Presented in part as an oral abstract at the 2012 American College of Veterinary Internal Medicine Forum, New Orleans, LA
Standard Article
Association between Granulomatous Colitis in French Bulldogs and Invasive Escherichia coli and Response to Fluoroquinolone Antimicrobials
Article first published online: 3 DEC 2012
DOI: 10.1111/jvim.12020
Copyright © 2012 by the American College of Veterinary Internal Medicine
Additional Information
How to Cite
Manchester, A.C., Hill, S., Sabatino, B., Armentano, R., Carroll, M., Kessler, B., Miller, M., Dogan, B., McDonough, S.P. and Simpson, K.W. (2013), Association between Granulomatous Colitis in French Bulldogs and Invasive Escherichia coli and Response to Fluoroquinolone Antimicrobials. Journal of Veterinary Internal Medicine, 27: 56–61. doi: 10.1111/jvim.12020
Publication History
- Issue published online: 11 JAN 2013
- Article first published online: 3 DEC 2012
- Manuscript Accepted: 16 OCT 2012
- Manuscript Revised: 21 SEP 2012
- Manuscript Received: 9 AUG 2012
- Abstract
- Article
- References
- Cited By
Keywords:
- Chronic diarrhea;
- Endoscopy;
- Fluorescence in-situ hybridization;
- Inflammatory bowel disease
Abstract
Background
French Bulldogs develop a form of granulomatous colitis (GC) with histopathological resemblance to GC of Boxer dogs (GCB). GCB is associated with mucosally invasive Escherichia coli whose eradication correlates with clinical remission.
Hypothesis/Objectives
To characterize the clinical and histopathological features, presence or absence of invasive colonic bacteria, and response to fluoroquinolones in French Bulldogs with GC.
Animals
A total of 6 French Bulldogs with a histological diagnosis of GC.
Methods
Retrospective study of medical records. Bacterial colonization was evaluated using 16S rRNA probes for eubacteria and E. coli. Biopsy specimens from 3 dogs were cultured for bacteria. Clinical response to fluoroquinolone antimicrobials was determined.
Results
All dogs were ≤1 year of age with hematochezia that was refractory to empirical therapy. Clinicopathologic and fecal analysis did not reveal abnormalities. Abdominal ultrasound revealed patchy thickening of the colon in 4/5 dogs and regional lymphadenopathy in 5/5. Colonoscopic abnormalities included irregularly thickened and ulcerated mucosa, hyperemia, and overt bleeding in 4/6 cases. Multifocal accumulations of PAS-positive macrophages and intramucosal E. coli were present in colonic biopsies of all 6 dogs. Administration of enrofloxacin (5/6) or marbofloxacin (1/6) at 4.4–10 mg/kg (median 10 mg/kg) PO q24h for 6–10 weeks was associated with clinical improvement within 5–14 days. All dogs remained in remission over a 3–30 month follow-up period.
Conclusions
Granulomatous colitis in young French Bulldogs is associated with the presence of invasive E. coli and closely parallels GCB. Treatment with fluoroquinolone antimicrobials can induce lasting clinical remission.
