SEARCH

SEARCH BY CITATION

Keywords:

  • food intake;
  • blood amino acids;
  • intramuscular fat;
  • arginase;
  • mRNA

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

Dietary lysine restriction may differentially affect body growth and lipid and nitrogen metabolism, depending on the degree of lysine restriction. This study was conducted to examine the effect of dietary lysine restriction on growth and lipid and nitrogen metabolism with two different degree of lysine restriction. Isocaloric amino acid–defined diets containing 1.4% lysine (adequate), 0.70% lysine (50% moderate lysine restriction) and 0.35% lysine (75% severe lysine restriction) were fed from the age of 52 to 77 days for 25 days in male Sprague–Dawley rats. The 75% severe lysine restriction increased (p < 0.05) food intake, but retarded (p < 0.05) growth, increased (p < 0.05) liver and muscle lipid contents and abdominal fat accumulation, increased (p < 0.05) blood urea nitrogen levels and mRNA levels of the serine-synthesizing 3-phosphoglycerate dehydrogenase gene, but decreased (p < 0.05) urea cycle arginase gene mRNA levels. In contrast, the 50% lysine restriction did not significantly (p > 0.05) affect body growth and lipid and nitrogen metabolism. Our results demonstrate that severe 75% lysine restriction has detrimental effects on body growth and deregulate lipid and nitrogen metabolism.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

Lysine is one of the essential amino acids, and cereal-only based diets are first-limiting in lysine (Young and Pellett, 1944). Majority of the world's children live in developing countries and are fed predominantly cereal-based diets. The shortage of grain consumption as the sole protein source may cause growth retardation change metabolism in infants and children. Restricting dietary protein, amino acid deficiencies and an amino acid imbalance affect lipid and nitrogen/protein metabolism. However, controversial results have been reported regarding the effects of restricting lysine and an amino acid imbalance on food intake and metabolism. Food intake is reduced with a 10% supply of lysine or lysine deficiency (Nagao et al., 2009, 2010), whereas no food intake changes occur with decreased dietary lysine (Brookes et al., 1972; Tanphaichitr et al., 1976; Cieslak and Benevenga, 1984) There are also differences in the effect of restricting lysine on body fat deposition.

Reduced intake of dietary lysine promotes accumulation of intramuscular fat in the longissimus dorsi muscles of finishing gilts (Witte et al., 2000; Katsumata et al., 2005). In rats, carcass lipid increases linearly when lysine levels decrease from 0.67 to 0.52% (Cieslak and Benevenga, 1984). A low protein diet also leads to body fat accumulation in rats (Aparecida de Franca et al., 2009; Theys et al., 2009). Intramuscular fat (IMF) content is an important pork quality trait, and studies have shown that IMF content is increased by feeding of low lysine diets in pig (Witte et al., 2000; Katsumata et al., 2005). In contrast, dietary lysine levels do not affect muscle lipid content in pigs (Apple et al., 2004; Yang et al., 2009). These inconsistencies may be related to several factors, such as different lysine restriction levels and physiological states. Thus, a verification study on the effects of dietary lysine restriction on food intake and metabolic changes is needed.

This study was conducted to examine the effect of restricting dietary lysine on growth and lipid and nitrogen metabolism with two different levels of lysine restriction (50% moderate and 75% severe lysine restriction). An experiment with different levels of lysine restriction would allow us to clarify the effects of restricting lysine on body growth and metabolism. In addition, we sought to understand the underlying molecular mechanisms.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

Rats and diets

All experimental procedures involving rats were approved by the Chonnam National University (CNU) Institutional Animal Use and Care Committee. All procedures for animal management followed the standard operation protocols of CNU. Male Sprague–Dawley rats (age, 6 weeks; average wt, 250 g) were purchased from Central Lab. Animal (Seoul, South Korea). Rats were maintained at 22 °C on a 12:12 light/dark cycle and given free access to water. Isocaloric amino acid–defined diets with 1.4% lysine (adequate control), 0.7% lysine (50%, moderate lysine restriction) and 0.35% lysine levels (75%, severe lysine restriction) were purchased from Dyets (Bethlehem, PA, USA) (Table 1). Control diet is a L-amino acid–defined diet for rats to meet 1995 NRC nutrient requirements (Reeves et al., 1993). Approximately double the amount of glutamic acid for the amount of corresponding lysine restricted was added to the lysine-restricted diets to create isonitrogenous levels. Rats were fed each diet ad libitum from the age of 52–77 days. Body weight and food intake were measured every 3 days. Rats were sacrificed by CO2 anaesthesia and cervical dislocation after 25 days of feeding, and blood and tissue samples were taken. Blood was collected by cardiac puncture into either regular tubes without anticoagulant or disposable Vacutainer tubes containing sodium heparin as anticoagulant (Becton Dickson, Franklin, NJ, USA). Serum and plasma were collected after 2-h storage at 4 °C, followed by centrifugation (3000 g for 15 min). Tissues were weighed and immediately frozen.

