SEARCH

SEARCH BY CITATION

Keywords:

  • biglycan;
  • collagen;
  • decorin;
  • Sox9;
  • transforming-growth-factor-beta

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

One major aim of regenerative medicine targeting the musculoskeletal system is to provide complementary and/or alternative therapeutic approaches to current surgical therapies, often involving the removal and prosthetic substitution of damaged tissues such as ligaments. For these approaches to be successful, detailed information regarding the cellular and molecular composition of different musculoskeletal tissues is required. Ligaments have often been considered homogeneous tissues with common biomechanical properties. However, advances in tissue engineering research have highlighted the functional relevance of the organisational and compositional differences between ligament types, especially in those with higher risks of injury. The aim of this study was to provide information concerning the relative expression levels of a subset of key genes (including extracellular matrix components, transcription factors and growth factors) that confer functional identity to ligaments. We compared the transcriptomes of three representative human ligaments subjected to different biomechanical demands: the anterior cruciate ligament (ACL); the ligamentum teres of the hip (LT); and the iliofemoral ligament (IL). We revealed significant differences in the expression of type I collagen, elastin, fibromodulin, biglycan, transforming growth factor β1, transforming growth interacting factor 1, hypoxia-inducible factor 1-alpha and transforming growth factor β-induced gene between the IL and the other two ligaments. Thus, considerable molecular heterogeneity can exist between anatomically distinct ligaments with differing biomechanical demands. However, the LT and ACL were found to show remarkable molecular homology, suggesting common functional properties. This finding provides experimental support for the proposed role of the LT as a hip joint stabiliser in humans.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Ligaments are key structures for joint stability and dynamics. They block certain displacements and/or guide and restrict joint movements within their physiological ranges. Additionally, ligaments provide important functional substrates for the transmission of proprioceptive information. The gross structures of ligaments are based on fibroblasts immersed in a collagen-based extracellular matrix (ECM), with collagen organised within cross-linked fibrils that are aligned according to tensile stress (Amiel et al. 1984). Type I collagen is the predominant molecule in these tissues; however, different components, such as other collagens, elastins/fibrillins or proteoglycans (PGs), are also present in tendons and ligaments, in proportion to their biomechanical demands (Hurle et al. 1990; Ros et al. 1995; Vogel & Peters, 2001; Vogel, 2004; Yoon & Halper, 2005; Franchi et al. 2010; Young et al. 2011).

Ligaments are hypocellular tissues, although their fibroblasts are connected to one another through long cellular processes. The cellular net is interconnected via GAP junctions, permitting communication throughout the entire ligament. Such an organisation may enable the orchestration of coordinated responses to maintain and adapt the composition and organisation of the ECM to the mechanical stress (McNeilly et al. 1996; Benjamin & Ralphs, 1997, 2000; Lo et al. 2002).

Collagen fibrils constitute approximately 80% of the dry weight of ligaments (Amiel et al. 1984). Type I collagen constitutes more than 95% of the collagen contained in ligaments, with the remaining portion primarily consisting of type III collagen, as well as small amounts of types V, VI, XI and XIV collagens (Amiel et al. 1984; Liu et al. 1995; Frank, 2004). The collagen molecules are cross-linked by bonds that stabilise the fibres and improve the tensile strength of the ligaments (Fujii et al. 1994; Eleswarapu et al. 2011). Additionally, the collagen fibrils confer the capacity for elongation to ligaments under increased mechanical stress, based on the crimping disposition of the collagen molecule (Boorman et al. 2006).

Elastic fibres are important components of dense connective tissues and have two major constituents, namely the fibrillin-based microfibrillar scaffold and the elastin deposits (Hurle et al. 1990; Neurath & Stofft, 1992; Strocchi et al. 1992; Ros et al. 1995; Hurle & Colombatti, 1996; Reinboth et al. 2000; Frank, 2004). The ratio of elastic fibres in the ligaments has a major impact on the biomechanical properties of the tissue, and their abundance is usually proportional to the tensile load on the ligaments (Neurath & Stofft, 1992; Sherratt et al. 2003; Frank, 2004; Glab & Wess, 2008).

The other ECM constituents of dense connective tissues include PGs, which are molecules based on a protein core that binds to the anionic glycosaminoglycan (aGAG) side-chains (Scott et al. 1995). The PG protein core binds at specific sites on the collagen fibrils, whereas the aGAGs form filaments that bridge between and across the collagen fibrils (Scott, 1992, 1996). These interfibrillar aGAG bridges are important in the maintenance of tissue shape, as they organise the collagen fibrils by linking them together. The aGAGs confer a hydrophilic character to the PGs, allowing them to aggregate with hyaluronic acid and thus determine the tissue's water content, which accounts for 60–70% of the total ligament weight (Amiel et al. 1984; Woo & Buckwalter, 1988; Hannafin & Arnoczky, 1994). Importantly, the PGs also modulate fibrillogenesis to create collagen fibres that accommodate the tensile forces (Pogany et al. 1994; Svensson et al. 1995; Pins et al. 1997; Graham et al. 2000; Corsi et al. 2002). It has also been suggested that PGs regulate cell growth and differentiation by controlling the local bioavailability of growth factors and/or through interactions with tyrosine kinase receptors (Ruoslahti, 1989; Hausser et al. 1994; Iozzo, 1998, 1999).