- AIEC
adherent-invasive Escherichia coli
- DAPI
4′,6′-diamidino-2-phenylindole
- FISH
fluorescent in-situ hybridization
- GCB
granulomatous colitis of Boxer dogs
- GC
granulomatous colitis
- HUC
histiocytic ulcerative colitis
- IBD
inflammatory bowel disease
- PAS
periodic acid-Schiff
Colitis characterized by granulomatous inflammation of the mucosa, lamina propria, and submucosa with a preponderance of infiltrative periodic acid-Schiff (PAS)-positive macrophages has been described almost exclusively in young Boxer dogs. This form of inflammatory bowel disease (IBD) is known as granulomatous colitis of Boxer dogs (GCB) or histiocytic ulcerative colitis (HUC).[1, 2] Clinical signs of GCB are typical of large bowel inflammatory disorders and include frequent, small-volume diarrhea, hematochezia, and tenesmus. Severe cases have hypoalbuminemia and cachexia. Isolated reports of a GCB-like disease have been described in the mastiff, Alaskan Malamute, Doberman Pinscher,[3] English Bulldog,[4] and French Bulldog.[5, 6]
Granulomatous colitis of Boxer dogs was widely considered a severe immune-mediated disease until remission in response to enrofloxacin-containing antimicrobial therapy was documented in 2004.[4, 7] These findings echoed the clinical response to chloramphenicol observed in 1965[1, 4] and strongly suggested that a bacterial infection is driving the chronic granulomatous inflammation. In 2006, studies employing contemporary culture-independent microbial techniques identified Escherichia coli within the colonic mucosa of GC-affected Boxer dogs.[9] Clinical remission correlates with eradication of these bacteria.[10, 11] Escherichia coli isolated from Boxers with GC usually lack virulence factors associated with diarrheagenic E. coli and most strains are able to invade epithelial cells, persist in macrophages or both, similar to adherent and invasive E. coli (AIEC).[9, 12, 13]
French Bulldogs share ancestry with Boxer dogs.[14] Anecdotal evidence suggests a predisposition of French Bulldogs to GC, although the published literature includes only 2 case reports of the disease in this breed.[5, 6] Little is known about the disease presentation, therapeutic responses, and potential role of bacteria in GC of French Bulldogs. Therefore, we characterized the clinical and histopathological features, the presence or absence of intramucosal bacteria in colonic biopsies, and the clinical responses to fluoroquinolone antimicrobials of 6 unrelated French Bulldogs with GC.
Materials and Methods
Six French bulldogs presented at 5 different referral centers across the United States (Cornell University Hospital for Animals 2/6, University of Tennessee Veterinary Medical Center 1/6, University of Florida Small Animal Hospital 1/6, Veterinary Specialty Hospital of San Diego 1/6, or Angell Animal Medical Center 1/6) for evaluation of chronic large-bowel diarrhea were included in this study. Each dog underwent a thorough diagnostic workup that included clinical pathological testing, abdominal sonography (5/6), and colonoscopic biopsy. A diagnosis of GC that resembled GCB was made by pathologists at each facility or at laboratories servicing the facility. Fresh biopsy samples were submitted for bacterial isolation and characterization by clinicians at 3 institutions (CUHA, VSH of San Diego, UFSAH).
A diagnosis of GC that resembles GCB was initially made by pathologists at each facility or laboratories servicing the facility. The diagnosis was independently confirmed by analysis of H&E and PAS-stained sections by another board certified veterinary pathologist (SPM). This individual was made aware of the respective canine's signalment and presenting clinical signs.
The signalment, history, physical exam findings, clinicopathological findings, ultrasound results, colonoscopic findings, histopathological evaluations, and clinical response to antimicrobial therapy were examined for each dog.
Fluorescence In Situ Hybridization
Formalin-fixed paraffin-embedded colonic sections were mounted on Probe-On Plus Slides (Fisher Scientific, Pittsburgh, PA) and evaluated by FISH using a eubacterial probe (5Cy3-EUB-338, GCTGCCTCCCGTAGGAGT) concomitantly with a control probe (56FAM-Non-EUB-338, ACTCCTACGGGAGGCAGC) as previously described.[9] In brief, biopsy specimens were deparaffinized by passage through xylene, 100% alcohol, 95% ethanol, and lastly, 70% ethanol. Then, slides air-dried while the FISH probes 5′ labeled with Cy-3 or 6-FAM (Integrated DNA technologies, Coralville, IA) were prepared by reconstitution with sterile water and dilution with a hybridization buffer (20 mM Tris-HCl, 0.1% sodium dodecyl sulfate [SDS], 0.9% NaCl [pH 7.2]) to a concentration of 5 ng/μL. Slides were incubated with 30 μL of the probe solution in a hybridization chamber for 4 hour at 46°C, washed in wash buffer (hybridization buffer without SDS) for 30 minutes at 48°C, then in PBS, and finally, air-dried. Sections were examined on a BX51 (Olympus America, Melville, NY) epifluorescence microscope and images were captured with an Olympus DP-7 camera (Olympus America).
