SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Different life-cycle stages of Trypanosoma brucei are characterized by stage-specific glycoprotein coats. GPEET procyclin, the major surface protein of early procyclic (insect midgut) forms, is transcribed in the nucleolus by RNA polymerase I as part of a polycistronic precursor that is processed to monocistronic mRNAs. In culture, when differentiation to late procyclic forms is triggered by removal of glycerol, the precursor is still transcribed, but accumulation of GPEET mRNA is prevented by a glycerol-responsive element in the 3′ UTR. A genome-wide RNAi screen for persistent expression of GPEET in glycerol-free medium identified a novel protein, NRG1 (Nucleolar Regulator of GPEET 1), as a negative regulator. NRG1 associates with GPEET mRNA and with several nucleolar proteins. These include two PUF proteins, TbPUF7 and TbPUF10, and BOP1, a protein required for rRNA processing in other organisms. RNAi against each of these components prolonged or even increased GPEET expression in the absence of glycerol as well as causing a significant reduction in 5.8S rRNA and its immediate precursor. These results indicate that components of a complex used for rRNA maturation can have an additional role in regulating mRNAs that originate in the nucleolus.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

The differentiation of a unicellular eukaryotic parasite from one life-cycle stage to the next requires that individual cells perceive environmental signals and make appropriate adjustments in gene expression. Trypanosoma brucei spends part of its life cycle in mammals, where it can cause human sleeping sickness or the cattle disease Nagana, and the other part in its final host the tsetse fly. There are several distinct life-cycle stages in the mammal and the insect, and parasites colonize different tissues. Differentiation can therefore occur within a host or as a consequence of transmission between hosts (recently reviewed in Schwede et al., 2012). Trypanosomes in different host tissues are covered by characteristic stage-specific surface coats whose expression is tightly regulated. The establishment of chronic infections in mammals is due to a large repertoire of variant surface glycoprotein (VSG) genes, of which only one is active in a given cell. Periodic switching of VSG expression provides antigenically distinct coats and prevents elimination by the host immune system. Following ingestion by the tsetse fly bloodstream forms differentiate into early procyclic forms. During this process the parasites shed the VSG coat and replace it by insect-specific coat proteins known as GPEET and EP procyclins (Roditi and Clayton, 1999). Both classes of procyclin are expressed by early procyclic forms. Late procyclic forms, which establish a persistent infection in the midgut, express high levels of EP, but are negative for GPEET. In culture, differentiation from early to late procyclic forms occurs spontaneously in medium lacking glycerol, and can be accelerated by exposing cells to hypoxic conditions (Vassella et al., 2000). In the presence of glycerol or in medium low in glucose, the expression of GPEET can be prolonged, although not indefinitely (Vassella et al., 2004). Re-expression of GPEET has not been observed in tsetse, but can occur in culture when sugar transport or the activity of mitochondrial enzymes is perturbed by RNA interference (RNAi) (Morris et al., 2002; Vassella et al., 2004).

In contrast with most protein-coding genes in trypanosomes, the procyclin transcription units are transcribed by RNA polymerase I (Pol I) and have clearly defined promoters (Pays et al., 1990; Rudenko et al., 1990; Sherman et al., 1991; Günzl et al., 2003). They share features with genes transcribed by Pol II, however, such as their organization in polycistronic transcription units and the processing of precursor RNAs to monocistronic mRNAs (reviewed in Rudenko, 2010). The procyclin transcription unit on chromosome 10 begins with two procyclin genes – EP1 and EP2 – followed by up to four procyclin-associated genes (Haenni et al., 2006). The transcription unit on chromosome 6 starts with GPEET, followed by EP3 and two additional genes (Fig. 1A). Despite being transcribed in the nucleolus by Pol I, the maturation of procyclin mRNAs by addition of a capped spliced leader and polyadenylation is the same as for genes transcribed by Pol II in the nucleoplasm. GPEET is the first gene downstream of the promoter, and it continues to be transcribed in late procyclic forms, but no mRNA can be detected (Vassella et al., 2000). Regulation is post-transcriptional, with an element in the 3′ untranslated region (UTR), the glycerol-responsive element (GRE), destabilizing the GPEET transcript at this stage of the life cycle, both in culture and in the fly (Vassella et al., 2004; Urwyler et al., 2005). Mutation of the GRE prevents repression in procyclic forms in culture and in the tsetse midgut. In addition to the GRE, which is specific for GPEET, procyclin mRNAs share other elements that regulate mRNA stability and translation (Hehl et al., 1994; Furger et al., 1997). To date, however, no trans-acting factors that regulate procyclin mRNA stability have been identified.

figure

Figure 1. Generation of a GFP reporter cell line for GPEET expression.

A. The coding region of green fluorescent protein (GFP) replaced the coding region of GPEET in one copy of the GPEET/PAG3 locus on chromosome 6. Hatched boxes show untranslated regions, arrows mark the procyclin promoter. Homologous regions for recombination are indicated in grey.

B. The reporter cell line shows simultaneous expression of GFP and GPEET in early and differentiating procyclic forms. Both proteins are downregulated in late procyclic forms.