Ligaments have often been considered homogeneous tissues with common biomechanical properties. However, the development of regenerative medicine and advances in tissue engineering research have highlighted the functional relevance of the organisational and compositional differences between ligament types, especially in those with higher risks of injury. In this study, we used quantitative polymerase chain reaction (PCR) and Western blotting to analyse compositional and transcriptional differences in three ligaments of clinical relevance: the anterior cruciate ligament (ACL) of the knee; the iliofemoral ligament (IL); and the ligamentum teres (LT) of the hip. These ligaments are subjected to different biomechanical demands, and the knee and hip joints are potential targets of regenerative medicine, due to the high prevalence of traumatic and degenerative diseases in these joints. In addition, the functional role of the LT is controversial. It has been proposed that the LT plays a mechanical role in hip stabilisation analogous to that of the ACL of the knee (Wenger et al. 2007; Bardakos & Villar, 2009; Cerezal et al. 2010). Hence, a comparative analysis of molecular differences between the LT and other ligaments with better functional characterisation may provide new insights into their biomechanical properties. For this study, we selected a panel of genes that included ECM components, transcription factors and growth factors.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Human ligaments

In this study, we employed 10 round ligaments (LTs) of the hip, eight hip capsular ILs and eight ACLs from 20 different donors (Table 1). These ligaments were taken from donors lacking severe aging-related diseases (except hypertension), diagnosed with hip or knee arthrosis during the joint removal surgery for prosthesis substitution. Only ligaments without appreciable anatomical or gross structural anomalies were collected. After their collection, the samples were immediately frozen using liquid nitrogen immersion in the operating room before further processing. The donor ages ranged from 45 to 84 years. This project has been approved by the competent authority ‘COMITÉ ÉTICO DE INVESTIGACIÓN CLÍNICA DE CANTABRIA’ (Certificate no. 2513).

Table 1. Data concerning the donors of the ligaments collected in this study
DonorAge (years)SexPathologyLigamentLigament gross anatomy
  1. ACL, anterior cruciate ligament; IL, Iliofemoral ligament; LT, ligamentum teres.

184MalePrimary gonarthrosisACLNormal
277FemalePrimary coxarthrosisLTNormal
380FemalePrimary gonarthrosisACLNormal
454MalePrimary gonarthrosisACLNormal
575MalePrimary coxarthrosisLTNormal
664MalePrimary coxarthrosisLT & ILNormal
755MalePrimary coxarthrosisLTNormal
876MalePrimary coxarthrosisLT & ILNormal
975FemalePrimary gonarthrosisACLNormal
1054MalePrimary coxarthrosisILNormal
1161FemalePrimary gonarthrosisACLNormal
1272FemalePrimary gonarthrosisACLNormal
1373FemalePrimary coxarthrosisLT & ILNormal
1469MalePrimary coxarthrosisLT & ILNormal
1563MalePrimary coxarthrosisLT & ILNormal
1678MalePrimary coxarthrosisLT & ILNormal
1763FemalePrimary gonarthrosisACLNormal
1945FemaleHealthy body donorACLNormal
2068FemalePrimary coxarthrosisLT & ILNormal

Real-time quantitative PCR (Q-PCR) for gene expression analysis

Ligaments were homogenised using a hand-held rotor-stator homogeniser. RNA extraction was performed by the acid guanidinium thiocyanate–phenol–chloroform-based method (Chomczynski & Sacchi, 2006). Treatment with RNAse-free DNAse I (Ambion) and subsequent phenol extraction for RNA purification were performed. Purified RNA samples were quantified using a spectrophotometer (Nanodrop Technologies ND-1000). First-strand cDNA was synthesised by reverse transcriptase-PCR using random hexamers and M-MulV reverse transcriptase (Fermentas). The cDNA concentrations were measured in a spectrophotometer (Nanodrop Technologies ND-1000) and adjusted to 0.5 μg μL−1. Q-PCR was performed using the Mx3005P system (Stratagene) with automation attachment. In this work, we used SYBRGreen (Takara)-based Q-PCR. Gapdh expression did not vary significantly across the sample set and therefore was chosen as the normaliser in our experiments. Mean gene expression levels were calculated for each gene to determine differences between different tissues. Expression levels were evaluated relative to a calibrator according to the inline image equation (Livak & Schmittgen, 2001). We randomly selected IL values as the calibrator for comparison purposes.

Each value in this work represents the mean ± SEM of all the obtained samples. Data were analysed using one-way analysis of variance followed by Bonferroni tests for post hoc comparisons of gene expression levels. Statistical significance was set at P < 0.05. All the analyses were performed using spss for Windows version 18.0. Specific Q-PCR primers for human genes (Table 2) were designed using the primer3 program (Sequence Analysis, Informagen). Furthermore, dissociation curves were evaluated in the PCR reaction to ensure specificity (Fig. S1).

Table 2. Primers employed in this study
GeneForward primer (5′–3′)Reverse primer (5′–3′)
Scleraxis (SCX)gcaccaacagcgtgaacaggtgcgagatgtagctggag
Collagen 1a2 (Col1a2)tctggagaggctggtactgctagaccacgttcacctctcg
Collagen 3a1 (Col3a1)tagctggacctcgtggtagcccaggttcaccattctgtcc
Collagen 5a1 (Col5a1)ccaccagaacgtcacctaccgacatctcctcgtcgttgg
Collagen 9a1 (Col9a1)gcagattcaggattcctctggtggagacttccatccagtcc
Collagen 2a1 (Col2a1)tccagatgaccttcctacgcagctgcttcgtccagatagg
Elastin (Eln)gctaaggcagccaagtatgggacaccaacacctggaacg
Emilin 1 (Emn)tcactgaatgagctccagaccatgatacggtccttggttgc
Decorin (Dcn)atcatcctccttctgcttgccggtcatcaggaacttctgg
Biglycan (Bgn)cctccaggtggtctatctgcctgatgccgttgtagtaggc
Fibromodulin (Fmod)cctccaacaccttcaattccggtagaggttctccaggttgg
SRY (sex-determining region Y)-box 9 (Sox9)tctgaacgagagcgagaagcgcggctggtacttgtaatcc
Aggrecan (Acan)caagtggttcctggtgtgggctcggtggtgaactctagg
Hypoxia inducible factor 1 alpha (Hif1a)gaaggtattgcactgcacaggagcaccaagcaggtcatagg
Bone morphogenetic protein 12 (Bmp12)actacgaggcgtaccactgcagcagcgtctgaatgatgg
Transforming growth factor β inducible gene (Bigh3)caccatcaccaacaacatcccttcaagcatcgtgttgagc
Glyceraldehyde 3-phosphate dehydrogenase (Gapdh)tgcaccaccaactgcttagcggcatggactgtggtcatgag
Mohawk (Mhk)cgtattggaaggagatcaacgggacgacttctggatgatgc
Tenomodulin (Tnmd)tcctctggcatctgttagccttgccatggtctctcagc
Transforming growth factor β 1 (Tgfβ1)gatgtcaccggagttgtgcgtccacttgcagtgtgttatcc
Transforming growth factor β 2 (Tgfβ2)ctcagcaatggagaagaatgccgttgttcaggcactctgg
Transforming growth factor β 3 (Tgfβ3)caacgaactggctgtctgcttctgctcggaataggttgg
Transforming growth inducible factor 1 (TGiF1) gaaaggatggcaaagatccaaggaatgaaatggggtctcc

Patients may exhibit inherent differences that could mask the results. One limitation of this study, which is common to reports of this type, is that sourcing ligaments from age-matched truly normal joints proved unfeasible. To discard distorted interpretations due to structural differences in the ligaments based on potential patient-dependent variations, we analysed neutral adjacent tissues from affected joints (i.e. dermis; see Fig. S2). We used Q-PCR to analyse the gene expression levels of all the factors and proteins employed in this work in the control tissues. No statistically significant differences were found in these analyses, suggesting that the observed differences in the ligaments are not due to the characteristics of each patient.