Table 1. Composition of diets
ItemsL-Amino acid–defined diet (control)Lysine 50% restriction diet (Lys50)Lysine 75% restriction diet (Lys75)
g/kgkcal/kgg/kgkcal/kgg/kgkcal/kg
  1. Diets were purchased from Dyte, Inc. 3801.6 kcal = 15.906 MJ.

Amino acids
l-Arginine12.012.012.0
l-Histidine6.06.06.0
l-Lysine HCl14.07.03.5
l-Tyrosine4.04.04.0
l-Tryptophan2.02.02.0
l-Phenylalanine8.08.08.0
l-Methionine6.06.06.0
l-Cystine4.04.04.0
l-Threonine8.08.08.0
l-Leucine12.012.012.0
l-Isoleucine8.08.08.0
l-Valine8.08.08.0
Glycine20.020.020.0
l-Proline5.05.05.0
l-Glutamic acid30.044.151.13
l-Alanine5.05.05.0
l-Asparagine H2O5.05.05.0
l-Serine5.05.05.0
l-Glutamine5.05.05.0
Total L-amino acid167.0668174.1696.4177.63710.52
Other ingredients
Corn starch419.0861508.7419.0861508.7419.0861508.7
Dextrose140532140532140532
Sucrose10040092.9371.689.37357.48
Cellulose500500500
Soybean oil706307063070630
Vitamin mix no. 3100251038.71038.71038.7
Salt mix no. 2100303524.23524.23524.2
Sodium bicarbonate6.406.406.40
Choline bitartrate2.502.502.50
Tert-Butylhydroquinone0.01400.01400.0140
Total10003801.610003801.610003801.6

Blood analyses

All blood parameters were analysed by the Green Cross Reference Lab (Seoul, South Korea). Serum glucose was analysed using Glucose II (HK) Reagents (Bayer, Pittsburgh, PA, USA). Free fatty acids were analysed using the NEFA HR kit (Wako Pure Chemical, Osaka, Japan) and the results were obtained with a Hitachi 7180 autobiochemical analyzer. Blood urea nitrogen (BUN) was analysed with Urea Nitrogen Reagents (Bayer) based on the kinetic UV test, and creatine was analysed with Creatinine Reagents (Bayer) based on the Jaffe kinetic method. Serum adiponectin, insulin, leptin, glucagon and thyroxine (T4) levels were determined by radioimmunoassay (RIA) kits (Linco Research, St Charles, MO, USA) using an antibody raised against rats. Plasma amino acid analysis was performed with the Biochrom 20 amino acid analyzer using a Biological Fluid kit (Amersham Pharmacia, Piscataway, NJ, USA).

Real-time PCR

Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed into cDNA using AccuPower RT Premix (Bioneer, Seoul, South Korea). Real-time PCR was performed using the QuantiTect SYBR Green RT-PCR Master Mix (Qiagen, Valencia, CA, USA) (Table 2). The ΔΔCT method was used to determine the relative fold changes (Livak and Schmittgen, 2001), and mRNA levels were normalized to those of β-actin.

Table 2. Primers used in real-time PCR
Gene name (symbol)Accession no.PrimerSequence (5′–3′)Product size, bp
3-phosphoglycerate dehydrogenase (PHGDH) NM_031620.1 ForwardTCCAGTTTGTGGACATGGTG114
ReverseATGCTTCTGCCAGACCAATC
Argininosuccinate synthetase 1 (ASS1) NM_013157.3 ForwardGAAAACCCCAAGAACCAAGC143
ReverseGTAGTGCCATCTTTGACGTTG
Argininosuccinate lyase (ASL) NM_021577.3 ForwardAGAAGCGGATCAATGTCCTG126
ReverseTGGCATCCATACTGTTGAGC
Arginase NM_017134.2 ForwardATATCTGCCAAGGACATCGTG142
ReverseAGGTCTCTTCATCACTTTGC
Beta-actin NM_031144.2 ForwardAGAGAAGCTGTGCTATGTTGCCCT125
ReverseACCGCTCATTGCCGATAGTGATGA