Colonic sections with evidence of bacterial invasion were subsequently evaluated by FISH with a probe directed against E. coli/Shigella 16S rRNA (5Cy3-E. coli/Shigella, GCAAAGGTATTAACTTTACTCCC) and a control probe (56-FAM-Non-EUB-338) as described previously.[9]
Isolation of Mucosa-Associated Bacteria
Colonic biopsy samples from 3/6 French Bulldogs were ground in sterile saline with a sterile pestle. Half of the homogenate was incubated in GN broth (BBL, Becton Dickinson, Franklin Lakes, NJ) overnight at 35°C and then subcultured onto Levine EMB (BBL). The remainder was placed onto Trypticase soy agar (5% sheep blood, BBL), Levine EMB agar (BBL), and Columbia solistin and nalidixic acid (CNA) agar (5% sheep blood, BBL) and Gram-negative broth (GN). Each plate was incubated at 37°C in 6% CO2 for 18–24 hours at which point they were screened for target bacteria. Typical colonies were selected and screened by Gram-stain, catalase and oxidase reaction and then identified using an automatic detection system (Sensititre System, TREK Diagnostic Systems, Cleveland, OH). Isolates were stored in glycerol broth at −70°C for future investigations.
Antimicrobial Susceptibility Testing
The minimum inhibitory concentrations of a panel of antimicrobials selected for putative activity against E. coli isolated from colonic mucosa of 2/3 dogs were determined in keeping with the Clinical Laboratory Standards Institute (CLSI) interpretive criteria.[15] The panel consisted of amikacin, ampicillin, augmentin, cefazolin, cefoxitin, cefpodoxime, chloramphenicol, clindamycin, doxycycline, enrofloxacin, erythromycin, gentamicin, imipenem, marbofloxacin, oxacillin + 2% NaCl, penicillin, rifampin, ticarcillin, timentin, and trimethoprim sulfamethoxazole sulfa (TMS).
Results
The 6 French Bulldogs ranged in age from 5 to 12 months (median, 11 months). The group included 1 intact female, 2 intact males, and 3 castrated males. Dogs were presented for investigation of clinical signs that ranged from 2 to 11 months in duration (median, 5 months). Hematochezia was present in all 6 dogs, with 4 having persistent chronic diarrhea characterized by increased frequency of defecation. Feces consistency varied from nondiarrheic to semiformed to watery. Three dogs displayed frequent tenesmus, 3 exhibited progressive weight loss, and 1 consistently appeared painful when defecating.
Before referral, all dogs had undergone a variety of empirical therapeutic trials with antimicrobials (metronidazole 6/6 at 75–250 mg q12h, tylosin1 3/6 amoxicillin2 1/6 at 250 mg q12h for 1 week, azithromycin 1/6 at 80 mg q24h for 10 days, erythromycin 1/6, sulfadimethoxine3 1/6 enrofloxacin4 1/6 at 4.5 mg/kg PO q24h for 10 days), anthelmintics (fenbendazole5 4/6, pyrantel6 3/6, praziquantel7 2/6), anti-inflammatory drugs (sulfasalazine 1/6 at 125 mg q12h, olsalazine 1/6 at 90 mg q8h), and a probiotic (FortiFlora8). Dietary modification, including novel protein and low-residue formulations, was attempted in all dogs. None of these therapies were effective in relieving clinical signs. All dogs had normal attitude and activity levels. Three dogs were thin and 1 had a poor hair coat. Body condition scores ranged 2–6 of 9 (median, 4.5). The rectal mucosa was abnormally reddened in 2 dogs, and both these dogs had pain upon digital rectal manipulation. Rectal examination did not reveal any structural abnormalities. Hematologic evaluation generally did not reveal any abnormalities. Minor abnormalities detected included a mild normocytic normochromic anemia (PCV = 39%) with slight polychromasia in one, a few reactive lymphocytes in another, and a slightly elevated red cell distribution (RDW = 16) with a mild mature neutropenia (3.1 thou/μL) in a third. Serum chemistry performed in 5/6 dogs was within reference intervals apart from a mild hypoglobulinemia (1.7 g/dL), hyperphosphatemia (7.3 mg/dL), and hypoferremia (72 μg/dL) in the anemic dog, a slightly elevated glucose (129 mg/dL) and AST (97 U/L) in another dog, and mild hyponatremia (143 mEq/L) and hyperphosphatemia (7.2 mg/dL) in a 3rd dog. All five had normal serum albumin concentrations (range 2.9–3.5, median 3.4 g/dL). These clinicopathologic abnormalities were considered consistent with gastrointestinal inflammation, blood loss, and young age.