Western blotting

Total protein extracts were obtained from the LT, IL and ACL samples. Cell lysis was performed with RIPA buffer [in mm: NaCl, 150; MgCl2, 1.5; NaF, 10; glycerol, 10%; EDTA, 4; Triton X-100, 1%; sodium dodecyl sulphate (SDS), 0.1%; deoxycholate, 1%; HEPES, 50; pH 7.4] supplemented with the protease inhibitors phenylmethylsulphonyl fluoride (1 mm), leupeptin (10 μg mL-1) and aprotinin (10 μg mL-1) for 15 min on ice. The cell lysates were clarified of cellular debris by centrifugation (13 200 g) for 10 min at 4 °C. Proteins were separated by 10% polyacrylamide gel electrophoresis containing 0.1% SDS and were transferred to a polyvinylidene fluoride membrane (Bio-Rad). The membranes were incubated for 1 h at room temperature in bovine serum albumin and incubated overnight with the following antibodies: rabbit polyclonal antibody against SOX9 (Chemicon); rabbit polyclonal antibody against DECORIN (Cell Signalling); and rabbit polyclonal antibody against transforming growth factor TGF__ (Santa Cruz Sc-146). Protein bands were detected with an ODYSSEY infrared-imaging system (Li-Cor Bioscience) according to the ODYSSEY Western blot protocol. Immunoblots were developed with anti-mouse IRDye 800DX or anti-rabbit IRDye 680DX (Rockland Immunochemicals, USA). Three different samples of each ligament type were tested by Western blotting.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Expression of ECM components

One of the main purposes of this study was to gain insight into the tissue identities of the different ligaments under study. Therefore, we first evaluated by Q-PCR the relative levels of gene expression of a set of ECM components that are characteristic of most connective tissues. The ECM is the main component of ligaments, and comparisons of gene expression by this technique would thus be very informative in terms of determining tissue identity.

We began by analysing the fibrillar components of the ECM. The LT and ACL showed equivalent levels of expression of collagen Ia1 and collagen Ia2 (data not shown; Fig. 1, respectively), and these were significantly higher than levels found in the IL. Similar findings were obtained for type III collagen and type V collagen (Fig. 1). Regarding specific differences, the collagen IIa1 relative gene expression level was higher in the IL than in the LT and ACL (Fig. 1). However, differences in collagen IIa1 relative gene expression level between the ACL and IL were not statistically significant. In addition, the LT and ACL exhibited equivalent relative levels of gene expression of collagen IXa1 that were significantly lower than levels in the IL (Fig. 1). We found that elastin expression was equivalent in the ACL and LT, while these were higher levels than those observed in the IL (Fig. 1). Interestingly, other components of the elastic fibres, such as emilin 1 and emilin 3 (Hurle et al. 1994), displayed no among-group differences (Table 3; data not shown, respectively).

Table 3. Average ± SEM expression values of genes studied in this work where no significant differences were found between LT, ACL and IL
LigamentAverageSE+SE−
  1. Note that the expression for the IL was taken as calibrator for each gene in the Q-PCR values.

  2. ACL, anterior cruciate ligament; IL, Iliofemoral ligament; LT, ligamentum teres.

Emilin 1
LT1.0436506660.3217196580.245913456
ACL0.9438743130.2564450560.201656248
IL10.2924350840.226266749
Aggrecan
LT0.7261468960.2428594860.18199226
ACL0.6861836550.2277034310.170969012
IL10.2742611540.215231511
Tenomodulin
LT1.2180584240.4497154220.328449604
ACL1.043670760.3032024260.234946771
IL10.2715890720.213582421
Transforming growth factor beta 2
LT0.6610254750.147385260.120514743
ACL0.9595412060.3550012330.259130707
IL10.183687410.155182364
Transforming growth factor beta 3
LT0.7477124990.2373168650.180141621
ACL0.7722197370.249321970.188471352
IL10.1561547220.135063862
Scleraxis
LT0.7071748580.1097577940.095011446
ACL1.253750260.3739298610.288026286
IL10.234217790.189770227
Mohawk
LT1.197709290.8572154240.499626517
ACL1.0307896810.3226919980.245756989
IL10.2783794760.217759657
image

Figure 1. Comparative analysis of relative gene expression levels of fibrillar components of the ECM in the iliofemoral ligament (IL), the ligamentum teres of the hip (LT) and the anterior cruciate ligament (ACL), as measured by Q-PCR. Note that the expression level profiles for fibrillar components of the ECM are comparable between the LT and ACL but different in the IL. The expression level in the IL was considered as the baseline for each gene (calibrator). n = 6 LT, 4 ACL and 4 IL. *P < 0.05, **P < 0.01 or ***P < 0.001 in ACL or LT vs. LT. COL, collagen; ELN, elastin. Each bar represents the mean value ± SEM.