Statistical analysis

All data are expressed as mean ± SE. The effects of lysine restrictions were analysed by anova followed by GLM analysis using sas (SAS Inst, Cary, NC, USA). When a significant difference (p < 0.05) was observed, we analysed the mean separations using Duncan's multiple range test.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

Growth and body parameters

The 75% severe lysine restriction regime increased (p < 0.05) food intake, whereas 50% moderate lysine restriction tended (p > 0.05) to increase food intake (Fig. 1a; Table 3). The actual degree of lysine restriction when considering food intake during the entire experimental period was 46.4% and 71.1% of the control for the 50% and 75% restriction groups respectively. Energy intake per unit body weight was higher in the 75% lysine-restricted group compared to that in the control (Table 3). The 75% lysine restriction retarded (p < 0.05) growth and decreased (p < 0.05) food efficiency, whereas the 50% lysine restriction did not affect these parameters (Fig. 1b; Table 3).

Table 3. Effect of dietary lysine restriction on growth and body parameters of male rats
ItemsControl (n = 6)Lys50 (n = 7)Lys75 (n = 7)
  1. Values are mean ± SE. Values with different letters are different at p < 0.05.

Growth parameters
Body weight at d1, g296.1 ± 3.7296.9 ± 3.4296.9 ± 3.3
Body weight at d25, g422.2 ± 8.1a436.4 ± 12.9a387.3 ± 4.7b
Weight gain 126 ± 4.6a139.5 ± 10.1a90.4 ± 5.3b
Total food intake, g556.5 ± 20.2a596.3 ± 20.9a,b642.4 ± 14.7b
Total lysine intake, g7.79 ± 0.28a4.17 ± 0.15b2.25 ± 0.05c
Total energy intake, Kcal 2116 ± 76.9a 2267 ± 79.4a,b2442 ± 55.7b
Energy intake/body wt, Kcal/g5.01 ± 0.13a5.19 ± 0.08a6.30 ± 0.10b
Weight gain/food intake0.23 ± 0.004a0.23 ± 0.01a0.14 ± 0.004b
Body parameters
Liver, g15.5 ± 0.73a15.6 ± 0.83a12.8 ± 0.42b
Liver wt/body wt, g/g × 1003.66 ± 0.12a3.56 ± 0.08a,b3.31 ± 0.12b
Kidney, g3.00 ± 0.163.20 ± 0.112.90 ± 0.08
Kidney wt/body wt, g/g × 1000.71 ± 0.040.73 ± 0.020.75 ± 0.02
Subcutaneous fat, g6.90 ± 0.378.00 ± 0.768.10 ± 0.79
Subcutaneous fat wt/body wt, g/g × 1001.64 ± 0.091.82 ± 0.122.07 ± 0.19
Abdominal fat, g6.60 ± 0.737.50 ± 0.688.60 ± 0.53
Abdominal fat wt/body wt, g/g × 1001.55 ± 0.18a1.72 ± 0.13a,b2.22 ± 0.11b
Perirenal fat, g0.70 ± 0.120.60 ± 0.080.60 ± 0.08
Perirenal fat wt/body wt, g/g × 1000.15 ± 0.030.14 ± 0.020.15 ± 0.02
Epididymal fat, g5.20 ± 0.655.40 ± 0.534.70 ± 0.42
Epididymal fat wt/body wt, g/g × 1001.23 ± 0.141.24 ± 0.111.21 ± 0.09
Total fat, g19.30 ± 1.6321.60 ± 1.8522.00 ± 1.74
Total fat wt/body wt, g/g × 1004.58 ± 0.364.82 ± 0.335.67 ± 0.39
image

Figure 1. Effect of 50% (Lys50) and 75% lysine restriction (Lys75) on daily food intake (a) and body weight (b) in male rats. Values are mean + SE (n = 6–7). Values with different letters are significantly different at p < 0.05. There was no significant difference in body weight between control and lys50 group.

Download figure to PowerPoint

Liver weight decreased (p < 0.05) in the 75% lysine-restricted group compared to that in the control, whereas it was unchanged by 50% lysine restriction (Table 3). The 75% lysine restriction increased (p < 0.05) both relative abdominal fat weight/body weight and lipid content of both back and quadriceps muscles, but these were not affected (p > 0.05) by the 50% lysine restriction (Table 3; Fig. 2). Subcutaneous, perirenal and epididymal fat contents were unchanged by both the 75% and 50% lysine restriction. Liver lipid contents were higher in the 50% and 75% lysine-restricted groups as compared with the control group (Fig. 2).

image

Figure 2. Effect of 50% (Lys50) and 75% lysine restriction (Lys75) on lipid content in the liver and back and quadriceps muscle of male rats. Values are mean + SE (n = 6–7). Values with different letters are significantly different at p < 0.05.