Download figure to PowerPoint

Ten years ago, the first RNAi library was constructed in late procyclic forms of T. brucei (Morris et al., 2002). A genome-wide screen with this library uncovered the link between inhibition of glucose transport and reactivation of GPEET expression. In the present study we describe a new RNAi library that we constructed in early procyclic forms. A screen of this library led to the isolation of cells that were no longer able to differentiate into late procyclic forms and identification of a negative regulator of GPEET in the nucleolus. This protein interacts with procyclin mRNA, two PUF proteins and at least one protein required for ribosome biogenesis in other organisms. Depletion of individual interacting proteins caused a delay in the repression of GPEET and impaired the maturation of ribosomal RNA. We propose that these proteins have at least two functions, one in ribosomal RNA processing, and an additional function in downregulating GPEET.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Construction of an RNAi library and identification of a negative regulator of GPEET

To identify factors regulating differentiation from early to late procyclic forms we constructed a new RNAi library. For the parental line we used a derivative of AnTat 90-13 (Engstler and Boshart, 2004) that was modified to reflect GPEET procyclin expression by simultaneous expression of green fluorescent protein (GFP). This was achieved by replacing the GPEET coding region on one copy of chromosome 6 by GFP, putting it under the control of regulatory elements in the GPEET 3′ UTR ( Fig. 1A). To guarantee that the resulting clone (AnTat 90-13-GFP) remained capable of differentiating through all stages of the life cycle, it was transmitted through tsetse flies and parasites from an infected mouse were triggered to differentiate into early procyclic forms. As shown by fluorescence microscopy, these were double-positive for GPEET and GFP (Fig. 1B). During differentiation to late procyclic forms, GPEET and GFP were downregulated in concert, resulting in cells that were either double-positive or double-negative for both proteins at all time points. GFP expression is therefore an accurate reflection of GPEET expression in individual trypanosomes (Fig. 1B).

An RNAi plasmid library based on pZJMβ (Wang et al., 2000) with opposing T7 promoters flanking inserts in the range from 500 to 2000 bp, was stably transformed into the GFP reporter cell line. The library showed a high diversity of inserts and an estimated fivefold coverage of the genome. To look for possible regulators of GPEET procyclin expression, an aliquot of the RNAi library (2 × 107 cells) was incubated with tetracycline to induce RNAi and at the same time triggered to differentiate into late procyclic forms by removing glycerol from the medium (Fig. 2A). After 12 days, when the majority of cells no longer expressed GPEET or GFP, the remaining green cells were isolated by fluorescence activated cell sorting (FACS). These cells were taken into culture (still in the presence of tetracycline) for recovery and expansion (Fig. S1). Four weeks after cell sorting the culture showed slow but steady growth (doubling time of 39 h) and was subjected to a second round of cell sorting. Genomic DNA was isolated from the pool of selected cells and RNAi inserts were amplified by PCR, cloned and sequenced. One of the sequences identified covered part of the open reading frame of a conserved hypothetical protein, Tb927.10.15170, with orthologues in Trypanosoma cruzi and Leishmania major. The protein is encoded by a single copy gene on chromosome 10 and has a predicted size of 77 kDa. Motif searches revealed a bipartite nuclear localization signal and a P-loop containing nucleoside triphosphate hydrolase motif (Fig. 2B). The C-terminus of the protein is most closely related to the C-terminal domain of the ATP-dependent RNA helicase DDX18 (human)/Has1p (yeast), but the degree of similarity is quite low (29% over 108 amino acid residues). Based on blast analyses, the protein with the highest similarity to human DDX18 is Tb927.10.6260. Furthermore, Tb927.10.15170 does not contain a recognizable helicase motif and no ATPase activity could be detected when it was expressed as a recombinant protein in Escherichia coli (data not shown). Taken together, no conclusions could be drawn about its function. To localize the product of Tb927.10.15170 in trypanosomes, red fluorescent protein (RFP) was fused to its C-terminus. The overexpressed fusion protein was detected in a single spot that colocalized with the negative DAPI staining of the condensed nucleolus and with a known nucleolar marker (Fig. 2C). Because of its influence on expression and its location in the cell we named the protein ‘nucleolar regulator of GPEET 1’ (NRG1).

figure

Figure 2. Identification of a negative regulator of GPEET expression.

A. Screening procedure using the RNAi library. RNAi was induced at the same time as differentiation into late procyclic forms was triggered by removal of glycerol (Ø gly). GFP-positive cells (green) were subjected to two rounds of fluorescence-activated cell sorting (FACS) and the RNAi inserts were amplified from the resulting cultures.

B. Schematic representation of the protein sequence of NRG1 (Tb927.10.15170). The protein contains a bipartite nuclear localization signal (yellow bars), a P-loop containing NTP hydrolase motif (green box) and a C-terminus related to the RNA helicase DDX18 (blue box). The region corresponding to the RNAi insert is indicated.

C. NRG1 was overexpressed as an RFP fusion protein. Immunofluorescence staining with an anti-nucleolar antigen antibody (L1C6) showed colocalization in the nucleolus.

D. Differentiation from early to late procyclic forms with (dashed lines) or without (solid lines) induction of RNAi against NRG1. Two independent clones (a, b) are shown; GFP-positive cells were quantified by flow cytometry.