Download figure to PowerPoint

We also studied non-fibrillar components of the ECM, namely PGs. Decorin, the most abundant PG in ligaments, was expressed in significantly higher levels in the ACL than in the LT and IL, with the latter ligament types showing equivalent levels of relative gene expression (Fig. 2). These differences were confirmed at the protein level by Western blotting (Fig. 4). The relative Biglycan gene expression levels were significantly higher in the LT than in the other tissues (Fig. 2). Furthermore, relative Biglycan gene expression levels were higher in the ACL than in the IL (Fig. 2). The relative Fibromodulin gene expression levels were considerably higher in the ACL and LT than in the IL. In addition, the relative Fibromodulin gene expression levels were significantly more elevated in the ACL than in the LT (Fig. 2). Finally, Aggrecan expression was equivalent in all three tissues (Table 1).

image

Figure 2. Comparative analysis of relative gene expression levels of characteristic components of the ECM of ligaments in the iliofemoral ligament (IL), the ligamentum teres of the hip (LT) and the anterior cruciate ligament (ACL), as measured by Q-PCR. Note that the expression levels of the canonical ligament PGs DCN, BGN and FMOD are always higher in the ACL and/or LT than in the IL. The same pattern is observed for BIGH3, an important component of the ECM. The expression level in the IL was considered the baseline level for each gene (calibrator). BGN, Biglycan; BIGH3, Transforming growth factor β induced gene; DCN, Decorin; FMOD; Fibromodulin. n = 6 LT, 4 ACL and 4 IL. *P < 0.05, **P < 0.01 or ***P < 0.001 in ACL or LT vs. LT. +P < 0.05 or +++P < 0.001 in ACL vs. LT. Each bar represents the mean value ± SEM.

Download figure to PowerPoint

Finally, among other types of proteins found in the ECM of ligaments, we did not observe any differences in the relative gene expression levels of Tenomodulin (Table 3). However, we detected an elevated expression of Transforming growth factor β induced gene (βigh3) in the ACL and LT compared with the IL (Fig. 2).

Expression of growth factors

As discussed above, the aim of this study was to obtain some insight into the tissue identity of the different ligaments under study, and growth factors are key players in the maintenance of ligament tissue integrity. Therefore, we chose to compare by Q-PCR the relative levels of gene expression of different widely recognised fibrogenic growth factors in the three ligaments. Members of the TGFβ superfamily are significantly involved in the development and maintenance of most connective tissues (Montero & Hurle, 2007; Montero et al. 2012). TGFβ genes have been recently shown to be absolutely required for the formation of dense connective tissue on the basis of in vitro evidence and in knock-out mice (Lorda-Diez et al. 2009; Pryce et al. 2009). In our study, differences in relative gene expression levels were only detected for TGFβ1, which was expressed at higher levels in the ACL and LT than in the IL (Fig. 3). TGFβ2 and TGFβ3 expression showed no differences between these tissues (Table 3). Analysis at the protein level confirmed the lower expression of TGFβ1 in IL (Fig. 4).

image

Figure 3. Comparative analysis of relative gene expression levels of growth and transcription factor genes in the iliofemoral ligament (IL), the ligamentum teres of the hip (LT) and the anterior cruciate ligament (ACL) as evaluated by Q-PCR. Note that the expression levels of the growth and transcription factors illustrated in the figure are similar in the ACL and LT but distinct in the IL. The expression level in the IL was considered the baseline for each gene (calibrator). BMP12, Bone morphogenetic protein 12; HIF1A, Hypoxia inducible factor 1α; SOX9, SRY (sex-determining region Y)-box 9 gen; TGFβ1, Transforming growth factor β1; TGiF1, Transforming growth interacting factor 1. n = 6 LT, 4 ACL and 4 IL. * P < 0.05, ** P < 0.01 or *** P < 0.001 in ACL or LT vs. LT. + P < 0.05 in ACL vs. LT. Each bar value represents the mean ± SEM.

Download figure to PowerPoint

image

Figure 4. Representative Western blots illustrating DECORIN, TGFβ1 precursor and SOX9 expression in the iliofemoral ligament (IL), the ligamentum teres (LT) and the anterior cruciate ligament (ACL). Note that the findings at the protein level reproduce to some extent those for gene expression. GAPDH was used as the loading control in all the experiments. n = 4 LT, 4 ACL and 4 IL.

Download figure to PowerPoint

Bone morphogenetic protein 12 (BMP12) is a member of the TGFβ superfamily and is known to stimulate fibrogenesis (Haddad-Weber et al. 2010; Berasi et al. 2011). We observed higher BMP12 relative gene expression levels in the IL than in the other ligaments; however, these differences did not reach statistical significance (Fig. 3).

Expression of transcription factors

Transcription factors are relevant molecular players that confer identities to different tissues. In fact it has been proposed that the balance between the expression levels of key transcription factors may specify different types of connective tissues as ligaments and tendons (Lorda-Diez et al. 2009; Furumatsu et al. 2010). In our comparative analysis of the gene expression levels in three ligaments, we chose three specific markers of ligament and tendon tissue identity, including Scleraxis (Lorda-Diez et al. 2009), Mohawk (Ito et al. 2010) and transforming growth interacting factor 1 (TGiF1) (Lorda-Diez et al. 2009). We found no significant differences in the relative gene expression levels of Scleraxis and Mohawk among the ACL, LT and IL (Table 3). However, we found an almost twofold increase in TGiF1 expression levels in the IL compared with the other two ligaments (Fig. 3).

In addition, chondrogenic markers are often expressed in ligaments, especially at the level of the enthesis (Smith et al. 2012). Thus, we analysed two major chondrogenic markers, Sox9 SRY (sex-determining region Y)-box 9 (Sox9) (Chimal-Monroy et al. 2003) and Hypoxia-inducible factor 1-alpha (Hif1a) (Kanichai et al. 2008). Interestingly, the relative gene expression levels of Sox9 were similar in the ACL and LT, but were significantly higher in the IL (Fig. 3). This finding was further demonstrated at the protein level by Western blotting (Fig. 4). Additionally, Hif1a relative gene expression levels were considerably higher in the ACL and LT than in the IL (Fig. 3). Finally, the ACL showed significantly higher expression levels of this gene than did the LT (Fig. 3).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The precise knowledge of different ligaments is of considerable clinical importance, as this information might be relevant to the improved design of modern healing strategies based on tissue engineering. Rupture of the ACL is one of the most prevalent ligament injuries, especially among people practicing contact sports or hiking (Farshad et al. 2011). ACL disruption causes changes in the kinematics of the knee, and this injury often results in knee instability with accompanying degeneration of the menisci and articular cartilage, as well as subsequent functional disability and pain. The LT of the hip has traditionally been considered an embryological remnant, acting as a vessel-bearing structure that allows blood supply to the femoral head. However, increasing evidence supports its role as a hip joint stabiliser, especially during flexion, external rotation and abduction, similar to the functional role of the ACL in the knee (Cerezal et al. 2010; Kivlan et al. 2013; Martin et al. 2013). Alterations in the LT have been associated with hip pain in athletes (Byrd & Jones, 2004). Compared with the distinct characteristics of the LT and the ACL, the IL is a less specialised ligament. However, the IL is a significant joint stabiliser for the standing position, and it limits the external rotation and extension of the femur (Wagner et al. 2012).