Download figure to PowerPoint

Blood metabolic parameters

Blood urea nitrogen (BUN) levels were higher (p < 0.05) by approximately 30% in the 75% lysine-restricted group compared with the control group (Table 4). This change was not observed in the 50% lysine-restricted group. Blood adiponectin levels increased (p < 0.05) with the 75% lysine restriction, but these changes were not detected in the 50% lysine-restricted group. Blood glucose, free fatty acids, T4, glucagon, insulin and leptin levels were not changed with lysine restriction.

Table 4. Effect of dietary lysine restriction on the levels of blood parameters in male rats
ParametersControlLys50Lys75
  1. Values are mean ± SE (n = 6–7). Values with different letters are different at p < 0.05.

Creatinine, μm0.52 ± 0.030.56 ± 0.020.51 ± 0.02
Blood urea nitrogen, μm16.5 ± 1.34a16.0 ± 1.04a21.3 ± 2.14b
Glucose, μm163 ± 13.5166 ± 6.1166 ± 10.6
Free fatty acid, μm237 ± 25.0236 ± 23.4294 ± 31.4
T4, μm5.07 ± 0.315.26 ± 0.284.57 ± 0.26
Adiponectin, µg/ml7.75 ± 0.69a8.50 ± 0.79a13.15 ± 0.79b
Glucagon, pg/ml50.6 ± 4.5344.4 ± 6.1642.4 ± 1.93
Insulin, ng/ml4.82 ± 1.103.77 ± 1.023.18 ± 0.79
Leptin, ng/ml8.17 ± 1.068.57 ± 0.839.99 ± 1.44

Concentration of blood amino acids

The 50% and 75% lysine restriction treatments decreased (p < 0.05) blood lysine concentrations by 42% and 67% respectively (Table 5), demonstrating that our dietary lysine restriction regimen worked well in rats. A previous study also reported that diets lacking one of the essential amino acids decrease plasma levels of the deficient amino acid (Goto et al., 2010). Concentrations of essential amino acids including histidine, phenylalanine and valine, and those of non-essential amino acid including alanine, glutamic acid, glutamine, serine and tyrosine increased in the 75% lysine-restricted group (p < 0.05; Table 5). The 50% lysine restriction increased (p < 0.05) concentrations of isoleucine, alanine, glutamic acid, glutamine and glycine in the blood. In contrast, both the 75% and 50% lysine restrictions markedly decreased (p < 0.05) cystine concentration by 75% and 74% respectively.

Table 5. Effect of dietary lysine restriction on concentrations (μm) of plasma amino acids in male rats
Amino acids (AA)ControlLys50Lys75
  1. Values are mean ± SE (n = 6–7). Values with different letters are different at p < 0.05.

Total AA6011 ± 2106336 ± 1536260 ± 185
Essential AA2291 ± 1102121 ± 631993 ± 84
Non-essential AA3720 ± 107a4215 ± 122b4267 ± 113b
Sulphur-containing AA152.2 ± 8.6a115.3 ± 3.8b117.6 ± 5.3b
Essential AA
Histidine108.5 ± 7.2a,b103.6 ± 2.6a123.4 ± 8.1b
Isoleucine148.3 ± 12.5a178.6 ± 6.1b164.0 ± 7.9a,b
Leucine214.2 ± 17.5255.3 ± 7.7249.4 ± 14.2
Lysine532.5 ± 11.6a311.3 ± 22.6b177.8 ± 13.4c
Methionine117.2 ± 7.1b106.1 ± 3.4a109.0 ± 4.6a,b
Phenylalanine112.5 ± 7.1a124.9 ± 3.6a,b133.1 ± 4.8b
Threonine838.3 ± 40.9788.6 ± 50.4777.7 ± 49.4
Valine219.5 ± 15.6a252.6 ± 7.9a,b258.4 ± 16.8b
Non-essential AA
Alanine725.80 ± 35.0a839.71 ± 22.3b895.86 ± 20.9b
Arginine214.5 ± 29.6250.0 ± 11.6252.0 ± 16.4
Asparagine103.0 ± 8.397.7 ± 7.089.1 ± 7.3
Aspartic acid86.3 ± 9.190.9 ± 7.296.4 ± 6.3
Cystine35.0 ± 2.6a9.1 ± 0.5b8.6 ± 0.7b
Glutamic acid291.3 ± 23.3a489.0 ± 20.3b411.0 ± 29.1b
Glutamine680.8 ± 30.3a781.8 ± 18.1b794.9 ± 34.3b
Glycine712.0 ± 17.0a782.7 ± 20.7b733.7 ± 18.3a,b
Proline227.3 ± 13.3222.0 ± 5.7228.4 ± 13.2
Serine544.3 ± 24.5a543.0 ± 24.4a626.4 ± 25.4b
Tyrosine99.7 ± 3.6a109.3 ± 7.6a,b130.9 ± 5.4b
Cystine35.0 ± 2.6a9.1 ± 0.5b8.6 ± 0.7b