Download figure to PowerPoint

The effect of NRG1 on GPEET expression was verified by back-cloning the insert into pZJMβ, followed by stable transformation of early procyclic forms of AnTat 90-13-GFP. Two clones were analysed for GFP expression during differentiation into late procyclic forms. In the presence of tetracycline, both clones delayed downregulation of GFP (Fig. 2D). After 18 days without glycerol more than 50% of cells were GFP-positive when RNAi was induced compared with 16% and 5%, respectively, without induction. The prolonged expression of GFP indicated that NRG1 participates in the repression of GPEET during differentiation to late procyclic forms. The RNAi construct seemed to be leaky, however, as even without induction the cells were not completely GFP-negative after 18 days. A new RNAi construct based on a stem-loop vector was therefore used to stably transform AnTat 90-13-GFP. Two independent clones were transmitted through tsetse flies and mice, and then triggered to differentiate into procyclic forms. The result of a representative RNAi experiment is shown in Fig. 3 (at least three experiments with similar results were performed with both clones). At day 0, logarithmically growing cells were triggered to differentiate to late procyclic forms by removal of glycerol from the medium. Growth was monitored during the differentiation of uninduced cells and cells induced at the start (d0) or 2 days prior to the start of differentiation (d-2). Both induced cultures showed a strong growth defect, with cells arresting between d2 and d4 (Fig. 3A). Total RNA was isolated from all three cultures and Northern blot analysis was performed (Fig. 3B). NRG1 and GPEET mRNAs were quantified and normalized against β-tubulin mRNA (Fig. 3C). Northern blot analysis confirmed the downregulation of NRG1 mRNA in the presence of tetracycline whereas mRNA levels were stable in uninduced cells. By day 8, cells from the d0 culture began to escape RNAi as NRG1 mRNA levels increased slightly. Early RNAi induction (2 days prior differentiation) gave essentially the same result, with an increase in NRG1 mRNA starting to be apparent at day 4 of the time-course. GPEET mRNA levels decreased approximately fourfold during differentiation of uninduced cells (Fig. 3B and C). In contrast, in cultures induced with tetracycline downregulation of GPEET mRNA was not only delayed, but rebounded, reaching higher levels than at the start of the experiment. This effect was most pronounced in the d-2 culture in which NRG1 was downregulated before differentiation was triggered. Ten days after induction of RNAi (and 8 days after the removal of glycerol) the level of GPEET mRNA in the d-2 culture declined slightly (Fig. 3C), although it was still higher than at the start of the experiment. The effect on steady-state levels of GPEET mRNA was mirrored by the number of GFP-positive cells (Fig. 3D) and by the levels of GFP and GPEET proteins (Fig. 3E). To obtain a more stable phenotype, without cells escaping from RNAi, we attempted to produce NRG1 knockouts, but were unable to delete the second copy of the gene (data not shown).

figure

Figure 3. RNAi against NRG1 increases GPEET expression.

A. Growth of uninduced cultures (−tet) and cultures induced for RNAi 2 days prior to initiation of differentiation (+tet d-2) or on the same day that differentiation was triggered (+tet d0).

B. Northern blot analysis of NRG1 and GPEET in the three cultures described above.

C. Quantification of the Northern blot. Relative mRNA levels of NRG1 (white bars) and GPEET (black bars) normalized against tubulin are shown.

D. Flow cytometric quantification of GFP-positive cells in the three cultures during the time-course.

E. Western blot analysis of NRG1, GPEET and GFP in the three cultures. An unspecific band (*) recognized by the anti-GFP antibody is shown as loading control.

Download figure to PowerPoint

NRG1 is a stage-regulated protein

Having established that NRG1 contributes to the regulation of GPEET, we investigated its expression in different life-cycle stages. NRG1 mRNA from bloodstream forms and early and late procyclic forms was analysed by Northern blot analysis (Fig. 4A). All three life-cycle stages showed similar levels of NRG1 mRNA. To analyse the protein, a polyclonal antiserum was raised against NRG1. The affinity-purified antibodies detected the endogenous protein in the nucleolus (Fig. 4B) and the signal was reduced in cells subjected to RNAi, confirming its specificity (Figs 3E and 4B). In contrast to the mRNA levels, Western blot analysis using anti-NRG1 antiserum showed that expression of the protein was stage-regulated (Fig. 4C). NRG1 was below the level of detection in bloodstream forms, but the protein could be detected during differentiation into early procyclic forms, with slightly faster kinetics than EP procyclin (Fig. 4C). Early and late procyclic forms expressed similar levels of the protein (Fig. 4D), but NRG1 temporarily decreased approximately fivefold for the first 3 days of differentiation to late procyclic forms (Fig. 4D, days 1–3).

figure

Figure 4. Expression and localization of endogenous NRG1 and evidence for binding to procyclin mRNA.

A. Northern blot analysis of NRG1 mRNA in bloodstream forms (BSF), early and late procyclic forms (PCF).

B. Localization of endogenous NRG1 by immunofluorescence. DNA is visualized with DAPI. NRG1 is in the nucleolus (the area of negative staining in the nucleus). RNAi against NRG1 (+tet) abolished the signal.

C. Time-course of differentiation from bloodstream to procyclic forms. A total of 5 × 106 cell equivalents were loaded per lane. NRG1, EP procyclin and Hsp60 were analysed on Western blots. Ponceau Red staining shows equal loading.

D. Differentiation from early to late procyclic forms. NRG1, GPEET and Hsp60 protein were detected by Western blot analysis. NRG1 was quantified and relative numbers are given below the blot.

