A genetics-based description of Symbiodinium minutum sp. nov. and S. psygmophilum sp. nov. (Dinophyceae), two dinoflagellates symbiotic with Cnidaria (48:1380–1391)

Authors

  • T. C. LaJeunesse,

  • J. E. Parkinson,

  • J. D. Reimer

Errata

This article corrects:

  1. A genetics-based description of Symbiodinium minutum sp. nov. and S. psygmophilum sp. nov. (Dinophyceae), two dinoflagellates symbiotic with cnidaria Volume 48, Issue 6, 1380–1391, Article first published online: 18 September 2012

In Table 2 (p. 1383), the sequences listed for primers cob1, dinocob1, 23S1M13, and 23S2M13 are incorrect. This revised Table 2 provides the correct primer sequences.

Table 2. Gene regions targeted for analyses, gene types, primer pairs used for PCR, primer sequences, approximate sizes of amplified DNA fragments, and annealing temperatures used to delineate species in clade B of the genus Symbiodinium. For analysis of ITS regions using denaturing gradient gel electrophoresis, a GC-rich area (clamp) is attached to the primer (underlined).
RegionTypePrimerPrimer Sequence (5′–3′)Size (bp)Tm (°C)
  1. a

    LaJeunesse et al. (2008).

  2. b

    LaJeunesse and Trench (2000).

  3. c

    Pettay and LaJeunesse (2007).

  4. d

    Zhang et al. (2005).

  5. e

    Santos et al. (2002).

  6. TD, touchdown PCR protocol.

ITS1 rDNANuclearITS1CLAMPa

CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCC

GGGATCCGTTTCCGTAGGTGAACCTGC

~42062-53 (TD)
ITS1intrev2aTTCACGGAGTTCTGCAAT
ITS2 rDNANuclearITS2CLAMPb

CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCC

GGGATCCATATGCTTAAGTTCAGCGGGT

~36062-52 (TD)
ITSintfor2bGAATTGCAGAACTCCGTG
Sym15NuclearB7Sym15 (forward)cCTCACCTTGAAATCAGTAGCCA~200–25059
B7Sym15 (reverse)cCGTAGCTTCTGAAGGTACGACAC
Cytochrome bMitochondrialcob1 (forward)dATGAAATCTCATTTACAWWCATATCCTTGTCC~95055
dinocob1 (reverse)dTCTCTTGAGGKAATTGWKMACCTATCCA
cp23S domain VPlastid23S1M13eCACGACGTTGTAAAACGACGGCTGTAACTATAACGGTCC~67055
23S2M13eGGATAACAATTTCACACAGGCCATCGTATTGAACCCAGC

Ancillary