Nitrogen metabolic gene expression in the liver

Hepatic expression of 3-phosphoglycerate dehydrogenase (PHGDH) increased markedly in the 75% lysine-restricted group, whereas it was unchanged in the 50% lysine-restricted group (Fig. 3). Arginase gene mRNA levels decreased with a decrease in dietary lysine levels, whereas argininosuccinate synthetase 1 (ASS1) and argininosuccinate lyase (ASL) mRNA levels were not altered by lysine restriction.

image

Figure 3. Effect of 50% (Lys50) and 75% lysine restriction (Lys75) on mRNA levels of the 3-phosphoglycerate dehydrogenase (PHGDH) gene and urea cycle genes including argininosuccinate synthetase 1 (ASS1), argininosuccinate lyase (ASL) and arginase in the liver of male rats. mRNA levels were determined by real-time PCR and normalized to β-actin. Values are mean + SE (n = 6–7). Values with different letters are significantly different at p < 0.05.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

Growth, organ weight and food intake

This study was conducted to examine the effects of lysine restriction on growth and lipid and nitrogen metabolism with two different levels of lysine restriction. The 75% severe lysine restriction retarded body growth even though an increase in food intake was observed, whereas the 50% moderate lysine restriction did not affect growth and caused a slight increase in food intake. Rats fed the 50% lysine-restricted diet may compensate by slightly increasing food intake to maintain growth. In contrast, the 75% severe lysine restriction retarded body growth, and the growth retardation could not be compensated, even though rats consumed significantly more food compared to the control. Our results suggest that a 75% lysine restriction has detrimental effects on body growth, which raises an important issue regarding the clinical aspects of cereal-based diets to supply adequate amino acids. Consuming a sufficient amount of a cereal-based diet may not affect body growth, even if lysine is a limiting amino acid in grains. However, consuming a limited amount of cereal-based diets as a sole source of protein may cause problems in body growth and metabolism, particularly in infants and children.

In our study, lysine restriction affected organ weight, as we observed decreased liver weight in the 75% lysine-restricted group. Amino acid deprivation in mammals is problematic, as essential amino acids cannot be synthesized de novo. Some proteins must be degraded to repartition essential amino acids to synthesize the proteins necessary for survival (Guo and Cavener, 2007). Recycling of non-essential proteins in skeletal muscle and some internal organs such as the liver results in an overall reduction in body weight (Adibi, 1976; Kerr et al., 1978). This may partly explain the growth retardation and reduced liver weight in the 75% lysine-restricted group in our study.

The food intake response in rats fed the lysine-restricted diets is somewhat controversial. No change in voluntary food intake occurred with a decrease in dietary lysine (Cieslak and Benevenga, 1984). Rats fed diets containing 0.43% lysine also consumed the same amount of food as those fed 0.72% dietary lysine, despite a 25% reduction in final body weight. Similarly, body weight gain was depressed by approximately 20% in rats fed a lysine-deficient diet, yet average daily food intake was unchanged (Brookes et al., 1972). Our present results and other studies demonstrate that changes in food intake due to lysine restriction are dependent on the degree of restriction: a moderate 50% lysine restriction (0.70% lysine) did not affect food intake, whereas a severe 75% lysine restriction (0.35% lysine) increased food intake compared to the 1.40% lysine control diet. The 75% severe lysine restriction in our study may have caused an imbalance in essential amino acids, triggering an increase in food intake to compensate for the lysine deficiency. However, more severe lysine restriction (0.176% lysine) or complete lysine deficiency (no lysine) decreases food intake compared to that in a 1.76% lysine control diet in Wistar rats (Nagao et al., 2009, 2010). Therefore, a diet with no or little lysine may cause loss of the control mechanism for amino acid homoeostasis, leading to decreased food intake (Nagao et al., 2009, 2010).