E. qPCR analysis of procyclin mRNA co-immunoprecipitated with HA-NRG1. RIP and qPCR were performed with cells induced for 2 days (+tet) or not induced (−tet) for the expression of HA-NRG1, and with the parental strain (AnTat1.1). The ratio of qPRC product from the RIP and the Input sample (normalized to the same amount of template cDNA) is shown. The expression of HA-NRG1 was verified by Western blotting (upper inset). RT-PCR amplification of coding regions from input material (In) and the co-precipitated transcripts (RIP). PCR products were separated by agarose gel electrophoresis (lower inset). No products were obtained in the absence of reverse transcriptase.

Download figure to PowerPoint

To investigate whether procyclin transcripts associate with NRG1, a haemagglutinin (HA)-tagged form of the protein was expressed from an inducible promoter in AnTat 90-13 (Fig. 4E, inset, upper panel). RNA-immunoprecipitation (RIP) was performed using a matrix to capture HA-NRG1 from cultures incubated with tetracycline for 2 days to induce its expression; uninduced cultures and wild-type AnTat 1.1 were used as controls. Quantitative reverse transcription-PCR was performed with a primer pair that amplifies the 3′ UTR of GPEET and EP1. For technical reasons, it was not possible to select primers that were suitable for qPCR and also exclusively specific for GPEET. Three independent experiments were performed with procyclic forms cultured in the presence of glycerol (35–68% GPEET-positive cells). In all cases procyclin transcripts were enriched after RIP from cultures expressing HA-NRG1 (Fig. 4E), indicating that the protein and RNA associate with each other, whereas no signals above background were obtained from the two controls. Since the primer pair used for qPCR does not discriminate between GPEET and EP, because the 3′ UTRs are the same length, non-quantitative RT-PCR was performed. In this case, the amplicons spanned the 5′ UTR and coding regions of all procyclins and could be distinguished by their lengths. These experiments revealed that trans-spliced GPEET mRNA and a small amount of EP mRNA were associated with NRG1 (Fig. 4E, inset, lower panel).

Identification of interaction partners of NRG1 and evidence for multitasking in ribosomal biogenesis

To find other factors involved in the regulation of GPEET, we established a cell line that stably expressed in situ tagged PTP-NRG1 (Schimanski et al., 2005). Affinity purification of PTP-NRG1 from early procyclic forms, followed by SDS-PAGE and MS/MS analysis resulted in the identification of three putative interaction partners: Noc3p (Tb927.10.6320), which is involved in nuclear export of ribosomes, and the RNA-binding proteins PUF7 (Tb11.01.6600) and PUF10 (Tb11.02.4570). In a next step, the immunoprecipitation was repeated with protein lysates from late procyclic forms. MS/MS analysis verified that PUF10 and Noc3p interacted with NRG1. More putative interaction partners were identified in this analysis, mainly proteins involved in ribosome biogenesis or known nucleolar proteins (Table S1 and Fig. S2). Since we were interested in interaction partners that were likely to influence the stability of GPEET mRNA, we decided to further analyse the two RNA-binding proteins PUF7 and PUF10. PUF7 has recently been shown to be a nucleolar protein in T. brucei, and RNAi indicated that it might play a role in rRNA processing (Droll et al., 2010). The prevalence of proteins involved in ribosome biogenesis was sufficiently striking for us to investigate Tb11.02.4620, a WD40 repeat protein that is probably the orthologue of mammalian BOP1/yeast ERB1. The domain structures of PUF7, PUF10 and BOP1 are shown in Fig. 5A. WD40 proteins are scaffolds that can interact with proteins as well as nucleic acids, and in mammalian cells BOP1 forms a complex with PES1 and WDR12 (Hölzel et al., 2005) that is involved in rRNA maturation. The trypanosome orthologue of PES1 also co-purified with NRG1 (Table S1). Tandem affinity purification of in situ tagged PTP-BOP1 from early procyclic forms led to the identification of many interaction partners (Table S2 and Fig. S2). NRG1, PUF7 and PUF10 were detected once again, strengthening the connection between GPEET regulation and rRNA processing. In addition, PES1, WDR12 and several other proteins involved in ribosome biogenesis also co-purified with BOP1.

figure

Figure 5. Interaction partners of NRG1.

A. Three interaction partners of NRG1 were identified by affinity purification. The domains found in PUF7, PUF10 and BOP1 are shown schematically.

B. Immunoprecipitation of in situ PTP-tagged PUF7, PUF10 and BOP1 and detection of co-precipitated endogenous NRG1. EP procyclin is shown as a negative control. Total lysates (L), precipitated fractions (IP) and flow-through fractions (FT) are loaded.

C. Summary of the interactions verified by co-immunoprecipitation (dashed arrows) and tandem-affinity purification (solid arrows). The dotted line indicates a known interaction described in other organisms (Hölzel et al., 2005).

D. Overexpression of GFP-tagged PUF10 and BOP1 shows that both proteins colocalize with NRG1–RFP in the nucleolus. DNA is stained with DAPI.

Download figure to PowerPoint

To localize PUF10 and BOP1, their coding regions were fused to GFP and transfected into the clone that stably expressed NRG1–RFP. Both proteins colocalized with NRG1–RFP (Fig. 5D) and PUF7 (Droll et al., 2010) in the nucleolus. Immunoprecipitation of in situ tagged PTP-PUF7, PTP-PUF10 or PTP-BOP1 all resulted in co-precipitation of endogenous NRG1 (Fig. 5B) confirming the interactions found by affinity purification (Fig. 5C). In all cases this interaction was independent of the presence of RNA (data not shown).