The tensile and elastic biomechanical properties of ligaments rely largely on the collagen and elastic fibres. We found that both the ACL and LT exhibit similar expression levels of collagen and elastic fibre genes. In fact, for those collagens that are more characteristic of ligaments, including collagen types I, III and V, expression levels were higher in the ACL and LT compared with the IL. As mechanical loading is an important factor modulating gene expression in connective tissues (Murchison et al. 2007; Scott et al. 2011), these findings could suggest that the LT is subjected to specialised biomechanical demands and is not simply an embryonic vestige that functions as a passive blood vessel bearer. Our interpretation is consistent with previous clinical and in vitro biomechanical studies (Wenger et al. 2007; Bardakos & Villar, 2009; Cerezal et al. 2010).

We analysed a panel of small leucine-rich PGs (SLRPs), including Decorin, Biglycan and Fibromodulin, which are important ECM components with key functions in the formation and homeostasis of ligaments. These PGs include collagen- and growth factor-binding molecules that are involved in the modulation of collagen fibrillogenesis, cell shape, cell growth and cell signalling (Corsi et al. 2002; Ferdous et al. 2007, 2010; Kilts et al. 2009). Furthermore, it is well recognised that PGs favour tissue hydration, acting as a lubricant between collagen fibres. They are also critical for the viscoelastic properties that allow ligaments under tension to return to their original shapes once the tension is removed (Scott, 1988; Weiss et al. 2002). Our findings showed that the ACL has the highest levels of Decorin (the predominant PG in ligaments) and Fibromodulin, which may account for the stiffness of the ligament. Consistent with this interpretation, the ACL is stiffer than the LT. Accordingly, animal models lacking these PGs show a disorganisation of the collagen fibres accompanied by reduced ligament stiffness. In these models, the ACL appears hypertrophied and torn, and it may exhibit ectopic ossification (Gill et al. 2002; Zhang et al. 2006; Kilts et al. 2009). The LT showed substantially higher levels of Biglycan expression than the IL or ACL. Similar to Decorin, Biglycan is a proteodermatan sulphate SLRP that mediates ligament stiffness (Kilts et al. 2009), and it may compensate for a deficiency of Decorin (Corsi et al. 2002; Zhang et al. 2006). Hence, despite these compositional differences in SLRPs, the mechanofunctional properties of the ACL and LT may be similar to each other and therefore different from those of the IL.

Proteoglycans modulate the bioavailability of growth factors. Hence, the high expression levels of PGs in the LT and ACL correlate with the elevated expression of TGFβ1 found in these ligaments. Decorin, Biglycan and Fibromodulin all bind TGFβ1, and they modulate its function in association with enzymatic processing (Hausser et al. 1994; Hildebrand et al. 1994). TGFβ1 has been involved in ligament development, homeostasis and healing, in turn regulating fibroblast differentiation, proliferation, adhesion and migration; furthermore, it promotes ECM synthesis and inhibits enzymatic degradation (Peltonen et al. 1991; Ghahary et al. 1993; Mauviel, 1993; Scherping et al. 1997; Uria et al. 1998; Evans, 1999; Lorda-Diez et al. 2009; Ferdous et al. 2010; Achari et al. 2011; Wang et al. 2011a). TGFβ1 also promotes collagen cross-linking, thereby contributing to ligament stiffness (Eleswarapu et al. 2011). These functions of TGFβ1 are regulated by mechanical stress, which can stimulate its production.

Given the findings mentioned above, the higher levels of expression for TGFβ1 may reflect the greater demands of the ACL and LT for self-renewal and strengthening, given their exposure to upper loading and compressive supported stress, in comparison with the IL. In this regard, the presence of high βiGH3 expression levels in the LT and ACL is also suggestive of elevated TGFβ signalling activity in these ligaments. βiGH3 is a gene that is directly inducible by TGFβ proteins, and it is known to modulate cell adhesion, cell migration and cell differentiation (Thapa et al. 2007). Importantly, it has been recently shown that it potentiates profibrogenic effects on connective tissue precursors under the control of TGFβ signalling (Lorda-Diez et al. 2013).

We found higher expression of hypoxia inducible factor 1α (Hif1a) in the LT and especially in the ACL, compared with the IL. This high expression is suggestive of a hypoxic environment. The presence of vessels might well be the cause of the lower expression of this factor in the LT compared with the ACL. However, the levels were still higher in the LT than in the IL. In other models, the Hif1a expression in cartilage has been associated with the inhibition of cell proliferation and tissue hypocellularity (Schipani, 2005); therefore, Hif1a could well be acting in a similar fashion in these ligaments. Furthermore, Hif1a expression has been linked to high matrix-metalloproteinase 2 activity in ligaments (Wang et al. 2011b). This could be associated with the weak healing capability of some ligaments, such as the ACL, as it would interrupt the necessary balance in the ECM remodelling (Zhou et al. 2005).

We did not find substantial differences in the expression levels of transcription factors related to fibrogenic induction, such as Scleraxis or Mohawk. However, we did indeed find higher expression of chondrogenic factors, such as Sox9, in the IL compared with the ACL or LT. Accordingly, we identified higher expression levels in the IL of type II collagen or type IX collagen, which are collagens that are more abundant and characteristic in cartilage and fibrocartilage (Eyre et al. 2004; Chen et al. 2012). Consistent with this expression pattern, the IL presents a prominent fibrocartilage interphase at the enthesis (Wagner et al. 2012), which may explain our findings of higher IL expression levels of collagen II or collagen IX than those in the LT. The ACL shows an intermediate profile for these genes, which is again consistent with the presence of fibrocartilaginous structures (Petersen & Tillmann, 1999). Finally, TGiF is a profibrogenic factor that exhibits higher expression in the IL compared with the ACL or LT, with an intermediated profile found for the ACL. Importantly, this transcription factor is involved in inhibiting the expression of the prochondrogenic Sox9 gene (Lorda-Diez et al. 2009), and thus this transcription factor might be important in maintaining the identity of these capsular and knee ligaments.