Body fat accumulation and muscle lipid content

Our results demonstrate that lysine restriction affects body fat accumulation, depending on degree of lysine restriction; the 75% lysine restriction increased both relative abdominal fat accumulation/body weight and lipid content in back muscle and quadriceps, whereas these changes were not detected in the 50% lysine-restricted group. In young growing male rats, carcass lipid content increases linearly as lysine levels decrease (Cieslak and Benevenga, 1984). In pigs, nutritional modulation by feeding low lysine diets has been used to increase IMF content in muscle for the improvement of pork quality (Katsumata, 2011). Some studies have shown that IMF content is increased by feeding of low lysine diets in pig (Witte et al., 2000; Katsumata et al., 2005). However, dietary lysine levels do not affect muscle lipid content in pigs (Apple et al., 2004; Yang et al., 2009; Rodríguez-Sánchez et al., 2011). Differences in diet composition, physiological states, animal strains and the extent of amino acid restriction could be reasons for the inconsistency among studies. Our study demonstrates that the degree of lysine restriction is one of the reasons for the discrepancies among experiments in rats.

Cieslak and Benevenga (1984) showed that rats fed suboptimal levels of lysine over-consume energy per unit of body weight relative to rats fed an adequate lysine level, leading to an increase in body fat deposition. In our study, energy consumption per unit body weight was higher in the 75% lysine-restricted group than that in the control. Thus, overconsumption of energy may have contributed to the increase abdominal and intramuscular fat in the 75% lysine-restricted group in our study. Additionally, lysine restriction may generate extra essential and non-essential amino acids due to body protein catabolism. In our study, concentrations of several gluconeogenic amino acids including histidine, phenylalanine, alanine, glutamic acid, glutamine, serine and tyrosine increased in the 75% lysine-restricted group. Carbon skeletons generated from the degradation of excess gluconeogenic amino acids may be converted to extra energy, resulting in an increase in body fat accumulation. Thus, excess gluconeogenic amino acids generated by the 75% lysine restriction may have also in part contributed to the accumulation of abdominal and intramuscular fat.

Previously, leptin mRNA levels in subcutaneous fat were affected by lysine restriction in weaned pigs (Yang et al., 2009). Plasma leptin concentrations in rats are proportional to fat mass (Bieswal et al., 2006). In this study, we observed no changes in both leptin concentrations and total body fat contents by lysine restriction. Therefore, no change in leptin concentrations could be explained by no alteration of body fat content by lysine restriction.

Nitrogen metabolism

Our results demonstrate that lysine restriction affected nitrogen metabolism depending on the degree of lysine restriction. Concentrations of several gluconeogenic amino acids including histidine, phenylalanine, alanine, glutamic acid, glutamine, serine and tyrosine increased in the 75% lysine-restricted group. A specific amino acid–deficient diet or shortage of specific amino acids results in a decrease in blood, muscle and liver concentrations of such amino acids, predisposing the tissues to proteolysis to provide the deficient amino acid from endogenous protein (Kadowaki and Kanazawa, 2003; Vabulas and Hartl, 2005). Amino acids generated by catabolism of body proteins may have been partly responsible for the increase in blood concentrations of several amino acids in the 75% lysine-restricted group.

We observed increased BUN levels in the 75% lysine-restricted group. Skeletal muscle wasting due to muscle protein catabolism is commonly associated with an abnormally high rate of hepatic urea production but very low blood cystine levels (Dröge and Holm, 1997), suggesting that the blood cystine level itself is a physiological regulator of nitrogen balance. Thus, the increased blood urea levels and decreased circulating cystine levels observed in our study may reflect skeletal muscle wasting in the 75% lysine-restricted rats.

BUN is a sensitive protein deprivation marker (Cherala et al., 2006), and a decrease in dietary protein intake in adult rats lowers BUN concentrations (Sawaya and Lunn, 1998; Du et al., 2000). BUN levels also decrease in pigs fed lysine-restricted diets (Yang et al., 2009) or a low protein diet (Ruusunen et al., 2007). In contrast, consumption of excess protein increases urea synthesis and excretion and this increase is reflected as an increase in plasma urea concentration (Chen et al., 1999). Our study showed that the 75% lysine-restricted group had increased BUN levels, whereas the 50% lysine restriction did not affect BUN levels. Thus, our results are inconsistent with those of previous studies. Increased BUN concentration in the 75% lysine-restricted group suggests that these rats utilized amino acids less efficiently for growth than the rats in the control group and generated increased BUN to excrete nitrogen. A severe lysine restriction may also induce body protein catabolism to supply the shortage of lysine, which induces increased BUN derived from deamination of other extra amino acids. A diet with no lysine increases blood urea and urinary urea in weanling rats (Prior et al., 1975). Thus, our results and others suggest that changes in BUN concentration are dependent on the degree of amino acid restriction. Complete deficiency or severe lysine restriction increases BUN due to both inefficiency in amino acid utilization and proteolysis of body protein, whereas a moderate lysine restriction does not affect or decreases BUN levels.