If NRG1, PUF7, PUF10 and BOP1 interact with each other, one would predict that RNAi against the individual components would give the same phenotype. We therefore analysed the effect on GPEET expression during the differentiation of early to late procyclic forms. RNAi against PUF7 or PUF10 resulted in reduced growth and altered expression of GPEET (Fig. 6A and B). RNAi against PUF7 most closely reflected the effect of RNAi against NRG1 and led to a strong increase in GFP and GPEET protein (Fig. 6B) and GPEET mRNA (Fig. S3). The effect was less pronounced with PUF10, but the repression of GPEET was still clearly delayed. Cells depleted of BOP1 grew normally for the first 4 days after RNAi induction, but stopped dividing after that. At day 4, the level of GPEET was considerably higher in the induced culture and remained high on subsequent days. This contrasted with the uninduced cells, which showed decreased GPEET expression from day 4 onwards. Furthermore, flow cytometry analysis revealed an increase in GPEET-positive cells when RNAi was induced (Fig. 6C). Taken together with the interaction studies, these findings suggest that NRG1, PUF7, PUF10 are associated with the BOP1 complex in the nucleolus, and that this complex acts as a negative regulator of GPEET.

figure

Figure 6. The effect of RNAi against PUF7, PUF10 and BOP1 on GPEET and 5.8S rRNA.

A. Growth of uninduced cultures (−tet) or cultures treated to induce RNAi (+tet) during differentiation from early to late procyclic forms. RNAi was induced at day 0 of differentiation.

B. Western blot analysis of GPEET and GFP during differentiation. PolyA-binding protein (PABP) or an unspecific band recognized by the anti-GFP antibody (*) are shown as loading controls. Experiments were performed at least three times, with similar results.

C. Flow cytometric analysis of GPEET expression in the BOP1 RNAi cell line. Cells were transferred to medium without glycerol and cultured in the presence or absence of tetracycline (tet). +tet: dark grey bars; −tet: light grey bars. Means of three experiments ± SD are shown.

Download figure to PowerPoint

Since PUF7 has already been linked to ribosomal RNA processing in trypanosomes (Droll et al., 2010), and BOP1 is responsible for maturation of 5.8S RNA in mammalian cells (Hölzel et al., 2005), we examined the effect of RNAi on the steady-state levels of 5.8S RNA. For these experiments early procyclic forms were cultured for 4 days in the presence or absence of tetracycline (without being triggered to differentiate). In each case knock-down of the target mRNA was confirmed (Fig. 7). Northern blot analysis demonstrated that RNAi against NRG1, PUF7, PUF10 and BOP1 resulted in reduced levels of the mature 5.8S RNA and its immediate precursor (Fig. 7A). Furthermore, as previously described for PUF7 (Droll et al., 2010), there was a slight accumulation of the 9.2 kb primary transcript after depletion of BOP1, NRG1 or PUF7 (2- to 2.5-fold). No accumulation of the 5.8 kb precursor was observed for NRG1, BOP1 or PUF10, and only a modest increase (1.4-fold) for PUF7. This is not unexpected since, in other systems, BOP1 acts both upstream and downstream of this processing intermediate (Strezoska et al., 2000; Pestov et al., 2001a). To obtain better resolution of the 0.6 kb and 5.8S rRNA transcripts, the RNAs were separated on acrylamide gels and quantified by Northern blot analysis (Fig. 7C and Fig. S4). In all cases, RNAi caused significant reductions in these two RNAs. These results confirm that all four proteins are involved in rRNA processing and the regulation of GPEET transcripts.

figure

Figure 7. Effect of downregulation of NRG1, PUF7, BOP1 or PUF10 mRNA on 5.8S rRNA maturation. Total RNA was isolated from cells grown for 4 days in the absence or presence of tetracycline.

A. Northern blot showing 5.8S rRNA and its precursors in treated (+) and untreated cells (−). A schematic depiction of the 5.8S rRNA maturation pathway is shown (Hartshorne and Toyofuku, 1999; Droll et al., 2010). Precursor RNAs were detected with an oligonucleotide (marked by an arrowhead) at the junction between the mature 5.8S rRNA and ITS2 as previously described (Droll et al., 2010). This probe binds more strongly to the precursors than to the mature 5.8S rRNA. Hybridization with an oligonucleotide complementary to the 7S RNA from the signal recognition particle (SRP) was used as the loading control and for normalization.

B. Control blot showing downregulation of targeted transcripts in the samples used above. Ribosomal RNA was stained with ethidium bromide (EtBr).

C. Quantification of 5.8S rRNA and its immediate precursor from three independent experiments. Signals obtained from cultures without tetracycline were set at 100%. White bars: 5.8S RNA; black bars: 0.6 kb precursor. Means of three experiments ± SD are shown. Statistical significance was evaluated by one-tailed Student's T-test with equal variance. *P < 0.05; **P < 0.01. A representative Northern blot from this series of experiments is shown in Fig. S4.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

A genome-wide screen for genes regulating the differentiation of early to late procyclic forms led to the identification of NRG1, a negative regulator of GPEET. Depletion of NRG1 by RNAi not only retarded the repression of GPEET in differentiating cells but also reactivated GPEET expression in cultures that were partially GPEET-negative. At first there was little to link NRG1 directly to regulation of GPEET apart from localization of the protein in the nucleolus, which is the site of procyclin transcription. NRG1 has no obvious motifs for interaction with RNAs, and although its C-terminus is weakly related to that of the DEAD box helicase DDX18, it does not possess a helicase domain. Nevertheless, RNA-immunoprecipitation confirmed that procyclin mRNAs interact (directly or indirectly) with NRG1. The precipitated transcripts could be amplified with a spliced leader primer demonstrating that mature mRNA, or at least partially processed pre-mRNA, is associated with NRG1. The fact that GPEET and, to a lesser extent, EP transcripts could be detected does not preclude that they are regulated independently. Indeed, there is a precedent for this – the cytoplasmic regulator TbZFP3 binds both GPEET and EP1 mRNAs, but has differential effects on translation (Walrad et al., 2009).