At the time of presentation, fecal flotation (5/5) and Giardia ELISA (4/4) results were negative for endoparasites. Fecal parasitology was not performed at the time of presentation in one dog. This dog had a history of Cyniclomyces cuttulatus and Saccharomycopsis guttulata infection 7 months before referral and a positive Giardia ELISA 3 months before colonoscopy. Clinical signs in this dog had persisted despite multiple courses of fenbendazole and metronidazole. Fecal cultures for Campylobacter and Salmonella were negative in 4/4 dogs in which they were performed. Rectal cytology, performed in 3/6 dogs, revealed moderate numbers of Campylobacter-like organisms in one, intracellular bacteria and neutrophils in another, and significant populations of spiral-shaped and beaded, filamentous bacteria with mature neutrophils in a 3rd dog. Five dogs underwent abdominal sonography. Mesenteric lymphadenopathy and irregular thickening of the colon wall were noted in 4/5 dogs, whereas multiple hypoechoic foci were found in the colonic submucosa of the 5th dog. Radiologists considered these findings consistent with an inflammatory infiltrative process. Enlargement of regional lymph nodes was attributed to reactive lymphoid hyperplasia. Colonoscopy was performed in all dogs. Gross examination revealed hyperemic, irregularly thickened colonic and rectal mucosa in 5/6. These abnormalities were diffuse with a cobblestone appearance and numerous ulcers and erosions in the colorectum of 4 cases and patchily ulcerated in one case. The 6th dog had a normal appearing colon, but the cecum was diffusely hyperemic with focal areas that were raised and edematous. The mucosa was considered markedly friable during biopsy in 4 dogs and the colon bled upon contact in 2 dogs. A minimum of 10 endoscopic biopsies were obtained from the colon of each dog and the cecum of 1 dog. Histopathological examination of colonic mucosa was consistent with GC in all dogs. Granulomatous inflammation characterized by dense cellular infiltration of the colonic mucosa, lamina propria, and sometimes submucosa with macrophages, neutrophils, and lymphocytes was readily apparent in multiple biopsy specimens from 4 dogs (Fig 1A). Multifocal to coalescing epithelial erosion and ulceration was observed adjacent to areas occupied by vast numbers of inflammatory cells. In 2 dogs, the distribution of granulomatous inflammation was limited to discrete regions of 1 or 2 biopsies. Reduction in PAS-positive mucus and goblet cells was apparent in inflamed regions. Additional architectural changes noted variably throughout the samples included glandular hyperplasia, goblet cell hyperplasia, crypt ectasia, and patchy fibrosis. Cecal biopsies were obtained from the dog whose cecum appeared grossly abnormally on colonoscopy; histopathological changes paralleled those seen scattered throughout the colon.
Figure 1. Photomicrographs of the colonic mucosa biopsy sections of a French Bulldog with granulomatous colitis. (A) Hematoxylin-eosin stained section showing marked infiltration of the lamina propria with macrophages, neutrophils, and lymphocytes (inset), loss of glandular structure, and superficial ulceration. (B) Periodic acid-Schiff staining highlights the presence of PAS-positive foamy macrophages. Only a few colonic glands are apparent which are depleted of mucus and do not stain positive with PAS. (C) FISH with 5Cy3-EUB-338 (red) and 56-FAM-Non-EUB-338 (green) reveals the presence of multifocal clusters of invasive bacteria (red), which are frequently within cells (inset). DAPI (4′,6′-diamidino-2-phenylindole) stained nuclei are blue. (D) FISH with a 5Cy3-Escherichia coli/Shigella probe (red) and 56-FAM-Non-EUB-338 control probe (green). Clumps of E. coli can be visualized within the colonic mucosa and intracellularly within macrophages (inset). DAPI stained nuclei are blue.