Nitrogen metabolic gene expression in the liver

To understand the underlying mechanisms regulating altered nitrogen metabolism by lysine restriction, we measured the expression levels of genes associated with nitrogen metabolism. We found that expression of the serine-synthesizing PHGDH gene increased in the 75% lysine-restricted group. Lysine deficiency increases plasma concentrations of serine and threonine along with upregulating the PHGDH gene in growing Wistar rats (Nagao et al., 2009, 2010). PHGDH plays an important role in de novo hepatic serine biosynthesis (Greenberg and Ichihara, 1957). Thus, our results also demonstrate that upregulation of PHGDH gene expression was responsible for the increase in blood serine concentrations in the 75% lysine-restricted group.

We measured gene expression of urea cycle enzymes to determine whether lysine restriction affects transcription of these genes. mRNA levels of arginase, which cleaves arginine to yield urea and ornithine, decreased with the decrease in dietary lysine levels, suggesting that dietary lysine restriction impairs arginase gene transcription. However, mRNA levels of other urea cycle genes including ASS1 and ASL were not affected by dietary lysine levels.

Conclusion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

Our results demonstrate that dietary lysine restriction affected body growth and lipid and nitrogen metabolism depending on the degree of restriction; the 75% lysine restriction retarded body growth, altered lipid metabolism by increasing lipid contents in the liver and muscle and led to abdominal fat accumulation. This severe restriction also deregulated nitrogen metabolism by increasing BUN levels with the altered gene expression of hepatic nitrogen metabolism genes such as PHGDH and arginase. In contrast, the 50% lysine restriction did not significantly affect body growth or lipid and nitrogen metabolism.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References