Affinity purification of tagged NRG1 from early procyclic forms indicated that it was associated with two proteins with RNA-binding motifs, PUF7 and PUF10, as well as with Noc3p, a protein implicated in nuclear export of ribosomes. We initially dismissed the latter as a contaminant until affinity purification of NRG1 from late procyclic forms identified BOP1 and PES1, which are part of a nucleolar complex that processes rRNA in other organisms. In addition, PUF7 has been shown to play a role in rRNA processing in T. brucei (Droll et al., 2010), suggesting that their functions might be linked. NRG1, the two PUF proteins and BOP1 colocalized in the nucleolus, and physical interactions between NRG1 and the other three proteins were confirmed by immunoprecipitation. Moreover, RNAi provided evidence of functional interactions since depletion of NRG1, BOP1, PUF7 and PUF10 by RNAi gave similar phenotypes. In all cases, repression of GPEET was delayed in cells transferred to medium without glycerol. Since RNAi slowed growth, it could be argued that cells that divide less frequently might take longer to dilute out GPEET. However, there are several observations that speak against its passive retention. First, differentiating cells sometimes stop dividing for several days but still lose GPEET during this time (Vassella et al., 2000 and Fig. S5). Our experiments also showed that rapid growth was not a prerequisite as the BOP1 RNAi line grew very slowly in the absence of tetracycline (more slowly than cells induced to knock down PUF7, for example) but still repressed GPEET. Second, differentiating cells do not gradually lose GPEET, but tend to make a rapid transition from being positive to negative (Vassella et al., 2000 and Fig. S5). Finally, we observed an increase in the amount of GPEET mRNA and protein, as well as an increase in the number of positive cells after RNAi, demonstrating that cells that had repressed GPEET were now expressing it again. Reactivation of GPEET has previously been observed in culture, for example when glucose uptake is inhibited (Morris et al., 2002) or mitochondrial enzymes are knocked down (Vassella et al., 2004), although it has not been reported in tsetse.

In addition to their effect on GPEET, knock-down of NRG1, BOP1, PUF7 and PUF10 all resulted in significantly lower levels of 5.8S rRNA and its 0.6 kb precursor. Although rRNA processing in trypanosomes differs from that in higher eukaryotes – with the large subunit RNA being cleaved into six pieces (White et al., 1986) – the basic steps appear to be conserved. A role for BOP1 in the maturation of 5.8S rRNA was therefore not surprising, given its function in other organisms, where it acts at multiple sites in the 5.8S rRNA processing pathway. Perturbation of BOP1 invariably reduces the level of mature 5.8S rRNA, but can result in accumulation, no change or reduction of intermediates, depending on the organism and on how expression is manipulated (Strezoska et al., 2000; Pestov et al., 2001a). Depletion of T. brucei PUF7 was previously shown to affect the 9.2 kb rRNA precursor (Droll et al., 2010) and the PUF proteins Nop9p and APUM23 are involved in rRNA processing in yeast (Thomson et al., 2007) and Arabidopsis respectively (Abbasi et al., 2010). The requirement for NRG1 in rRNA maturation – and not exclusively for the regulation of GPEET – could explain the existence of orthologues in T. cruzi and Leishmania spp. The antiserum we generated did not detect NRG1 in bloodstream forms of T. brucei AnTat 1.1 but we do not exclude that this might be a problem of sensitivity and that the protein is expressed at low levels (< 10% of the level in procyclic forms). It is worth noting that NRG1 was detected in bloodstream forms of the Lister 427 strain at levels fourfold lower than in procyclic forms (Urbaniak et al., 2012). Although we do not know if NRG1 is involved in rRNA processing in bloodstream forms, an essential function for it in both life-cycle stages seems likely, since we were unable to generate null mutants in either bloodstream or procyclic forms.

Taken together, our results indicate that trypanosomes have recruited components of a complex responsible for a universal function, rRNA processing, to perform an additional specialized function for a protein-coding RNA from the same compartment. Whether a single complex is responsible for both functions remains to be established. There are several examples in the literature of multipurpose proteins that are involved in functions in addition to ribosome biogenesis, particularly in yeast. These include the DEAH box ATPase Prp43p, a recycling factor that participates in splicing and rRNA processing (Leeds et al., 2006), eIF3/Hcr1p, which is involved in rRNA processing and translation initiation (Valasek et al., 2001), and Rrp14p which has roles in positioning of the mitotic spindle and cell polarity in addition to rRNA processing (Oeffinger et al., 2007; Yamada et al., 2007). Finally, the mammalian orthologue of BOP1 itself has been implicated in p53-dependent cross-talk during the cell cycle, in addition to its role in ribosome biogenesis (Pestov et al., 2001b).