In summary, our data complement traditional histological and functional studies of three representative human ligaments, and provide a transcriptomal characterisation of potential usefulness for modern regenerative medicine.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The authors declare no conflicts of interests. Thanks are due to Montse Fernandez-Calderon, Sonia Perez-Mantecón and Susana Dawalibi for excellent technical assistance. This work was supported by a grant from the Spanish Ministry of Economy and Competitiveness to JMH (BFU2011-24169).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Achari Y, Chin JW, Heard BJ, et al. (2011) Molecular events surrounding collagen fibril assembly in the early healing rabbit medial collateral ligament – failure to recapitulate normal ligament development. Connect Tissue Res 52, 301312.
  • Amiel D, Frank C, Harwood F, et al. (1984) Tendons and ligaments: a morphological and biochemical comparison. J Orthop Res 1, 257265.
  • Bardakos NV, Villar RN (2009) The ligamentum teres of the adult hip. J Bone Joint Surg Br 91, 815.
  • Benjamin M, Ralphs JR (1997) Tendons and ligaments – an overview. Histol Histopathol 12, 11351144.
  • Benjamin M, Ralphs JR (2000) The cell and developmental biology of tendons and ligaments. Int Rev Cytol 196, 85130.
  • Berasi SP, Varadarajan U, Archambault J, et al. (2011) Divergent activities of osteogenic BMP2, and tenogenic BMP12 and BMP13 independent of receptor binding affinities. Growth Factors 29, 128139.
  • Boorman RS, Norman T, Matsen FA 3rd, et al. (2006) Using a freeze substitution fixation technique and histological crimp analysis for characterizing regions of strain in ligaments loaded in situ. J Orthop Res 24, 793799.
  • Byrd JW, Jones KS (2004) Traumatic rupture of the ligamentum teres as a source of hip pain. Arthroscopy 20, 385391.
  • Cerezal L, Kassarjian A, Canga A, et al. (2010) Anatomy, biomechanics, imaging, and management of ligamentum teres injuries. Radiographics 30, 16371651.
  • Chen WC, Wei YH, Chu IM, et al. (2012) Effect of chondroitin sulphate C on the in vitro and in vivo chondrogenesis of mesenchymal stem cells in crosslinked type II collagen scaffolds. J Tissue Eng Regen Med 7, 665672.
  • Chimal-Monroy J, Rodriguez-Leon J, Montero JA, et al. (2003) Analysis of the molecular cascade responsible for mesodermal limb chondrogenesis: Sox genes and BMP signaling. Dev Biol 257, 292301.
  • Chomczynski P, Sacchi N (2006) The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on. Nat Protoc 1, 581585.
  • Corsi A, Xu T, Chen XD, et al. (2002) Phenotypic effects of biglycan deficiency are linked to collagen fibril abnormalities, are synergized by decorin deficiency, and mimic Ehlers-Danlos-like changes in bone and other connective tissues. J Bone Miner Res 17, 11801189.
  • Eleswarapu SV, Responte DJ, Athanasiou KA (2011) Tensile properties, collagen content, and crosslinks in connective tissues of the immature knee joint. PLoS ONE 6, e26178.
  • Evans CH (1999) Cytokines and the role they play in the healing of ligaments and tendons. Sports Med 28, 7176.
  • Eyre DR, Pietka T, Weis MA, et al. (2004) Covalent cross-linking of the NC1 domain of collagen type IX to collagen type II in cartilage. J Biol Chem 279, 25682574.
  • Farshad M, Gerber C, Meyer DC, et al. (2011) Reconstruction versus conservative treatment after rupture of the anterior cruciate ligament: cost effectiveness analysis. BMC Health Serv Res 11, 317.
  • Ferdous Z, Wei VM, Iozzo R, et al. (2007) Decorin-transforming growth factor-interaction regulates matrix organization and mechanical characteristics of three-dimensional collagen matrices. J Biol Chem 282, 35 88735 898.
  • Ferdous Z, Peterson SB, Tseng H, et al. (2010) A role for decorin in controlling proliferation, adhesion, and migration of murine embryonic fibroblasts. J Biomed Mater Res A 93, 419428.
  • Franchi M, De Pasquale V, Martini D, et al. (2010) Contribution of glycosaminoglycans to the microstructural integrity of fibrillar and fiber crimps in tendons and ligaments. Sci World J 10, 19321940.
  • Frank CB (2004) Ligament structure, physiology and function. J Musculoskelet Neuronal Interact 4, 199201.
  • Fujii K, Yamagishi T, Nagafuchi T, et al. (1994) Biochemical properties of collagen from ligaments and periarticular tendons of the human knee. Knee Surg Sports Traumatol Arthrosc 2, 229233.
  • Furumatsu T, Hachioji M, Saiga K, et al. (2010) Anterior cruciate ligament-derived cells have high chondrogenic potential. Biochem Biophys Res Commun 391, 11421147.
  • Ghahary A, Shen YJ, Scott PG, et al. (1993) Enhanced expression of mRNA for transforming growth factor-beta, Type I and Type III procollagen in human post-burn hypertrophic scar tissues. J Lab Clin Med 122, 465473.
  • Gill MR, Oldberg A, Reinholt FP (2002) Fibromodulin-null murine knee joints display increased incidences of osteoarthritis and alterations in tissue biochemistry. Osteoarthritis Cartilage 10, 751757.
  • Glab J, Wess T (2008) Changes in the molecular packing of fibrillin microfibrils during extension indicate intrafibrillar and interfibrillar reorganization in elastic response. J Mol Biol 383, 11711180.
  • Graham HK, Holmes DF, Watson RB, et al. (2000) Identification of collagen fibril fusion during vertebrate tendon morphogenesis: the process relies on unipolar fibrils and is regulated by collagen-proteoglycan interaction. J Mol Biol 295, 891902.