Periodic acid-Schiff (PAS) staining was performed on biopsies from all cases. This highlighted the presence of PAS-positive material in the cytoplasm of infiltrative macrophages in the lamina propria of all 6 cases (Fig 1B). Accumulations of PAS-positive histiocytes were located in areas with inflammation and architectural abnormalities in each dog. In sections from 4 dogs, they were diffusely scattered and readily detected whereas in sections from 2 dogs, these cells were focal and limited in number. Multifocal and discrete clumps of intramucosal bacteria, some within macrophages, were visualized in colonic biopsies from all dogs using eubacterial FISH (Fig 1C). In each dog, the invasive bacteria hybridized with a probe against E. coli/Shigella (Fig 1D). These were assumed to be E. coli rather than Shigella as the latter is not a common pathogen in dogs. Mucosa-associated bacteria were isolated from fresh biopsy specimens of 2/3 dogs. Bacteria isolated included E. coli, Enterococcus avium, other Enterococcus species, and Clostridium perfringens. Multiple colonies of E. coli were grown from 2 dogs' biopsy specimens. On the basis of colony morphology, 3 isolates (2 from 1 dog, 1 from another) were selected for antimicrobial susceptibility testing. All 3 isolates were uniformly resistant to the β-lactam antimicrobials penicillin, clindamycin, erythromycin, and oxacillin. All were susceptible to amikacin, cefazolin, and doxycycline. The most effective antimicrobials (MIC ≤ 0.5) included enrofloxacin, marbofloxacin, and TMS. Campylobacter, Salmonella, or Shigella was not isolated from either dog. All dogs received oral fluoroquinolone antimicrobials once per day for 6–10 weeks (median 8 weeks), in keeping with recommendations for treatment of Boxers with GC.[11] Five dogs received 10 mg/kg enrofloxacin. The dog previously unresponsive to enrofloxacin was prescribed marbofloxacin at 4.4 mg/kg for 10 weeks supplemented with sulfasalazine at 250 mg PO q8h. Three dogs underwent concurrent dietary modification with a hypoallergenic (Purina HA9 or Hill's z/d10) or novel protein diet (Royal Canin Hypoallergenic Potato and Venison11). One dog received ancillary antimicrobials consisting of olsalazine (90 mg q8h) and metronidazole (125 mg q12h) in addition to famotidine to address contemporaneous gastritis. Clinical signs resolved in all dogs within 3 to 14 days of initiating fluoroquinolone treatment. One dog which had lifelong unrelenting diarrhea and more than 7 bowel movements per day experienced normal bowel movements after 2 weeks of treatment. One month after initiation of treatment, 3 dogs were reported to have gained weight with one of these dogs reported as overconditioned (BCS increase from 2 to 6/9) upon examination 30 months after initial presentation. In the 4 dogs with follow-up >3 months (range 9–30 months), clinical remission was sustained beyond cessation of antimicrobial therapy at 6–10 weeks.
Discussion
Our study provides a series of GC in a single non-Boxer dog breed—the ancestrally related French Bulldog, demonstrating that GC in French Bulldogs is associated with intramucosal E. coli and clinical response to fluoroquinolone antimicrobials. Thus, GC in French Bulldogs is phenotypically, histologically, and microbiologically analogous to GCB.[9] The lack of clinical response to empirical therapeutic trials combining antibiotics, anthelmintics, anti-inflammatories, probiotics, and dietary modifications in French Bulldogs with clinical signs of GC contrast the favorable responses observed with targeted antimicrobial therapy. These findings underscore the importance of basing treatment on an accurate diagnosis.