If NRG1 and members of the BOP1 complex are required for rRNA processing in both early and late procyclic forms, what factors determine the stage-specific degradation of GPEET? One possibility is that degradation is prevented in early procyclic forms by a protective factor that masks the GRE. Such a factor would not have been detected in the RNAi screen as this can only identify genes that exert their phenotypes through loss of function. Another possibility is that regulation of GPEET requires additional proteins only present in late procyclic forms, or stage-specific post-translational modifications of existing components. Intriguingly, NRG1 eclipses and then reappears during the differentiation of early to late procyclic forms, making it tempting to speculate that different isoforms are expressed in these two stages, and that these determine whether or not the GPEET transcript is degraded. Since the stability of GPEET mRNA is affected by glycerol, glucose and oxygen, an additional possibility is that metabolites influence the specificity of cleavage. At present, the identity of the nuclease responsible for degrading GPEET is unknown. One possibility, however, is that the BOP1 complex itself performs the cleavage, since it is required for RNA processing in other organisms (Strezoska et al., 2000; Pestov et al., 2001a).

In theory, turning off GPEET during or shortly after transcription should be enough to ensure its repression. However, given the rapid transition from GPEET-positive to GPEET-negative cells, indicating an active mechanism of protein degradation or shedding, we consider it highly likely that there are additional levels of control.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Trypanosome stocks and culture conditions

The pleomorphic, fly-transmissible strain Trypanosoma brucei brucei AnTat 1.1 (Le Ray et al., 1977) and clones derived from it were used in this study. RNAi experiments were performed with procyclic forms of AnTat 90-13-GFP, a derivative of AnTat 1.1 90-13 (Engstler and Boshart, 2004) in which the coding region of one copy of GPEET is replaced by enhanced GFP (see below).

Bloodstream forms of AnTat1.1 and AnTat 90-13-GFP were obtained from mouse blood after transmission through tsetse as described (Vassella et al., 2009). Bloodstream forms were cultivated in HMI-9 (Carruthers et al., 1993) supplemented with 10% horse serum at 37°C and 5% CO2. Differentiation into early procyclic forms was triggered in DTM (Vassella and Boshart, 1996) supplemented with 15% fetal bovine serum (FBS) and 6 mM cis-aconitate at 27°C. Early procyclic forms were cultivated at 27°C either in DTM with 15% FBS or in SDM-79 (Brun and Schonenberger, 1979) supplemented with 10% FBS and 20 mM glycerol. Cultivation in SDM-79 + 10% FBS without glycerol mediates differentiation to late procyclic forms.

Construction of an RNAi library in AnTat 90-13-GFP

AnTat 90-13-GFP was generated by transformation with pCorleone-GFP/GPEET-blast, which is based on pCorleone-GARP/GPEET-ble (Vassella et al., 2000). First, the phleomycin-resistance gene was released by cleavage with NheI and ClaI and replaced by a blasticidin-resistance gene (Vassella et al., 2009). In a second step, the GARP coding region was excised by cleavage with HindIII and BamHI and the ends were treated with Klenow fragment. GARP was replaced by the coding region from pEGFP-N1 (Clontech laboratories), which was obtained by cleavage with BamHI and NotI and treatment with Klenow. The construct was linearized with NotI for stable transformation into early procyclic-form AnTat 1.1 90-13.

To generate an RNAi library, 6 μg of genomic DNA of T. brucei ILTat 1.25 (Carrington et al., 1991) were digested with BfaI and TruI (partial, complete and combined digests). DNA fragments with sizes ranging from 500 to 2000 bp were isolated from an agarose gel and ligated into the NdeI site of the RNAi vector pZJMβ (Morris et al., 2002). Transformed bacteria (5 × 105 colonies) were recovered from agar plates and plasmid DNA was extracted. The plasmid library showed diverse insert sizes in the expected range. The library was used to stably transform early procyclic forms of AnTat 90-13-GFP (in SDM-79 + 10% FBS + 20 mM glycerol) in 30 electroporations following an optimized protocol for AnTat 1.1 (Burkard et al., 2007). After 24 h, the pool cultures from all the electroporations were combined, supplemented with 1 μg ml−1 phleomycin and then distributed into six-well plates (8 ml per well). As soon as resistant cells grew up, they were collected, pooled again and after one dilution step in fresh medium with 1 μg ml−1 phleomycin aliquots of 2 × 107 cells were stored in liquid nitrogen. The resulting library had a complexity equivalent to approximately fivefold coverage of the genome.

Library screening and fluorescence-activated cell sorting (FACS)