  • Haddad-Weber M, Prager P, Kunz M, et al. (2010) BMP12 and BMP13 gene transfer induce ligamentogenic differentiation in mesenchymal progenitor and anterior cruciate ligament cells. Cytotherapy 12, 505513.
  • Hannafin JA, Arnoczky SP (1994) Effect of cyclic and static tensile loading on water content and solute diffusion in canine flexor tendons: an in vitro study. J Orthop Res 12, 350356.
  • Hausser H, Groning A, Hasilik A, et al. (1994) Selective inactivity of TGF-beta/decorin complexes. FEBS Lett 353, 243245.
  • Hildebrand A, Romaris M, Rasmussen LM, et al. (1994) Interaction of the small interstitial proteoglycans biglycan, decorin and fibromodulin with transforming growth factor beta. Biochem J 302(Pt 2), 527534.
  • Hurle JM, Colombatti A (1996) Extracellular matrix modifications in the interdigital spaces of the chick embryo leg bud during the formation of ectopic digits. Anat Embryol (Berl) 193, 355364.
  • Hurle JM, Ros MA, Ganan Y, et al. (1990) Experimental analysis of the role of ECM in the patterning of the distal tendons of the developing limb bud. Cell Differ Dev 30, 97108.
  • Hurle JM, Corson G, Daniels K, et al. (1994) Elastin exhibits a distinctive temporal and spatial pattern of distribution in the developing chick limb in association with the establishment of the cartilaginous skeleton. J Cell Sci 107(Pt 9), 26232634.
  • Iozzo RV (1998) Matrix proteoglycans: from molecular design to cellular function. Annu Rev Biochem 67, 609652.
  • Iozzo RV (1999) The biology of the small leucine-rich proteoglycans. Functional network of interactive proteins. J Biol Chem 274, 18 84318 846.
  • Ito Y, Toriuchi N, Yoshitaka T, et al. (2010) The Mohawk homeobox gene is a critical regulator of tendon differentiation. Proc Natl Acad Sci USA 107, 10 53810 542.
  • Kanichai M, Ferguson D, Prendergast PJ, et al. (2008) Hypoxia promotes chondrogenesis in rat mesenchymal stem cells: a role for AKT and hypoxia-inducible factor (HIF)-1alpha. J Cell Physiol 216, 708715.
  • Kilts T, Ameye L, Syed-Picard F, et al. (2009) Potential roles for the small leucine-rich proteoglycans biglycan and fibromodulin in ectopic ossification of tendon induced by exercise and in modulating rotarod performance. Scand J Med Sci Sports 19, 536546.
  • Kivlan BR, Richard Clemente F, Martin RL, et al. (2013) Function of the ligamentum teres during multi-planar movement of the hip joint. Knee Surg Sports Traumatol Arthrosc 21, 16641668.
  • Liu SH, Yang RS, al-Shaikh R, et al. (1995) Collagen in tendon, ligament, and bone healing. A current review. Clin Orthop Relat Res 318, 265278.
  • Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402408.
  • Lo IK, Chi S, Ivie T, et al. (2002) The cellular matrix: a feature of tensile bearing dense soft connective tissues. Histol Histopathol 17, 523537.
  • Lorda-Diez CI, Montero JA, Martinez-Cue C, et al. (2009) Transforming growth factors beta coordinate cartilage and tendon differentiation in the developing limb mesenchyme. J Biol Chem 284, 29 98829 996.
  • Lorda-Diez CI, Montero JA, Diaz-Mendoza MJ, et al. (2013) Betaig-h3 potentiates the profibrogenic effect of tgfbeta signaling on connective tissue progenitor cells through the negative regulation of master chondrogenic genes. Tissue Eng Part A 19, 448457.
  • Martin RL, Kivlan BR, Clemente FR (2013) A cadaveric model for ligamentum teres function: a pilot study. Knee Surg Sports Traumatol Arthrosc 21, 16891693.
  • Mauviel A (1993) Cytokine regulation of metalloproteinase gene expression. J Cell Biochem 53, 288295.
  • McNeilly CM, Banes AJ, Benjamin M, et al. (1996) Tendon cells in vivo form a three dimensional network of cell processes linked by gap junctions. J Anat 189(Pt 3), 593600.
  • Montero JA, Hurle JM (2007) Deconstructing digit chondrogenesis. BioEssays 29, 725737.
  • Montero JA, Lorda-Diez CI, Hurle JM (2012) Regenerative medicine and connective tissues: cartilage versus tendon. J Tissue Eng Regen Med 6, 337347.
  • Murchison ND, Price BA, Conner DA, et al. (2007) Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development 134, 26972708.
  • Neurath MF, Stofft E (1992) Structure and function of matrix components in the cruciate ligaments: an immunohistochemical, electron-microscopic, and immunoelectron-microscopic study. Acta Anat (Basel) 145, 387394.
  • Peltonen J, Hsiao LL, Jaakkola S, et al. (1991) Activation of collagen gene expression in keloids: co-localization of type I and VI collagen and transforming growth factor-Beta 1 mRNA. J Invest Dermatol 97, 240248.
  • Petersen W, Tillmann B (1999) Structure and vascularization of the cruciate ligaments of the human knee joint. Anat Embryol (Berl) 200, 325334.
  • Pins GD, Christiansen DL, Patel R, et al. (1997) Self-assembly of collagen fibers. Influence of fibrillar alignment and decorin on mechanical properties. Biophys J 73, 21642172.
  • Pogany G, Hernandez DJ, Vogel KG (1994) The in vitro interaction of proteoglycans with Type I collagen is modulated by phosphate. Arch Biochem Biophys 313, 102111.
  • Pryce BA, Watson SS, Murchison ND, et al. (2009) Recruitment and maintenance of tendon progenitors by TGFbeta signaling are essential for tendon formation. Development 136, 13511361.
  • Reinboth BJ, Finnis ML, Gibson MA, et al. (2000) Developmental expression of dermatan sulfate proteoglycans in the elastic bovine nuchal ligament. Matrix Biol 19, 149162.
  • Ros MA, Rivero FB, Hinchliffe JR, et al. (1995) Immunohistological and ultrastructural study of the developing tendons of the avian foot. Anat Embryol (Berl) 192, 483496.
  • Ruoslahti E (1989) Proteoglycans in cell regulation. J Biol Chem 264, 13 36913 372.
