conserved role for anaplastic lymphoma kinase in behavioral responses to ethanol. PLoS ONE 6, e22636.
  • Le Greves P. (2005) Pleiotrophin gene transcription in the rat nucleus accumbens is stimulated by an acute dose of amphetamine. Brain Res. Bull. 65, 529532.
  • Luscher C. and Malenka R. C. (2011) Drug-evoked synaptic plasticity in addiction: from molecular changes to circuit remodeling. Neuron 69, 650663.
  • Marchand S., Betourne A., Marty V., Daumas S., Halley H., Lassalle J. M., Zajac J. M. and Frances B. (2006) A neuropeptide FF agonist blocks the acquisition of conditioned place preference to morphine in C57Bl/6J mice. Peptides 27, 964972.
  • Martin Y. B., Gramage E. and Herradon G. (2013) Maintenance of amphetamine-induced place preference does not correlate with astrocytosis. Eur. J. Pharmacol. 699, 258263.
  • Mayfield R. D., Harris R. A. and Schuckit M. A. (2008) Genetic factors influencing alcohol dependence. Br. J. Pharmacol. 154, 275287.
  • Meng K., Rodriguez-Pena A., Dimitrov T., Chen W., Yamin M., Noda M. and Deuel T. F. (2000) Pleiotrophin signals increased tyrosine phosphorylation of beta beta-catenin through inactivation of the intrinsic catalytic activity of the receptor-type protein tyrosine phosphatase beta/zeta. Proc. Natl Acad. Sci. USA 97, 26032608.
  • Miyakawa T., Yagi T., Kitazawa H., Yasuda M., Kawai N., Tsuboi K. and Niki H. (1997) Fyn-kinase as a determinant of ethanol sensitivity: relation to NMDA-receptor function. Science 278, 698701.
  • Muramatsu T. (2014) Structure and function of midkine as the basis of its pharmacological effects. Br. J. Pharmacol. 171, 814826.
  • Palmer R. H., Button T. M., Rhee S. H., Corley R. P., Young S. E., Stallings M. C., Hopfer C. J. and Hewitt J. K. (2012) Genetic etiology of the common liability to drug dependence: evidence of common and specific mechanisms for DSM-IV dependence symptoms. Drug Alcohol Depend. 123(Suppl 1), S24S32.
  • Pariser H., Ezquerra L., Herradon G., Perez-Pinera P. and Deuel T. F. (2005) Fyn is a downstream target of the pleiotrophin/receptor protein tyrosine phosphatase beta/zeta-signaling pathway: regulation of tyrosine phosphorylation of Fyn by pleiotrophin. Biochem. Biophys. Res. Commun. 332, 664669.
  • Perez-Pinera P., Zhang W., Chang Y., Vega J. A. and Deuel T. F. (2007) Anaplastic lymphoma kinase is activated through the pleiotrophin/receptor protein-tyrosine phosphatase beta/zeta signaling pathway: an alternative mechanism of receptor tyrosine kinase activation. J. Biol. Chem. 282, 2868328690.
  • Rietschel M. and Treutlein J. (2013) The genetics of alcohol dependence. Ann. N. Y. Acad. Sci. 1282, 3970.
  • Tajuddin N., Moon K. H., Marshall S. A., Nixon K., Neafsey E. J., Kim H. Y. and Collins M. A. (2014) Neuroinflammation and neurodegeneration in adult rat brain from binge ethanol exposure: abrogation by docosahexaenoic Acid. PLoS ONE 9, e101223.
  • Tzschentke T. M. (2007) Measuring reward with the conditioned place preference (CPP) paradigm: update of the last decade. Addict. Biol. 12, 227462.
  • Vicente-Rodriguez M., Perez-Garcia C., Gramage E. and Herradon G. (2012) Genetic inactivation of pleiotrophin but not midkine potentiates clonidine-induced alpha-2 adrenergic-mediated analgesia. Pharmacol. Biochem. Behav. 110, 185191.
  • Vicente-Rodriguez M., Gramage E., Herradon G. and Perez-Garcia C. (2013) Phosphoproteomic analysis of the striatum from pleiotrophin knockout and midkine knockout mice treated with cocaine reveals regulation of oxidative stress-related proteins potentially underlying cocaine-induced neurotoxicity and neurodegeneration. Toxicology 314, 166173.
  • Wang J., Carnicella S., Phamluong K., Jeanblanc J., Ronesi J. A., Chaudhri N., Janak P. H., Lovinger D. M. and Ron D. (2007) Ethanol induces long-term facilitation of NR2B-NMDA receptor activity in the dorsal striatum: implications for alcohol drinking behavior. J. Neurosci. 27, 35933602.
  • Yaka R., Tang K. C., Camarini R., Janak P. H. and Ron D. (2003) Fyn kinase and NR2B-containing NMDA receptors regulate acute ethanol sensitivity but not ethanol intake or conditioned reward. Alcohol. Clin. Exp. Res. 27, 17361742.