The dramatic clinical responses of French Bulldogs with GC and intramucosal E. coli to fluoroquinolones support a causal role for E. coli in the pathogenesis of this disease. FISH analysis of tissue obtained after treatment would have enabled us to definitively ascertain the eradication of intramucosal E. coli, but we could not justify additional invasive procedures requiring anesthesia to clients who had observed complete remission of clinical signs in their pets. Based on previous findings in Boxer dogs where clinical remission correlated with elimination of intramucosal E. coli,[11] our results indicate that these French Bulldogs experienced an equivalent eradication of colonic mucosal bacteria. The uniform presence of intramucosal E. coli and response to specific antimicrobials in our group of 6 dogs argue against the use of immunosuppressive drugs and multiple rounds of empirical polypharmacy in French Bulldogs with GC, as is the case in GC-affected Boxers.[10] Antimicrobial therapy for dogs with GC could be optimized by considering the results of in vitro sensitivity testing of mucosal E. coli and the ability of the agent to penetrate macrophages where invasive E. coli reside and proliferate. Treatment success in Boxer dogs is most frequently achieved with fluoroquinolones and historically chloramphenicol, both of which enter cells and kill susceptible E. coli.[1, 2, 16]
Although the dogs in this study responded to fluoroquinolones, a recent study found 50% of 14 GC Boxers harbored fluoroquinolone-resistant E. coli.[10] Empirical use of these antimicrobials and treatment for <8 weeks before obtaining a definitive diagnosis were linked to enrofloxacin-resistance in this group. Standard therapy for nonresistant invasive E. coli consists of an 8-week course of enrofloxacin (7.5–10 mg/kg q24h). We speculate that the relatively rapid resolution of GC-associated clinical signs observed in this study and others could lead clients and clinicians to prematurely discontinue antimicrobial administration after 1 to 2 weeks before complete eradication of intramucosal E. coli has been achieved.[4, 11] This practice might promote the development of enrofloxacin-resistant E. coli, which has been associated with very poor outcomes, often euthanasia.[10] Experimental studies have demonstrated that azithromycin, clarithromycin, rifampin, tetracycline, and TMS are also effective against AIEC within macrophages.[16] These antimicrobials singly or in combination, such as tetracycline and TMS, might offer additional culture-based choices for treatment of GC in French Bulldogs and Boxers demonstrating resistance to fluoroquinolones.
Previous accounts of GC in other breeds including the Doberman, Mastiff, and Alaskan Malamute report dismal clinical responses to immunosuppression and nonfluoroquinolone antimicrobials.[3, 5, 8, 17] This suggests antimicrobial therapy targeting invasive E. coli could be efficacious in the GC in these other breeds. However, it is important to note that the histopathological features of GC can represent a common endpoint of a variety of infectious agents in susceptible individuals. For example, infection with Prototheca spp. is associated with GC in Boxer dogs in Australia.[18] Thus, in dogs with a histological diagnosis of GC it seems prudent to perform an initial survey for infectious agents in general rather than for specific bacterial species. On formalin-fixed biopsy samples, eubacterial FISH analysis in combination with traditional cytochemical methods such as Acid fast, GMS, PAS, Gram, and Modified Steiner stains should enable detection of a variety of bacteria, fungi, protozoa, and algae. We typically perform aerobic bacterial culture of fresh colonic biopsy samples for Salmonella, Campylobacter, and E. coli with isolates saved for antimicrobial susceptibility testing.
It is notable that GC has also been reported in the Mastiff and English Bulldog that along with Boxers and French Bulldogs fall within the group of Mastiff-type dogs that cluster together based on genetic similarity using microsatellite markers.[14, 19] The striking similarities of GC in Boxers and French Bulldogs and their common ancestry suggest that these breeds share a heritable defect conferring susceptibility to mucosally invasive E. coli, with consequent development of chronic inflammation. Identification of a genetic basis for this severe form of IBD could enable eradication of this trait by selective breeding.