  • Scherping SC Jr, Schmidt CC, Georgescu HI, et al. (1997) Effect of growth factors on the proliferation of ligament fibroblasts from skeletally mature rabbits. Connect Tissue Res 36, 18.
  • Schipani E (2005) Hypoxia and HIF-1 alpha in chondrogenesis. Semin Cell Dev Biol 16, 539546.
  • Scott JE (1988) Proteoglycan-fibrillar collagen interactions. Biochem J 252, 313323.
  • Scott JE (1992) Supramolecular organization of extracellular matrix glycosaminoglycans, in vitro and in the tissues. FASEB J 6, 26392645.
  • Scott JE (1996) Proteodermatan and proteokeratan sulfate (decorin, lumican/fibromodulin) proteins are horseshoe shaped. Implications for their interactions with collagen. Biochemistry 35, 87958799.
  • Scott JE, Heatley F, Wood B (1995) Comparison of secondary structures in water of chondroitin-4-sulfate and dermatan sulfate: implications in the formation of tertiary structures. Biochemistry 34, 15 46715 474.
  • Scott A, Danielson P, Abraham T, et al. (2011) Mechanical force modulates scleraxis expression in bioartificial tendons. J Musculoskelet Neuronal Interact 11, 124132.
  • Sherratt MJ, Baldock C, Haston JL, et al. (2003) Fibrillin microfibrils are stiff reinforcing fibres in compliant tissues. J Mol Biol 332, 183193.
  • Smith L, Xia Y, Galatz LM, et al. (2012) Tissue-engineering strategies for the tendon/ligament-to-bone insertion. Connect Tissue Res 53, 95105.
  • Strocchi R, de Pasquale V, Gubellini P, et al. (1992) The human anterior cruciate ligament: histological and ultrastructural observations. J Anat 180(Pt 3), 515519.
  • Svensson L, Heinegard D, Oldberg A (1995) Decorin-binding sites for collagen type I are mainly located in leucine-rich repeats 4-5. J Biol Chem 270, 20 71220 716.
  • Thapa N, Lee BH, Kim IS (2007) TGFBIp/betaig-h3 protein: a versatile matrix molecule induced by TGF-beta. Int J Biochem Cell Biol 39, 21832194.
  • Uria JA, Jimenez MG, Balbin M, et al. (1998) Differential effects of transforming growth factor-beta on the expression of collagenase-1 and collagenase-3 in human fibroblasts. J Biol Chem 273, 97699777.
  • Vogel KG (2004) What happens when tendons bend and twist? Proteoglycans J Musculoskelet Neuronal Interact 4, 202203.
  • Vogel KG, Peters JA (2001) Isolation of proteoglycans from tendon. Methods Mol Biol 171, 917.
  • Wagner FV, Negrao JR, Campos J, et al. (2012) Capsular ligaments of the hip: anatomic, histologic, and positional study in cadaveric specimens with MR arthrography. Radiology 263, 189198.
  • Wang Y, Tang Z, Xue R, et al. (2011a) TGF-beta1 promoted MMP-2 mediated wound healing of anterior cruciate ligament fibroblasts through NF-kappaB. Connect Tissue Res 52, 218225.
  • Wang Y, Tang Z, Xue R, et al. (2011b) Combined effects of TNF-alpha, IL-1beta, and HIF-1alpha on MMP-2 production in ACL fibroblasts under mechanical stretch: an in vitro study. J Orthop Res 29, 10081014.
  • Weiss JA, Gardiner JC, Bonifasi-Lista C (2002) Ligament material behavior is nonlinear, viscoelastic and rate-independent under shear loading. J Biomech 35, 943950.
  • Wenger D, Miyanji F, Mahar A, et al. (2007) The mechanical properties of the ligamentum teres: a pilot study to assess its potential for improving stability in children's hip surgery. J Pediatr Orthop 27, 408410.
  • Woo SL, Buckwalter JA (1988) AAOS/NIH/ORS workshop. Injury and repair of the musculoskeletal soft tissues. Savannah, Georgia, June 18–20, 1987. J Orthop Res 6, 907931.
  • Yoon JH, Halper J (2005) Tendon proteoglycans: biochemistry and function. J Musculoskelet Neuronal Interact 5, 2234.
  • Young K, Samiric T, Feller J, et al. (2011) Extracellular matrix content of ruptured anterior cruciate ligament tissue. Knee 18, 242246.
  • Zhang G, Ezura Y, Chervoneva I, et al. (2006) Decorin regulates assembly of collagen fibrils and acquisition of biomechanical properties during tendon development. J Cell Biochem 98, 14361449.
  • Zhou D, Lee HS, Villarreal F, et al. (2005) Differential MMP-2 activity of ligament cells under mechanical stretch injury: an in vitro study on human ACL and MCL fibroblasts. J Orthop Res 23, 949957.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
joa12124-sup-0001-FigS1.tifimage/tif22916KFig. S1. Graph showing the dissociation curves in a characteristic Q-PCR experiment for different genes employed in this study. Primer specificity was verified by the presence of only one amplicon at a specific temperature in each experiment. Xaxis= fluorescence; Yaxis= temperature.
joa12124-sup-0002-FigS2.tifimage/tif9587KFig. S2. Chart illustrating the comparison by Q-PCR of relative gene expression levels of several markers, in the dermis of the knee vs. the hip. Most of the relevant genes from this study are shown. The samples were taken from the knee and hip regions during the joint removal surgery procedures, at the same time that ligaments were collected. Each pair of bars represents the gene expression mean ± SEM values for dermis from the knee (left bar in each pair) and dermis from the hip (right bar in each pair). Note that the relative gene expression level in the knee was chosen as the calibrator for comparisons in each pair of bars. *P < 0.05, **P < 0.01 or ***P < 0.001. Note the absence of significant differences in any of the genes. The absence of significant differences precludes individual variations masking the differences observed between knee and hip ligaments. n(knee dermis) = 3 and n(hip dermis) = 3.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.