This work was supported by grants from Korea Research Foundation (MOEHRD) (KRF-2007-521-F00033) and the Next-Generation BioGreen 21 Program (no. PJ00819103), Rural Development Administration, Republic of Korea.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  • Adibi, S. A., 1976: Metabolism of branched-chain amino acids in altered nutrition. Metabolism 25, 12871302.
  • Aparecida de Franca, S.; Dos Santos, M. P.; Garofalo, M. A.; Navegantes, L. C.; Kettelhut Ido, C.; Lopes, C. F.; Kawashita, N. H., 2009: Low protein diet changes the energetic balance and sympathetic activity in brown adipose tissue of growing rats. Nutrition 25, 11861192.
  • Apple, J. K.; Maxwell, C. V.; Brown, D. C.; Friesen, K. G.; Musser, R. E.; Johnson, Z. B.; Armstrong, T. A., 2004: Effects of dietary lysine and energy density on performance and carcass characteristics of finishing pigs fed ractopamine. Journal of Animal Science 82, 32773287.
  • Bieswal, F. M.; Ahn, T.; Reusens, B.; Holvoet, P.; Raes, M.; Rees, W.D.; Remacle, C., 2006: The importance of catch-up growth after early malnutrition for the programming of obesity in male rat. Obesity 14, 13301343.
  • Brookes, I. M.; Owens, F. N.; Garrigus, U. S., 1972: Influence of amino acid level in the diet upon amino acid oxidation by the rat. Journal of Nutrition 102, 2736.
  • Chen, H. Y.; Lewis, A. J.; Miller, P. S.; Yen, J. T., 1999: The effect of excess protein on growth performance and metabolism of finishing barrows and gilts. Journal of Animal Science 77, 32383247.
  • Cherala, G.; Shapiro, B. H.; D'mello, A. P., 2006: Two low protein diets differentially affect food consumption and reproductive performance in pregnant and lactating rats and long-term growth in their offspring. Journal of Nutrition 136, 28272833.
  • Cieslak, D. G.; Benevenga, N. J., 1984: The effect of amino acid excess on utilization by the rat of the limiting amino acid-lysine. Journal of Nutrition 114, 18631870.
  • Dröge, W.; Holm, E., 1997: Role of cysteine and glutathione in HIV infection and other diseases associated with muscle wasting and immunological dysfunction. FASEB Journal 11, 10771089.
  • Du, F.; Higginbotham, D. A.; White, B. D., 2000: Food intake, energy balance and serum leptin concentrations in rats fed low-protein diets. Journal of Nutrition 130, 514521.
  • Goto, S.; Nagao, K.; Bannai, M.; Takahashi, M.; Nakahara, K.; Kangawa, K.; Murakami, N., 2010: Anorexia in rats caused by a valine-deficient diet is not ameliorated by systemic ghrelin treatment. Neuroscience 166, 333340.
  • Greenberg, D. M.; Ichihara, A., 1957: Further studies on the pathway of serine formation from carbohydrate. Journal of Biological Chemistry 224, 331340.
  • Guo, F.; Cavener, D. R., 2007: The GCN2 eIF2alpha kinase regulates fatty-acid homeostasis in the liver during deprivation of an essential amino acid. Cell Metabolism 5, 103114.
  • Kadowaki, M.; Kanazawa, T., 2003: Amino acids as regulators of proteolysis. Journal of Nutrition 133, 20522056.
  • Katsumata, M., 2011: Promotion of intramuscular fat accumulation in porcine muscle by nutritional regulation. Animal Science Journal 82, 1725.
  • Katsumata, M.; Kobayashi, S. I.; Matsumoto, M.; Tsneishi, E.; Kaji, Y., 2005: Reduced intake of dietary lysine promotes accumulation of intramuscular fat in the longissimus dorsi muscles of finishing gilts. Animal Science Journal 76, 237244.
  • Kerr, D. S.; Stevens, M. C.; Robinson, H. M., 1978: Fasting metabolism in infants. I. Effect of severe undernutrition on energy and protein utilization. Metabolism 27, 411435.
  • Livak, K. J.; Schmittgen, T. D., 2001: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402408.
  • Nagao, K.; Bannai, M.; Seki, S.; Mori, M.; Takahashi, M., 2009: Adaptational modification of serine and threonine metabolism in the liver to essential amino acid deficiency in rats. Amino Acids 36, 555562.
  • Nagao, K.; Bannai, M.; Seki, S.; Kawai, N.; Mori, M.; Takahashi, M., 2010: Voluntary wheel running is beneficial to the amino acid profile of lysine-deficient rats. American Journal of Physiology Endocrinology and Metabolism 298, 11701178.
  • Prior, R. L.; Milner, J. A.; Visek, W. J., 1975: Urea, citrate and orotate excretion in growing rats fed amino acid-deficient diets. Journal of Nutrition 105, 141146.
  • Reeves, P. G.; Nielsen, F. H.; Fahey, G. C. Jr, 1993: AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. Journal of Nutrition 123, 19391951.
  • Rodríguez-Sánchez, J. A.; Sanz, M. A.; Blanco, M.; Serrano, M. P.; Joy, M.; Latorre, M. A., 2011: The influence of dietary lysine restriction during the finishing period on growth performance and carcass, meat, and fat characteristics of barrows and gilts intended for dry-cured ham production. Journal of Animal Science 89, 36513662.
  • Ruusunen, M.; Partanen, K.; Pösö, R.; Puolanne, E., 2007: The effect of dietary protein supply on carcass composition, size of organs, muscle properties and meat quality of pigs. Livestock Science 107, 170181.
  • Sawaya, A. L.; Lunn, P. G., 1998: Lowering of plasma triiodothyronine level and sympathetic activity does not alter hypoalbuminaemia in rats fed on a diet of low protein concentration. British Journal of Nutrition 79, 455462.
  • Tanphaichitr, V.; Zaklama, M. S.; Broquist, H. P., 1976: Dietary lysine and carnitine: relation to growth and fatty livers in rats. Journal of Nutrition 106, 111117.
  • Theys, N.; Bouckenooghe, T.; Ahn, M. T.; Remacle, C.; Reusens, B., 2009: Maternal low-protein diet alters pancreatic islet mitochondrial function in a sex-specific manner in the adult rat. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 297, 15161525.
  • Vabulas, R. M.; Hartl, F. U., 2005: Protein synthesis upon acute nutrient restriction relies on proteasome function. Science 310, 19601963.
  • Witte, D. P.; Ellis, M.; McKeith, F. K.; Wilson, E. R., 2000: Effect of dietary lysine level and environmental temperature during the finishing phase on the intramuscular fat content of pork. Journal of Animal Science 78, 12721276.
  • Yang, Y. X.; Guo, J.; Jin, Z.; Yoon, S. Y.; Choi, J. Y.; Wang, M. H.; Piao, X. S.; Kim, B. W.; Chae, B. J., 2009: Lysine restriction and realimentation affected growth, blood profiles and expression of genes related to protein and fat metabolism in weaned pigs. Journal of Animal Physiology and Animal Nutrition 93, 732743.
  • Young, V. R.; Pellett, P. L., 1944: Plant proteins in relation to human protein and amino acid nutrition. American Journal of Clinical Nutrition 59, 12031212.