In conclusion, GC in French Bulldogs closely parallels GCB in its clinical presentation, histopathological appearance, and involvement of mucosally invasive E. coli. Therapeutic responses of French Bulldogs are similar to those observed in GCB before the emergence of fluoroquinolone resistance. Because successful treatment of GC is predicated on the judicious selection of appropriate therapy, it seems prudent that treatment is guided by the detection of E. coli in colonic biopsy samples and their susceptibility to antimicrobials with the ability to penetrate macrophages. Our findings support the possibility that invasive bacteria are present in other breeds affected by GC.
Conflict of Interest: Authors disclose no conflict of interest.
- 1
Tylan, Elanco, Greenfield, IN
- 2
Amoxi-Tabs, Pfizer Animal Health, New York, NY
- 3
Albon, Pfizer Animal Health
- 4
Baytril, Bayer Animal Health, Shawnee Mission, KS
- 5
Panacure-C, Intervet, Inc, Roseland, NJ
- 6
Nemex, Pfizer Animal Health
- 7
Droncit Canine Tablets, Bayer Animal Health
- 8
FortiFlora Canine Nutritional Supplements, Purina, Vevey, Switzerland
- 9
HA Hypoallergenic Canine Formula, Purina
- 10
Prescription Diet z/d Canine ULTRA Allergen-Free, Hill's, Topeka, KS
- 11
Hypoallergenic PV Potato and Venison, Royal Canin, St. Charles, MO
References
- 1, , , . A granulomatous colitis of dogs with histologic resemblance to whipple's disease. Pathol Vet 1965;2:521–544.
- 2, , . Granulomatous colitis of Boxer dogs. Vet Clin North Am Small Anim Pract 2011;41:433–445.
- 3, , , et al. Histiocytic ulcerative colitis in three non-boxer dogs. J Am Anim Hosp Assoc 2001;37:461–465.
- 4, , , et al. Antibiotic-responsive histiocytic ulcerative colitis in 9 dogs. J Vet Intern Med 2004;18:499–504.Direct Link:
- 5, , . Histiocytic ulcerative colitis in a French Bulldog. J Vet Med Sci 2003;65:431–433.
- 6, , , et al. Histiocytic ulcerative colitis in a French Bulldog. J Small Anim Pract 1978;19:283–290.
- 7, , , . Successful management of histiocytic ulcerative colitis with enrofloxacin in two Boxer dogs. Aust Vet J 2004;82:58–61.
- 8, . Canine histiocytic ulcerative colitis. Aust Vet J 1997;75:710–713.
- 9, , , et al. Adherent and invasive escherichia coli is associated with granulomatous colitis in Boxer dogs. Infect Immun 2006;74:4778–4792.
- 10, , , et al. Antimicrobial resistance impacts clinical outcome of granulomatous colitis in Boxer dogs. J Vet Intern Med 2010;24:819–824.
- 11, , , et al. Remission of histiocytic ulcerative colitis in Boxer dogs correlates with eradication of invasive intramucosal escherichia coli. J Vet Intern Med 2009;23:964–969.
- 12, , , et al. Inflammation drives dysbiosis and bacterial invasion in murine models of ileal crohn's disease. PLoS ONE 2012;7:e41594.
- 13, . Adherent-invasive escherichia coli in inflammatory bowel disease. Inflamm Bowel Dis 2007;13:1277–1283.
- 14, , , et al. Genetic structure of the Purebred domestic dog. Science 2004;304:1160–1164.
- 15. Performance standards for antimicrobial susceptibility testing; eighteenth informational supplement. Wayne, PA: CLSI; 2008.
- 16, , , et al. Replication of colonic crohn's disease mucosal escherichia coli isolates within macrophages and their susceptibility to antibiotics. Antimicrob Agents Chemother 2008;52:427–434.
- 17, . Histiocytic ulcerative colitis in a Boxer dog. Aust Vet J 1978;54:447–449.
- 18, , , et al. Protothecosis in 17 Australian dogs and a review of the canine literature. Med Mycol 2007;45:249–266.
- 19, . The canine genome. Genome Res 2005;15:1706–1716.

1939-1676/asset/bannerforeground.gif?v=1&s=3ab0e3dc9095388081db55dec537408d13224811)