To maintain cells as early procyclic forms, the RNAi library (AnTat 90-13-GFP-RNAi) was cultured in SDM-79 + 20 mM glycerol + 10% FBS. To screen for cells with altered GPEET expression phenotype, RNAi was induced and concurrently, differentiation into late procyclic forms was triggered by a change to glycerol-free medium. After 12 days in this medium (SDM-79 + 10% FBS + 1 μg ml−1 tetracycline), the cultures were diluted to 5 × 106 cells ml−1 and subjected to cell sorting (BD FACS Aria). A total of 2.5 × 105 GFP-positive cells were isolated, washed twice in 14 ml of ice-cold medium, resuspended in 750 μl of medium (SDM-79 + 10% FBS + 1 μg ml−1 tetracycline) and transferred into a 24-well plate (1.9 × 105 cells ml−1). Since AnTat 1.1 procyclic forms have difficulties growing at low densities, and cell-sorting is an additional stress, a cell culture insert (Becton Dickinson, 0.4 μm pore size insert for 24-well plates) containing 2 × 106 feeder cells (from the same culture before sorting) in 250 μl was added to each well. The sorted cells were in stationary phase for 11 days before they recovered and started to grow again (Fig. S1). At a cell density of 5.6 × 106 cells ml−1 the insert with the feeder cells was removed and the cells were transferred into a culture flask for further expansion in fresh medium with tetracycline. After 10 days of slow growth (doubling time of 39 h), the culture was submitted to a second round of cell sorting. Less than 1% of the culture was still GFP-positive at this time point and 6.6 × 104 green fluorescent cells were isolated during 1h of sorting. The cells were collected as described above and put into 250 μl of medium in a 24-well plate (with insert and feeder cells) with a final concentration of 1.7 × 105 GFP-positive cells ml−1. After 9 days in culture, the cells were grown to 2.6 × 105 cells ml−1 and genomic DNA was isolated for analysis.

RNAi inserts were amplified from genomic DNA by nested PCR using the following primer pairs: pZJMfor1 (ggaacggcactggtcaac)/pZJMrev1 (ctccaaagcaaacatgcaga) and pZJMfor2 (ctcgagggccagtgaggc)/pZJMrev2 (gatctagcccctgcaggaat). The final PCR product was cloned into pCR2.1-TOPO (Invitrogen) and sequenced. To verify the phenotype, RNAi inserts were back-cloned into pZJMβ and stably transformed into AnTat 90-13-GFP.

Constructs for fusion proteins

For the HA-NRG1 construct the pLEW100 expression vector (Wirtz et al., 1999) was digested with HindIII and BamHI. Two oligonucleotides encoding an HA tag and containing flanking AgeI and HindIII sites (agctatgtacccttacgacgtacctgactacgctaagcttgcgaccggtgccg/gatccggcaccggtcgcaagcttagcgtagtcaggtacgtcgtaagggtacat) were annealed and ligated into the vector, keeping the BamHI site intact and destroying the original HindIII site. The open reading frame of NRG1 was amplified with the primers accggtatgtcctccctgacatccgtc and tggatccgaaacatgtcctccctg, digested with AgeI and BamHI and cloned between the corresponding sites, in frame after the HA tag. The construct was linearized with NotI and used to stably transform AnTat 90-13.

The N-terminally tagged fusion proteins GFP–NRG1, GFP–PUF7 and GFP–PUF10 were constructed by PCR amplification of the open reading frames and ligation into the vector pG–EGFP–ΔLIIγ (Burkard et al., 2007). The following primers with the underlined restriction sites were used for cloning:

  • GFP–NRG1-for tggatccgaaacatgtcctccctg
  • GFP–NRG1-rev tggatccattcacgtgctcgctac
  • GFP–PUF7-for tacccgggatgccaaaaatgcgtttagac
  • GFP–PUF7-rev tatgatcattcggccgttttgaaagg
  • GFP–PUF10-for tacccgggatgggcaagaagggaacgctac
  • GFP–PUF10-rev attgatcatgtggattcacttatctgc

The C-terminally tagged fusion proteins NRG1–RFP and BOP1–GFP were cloned into pG–RFP–ΔLIIβ or pG–EGFP–ΔLIIβ respectively (Burkard et al., 2007). For PCR amplification of the open reading frames the following primers were used:

  • NRG1–RFP-for ttctcgagttggaggaaacatgtcc
  • NRG1–RFP-rev tgtcgacactggttttcctccctc
  • BOP1–GFP-for ctcgagatggtcaagaagcgtgagc
  • BOP1–GFP-rev accggttcttccgtccatgctgatacaac

The PTP-PUF7 was generated by amplification with the primer pair tacggccgcaccaaaaatgcgtttagac/tagggccctcatttcccaccaaggc, cloning into pN-PURO-PTP (Schimanski et al., 2005) and linearization with EcoRI. PTP-PUF10 was amplified with the primer pair tacggccgcaggcaagaagggaacgctac/tagggcccaacgcgttcaacag, cloned into pN-PURO-PTP and linearized with SphI. PTP-BOP1 was amplified with the primer pair tagcggccgctgtcaagaagcgtgagcccac/tagggcccggcgcttcgagccag, cloned into pN-PURO-PTP and linearized with FspAI. The C-terminally tagged NRG1-PTP was amplified with the primers atagggccccagtgtgcac/atcggccgctggttttcctccctctg and cloned into pC-PTP-NEO (Schimanski et al., 2005) followed by linearization with BmgBI.

RNAi constructs

RNAi constructs were made in the stem-loop vector pSLcomp1 (Mani et al., 2011). The RNAi insert for downregulation of NRG1 was derived from the PCR-amplified insert from the library screen. This was first cloned in pCR2.1-TOPO (Invitrogen), then excised with BamHI and XhoI. The inserts for RNAi against PUF7, PUF10 and BOP1 were obtained by amplification from genomic DNA with the following primer pairs:

  • PUF7:tacggccgcaccaaaaatgcgtttagac/tgcccaaactcgtgaagcgcaa PUF10:tacggccgcaggcaagaagggaacgctac/tagggcccaacgcgttcaacag BOP1:taggatccctccaagttactgc/tactcgaggtaaagcgcttcacc

PCR products were cloned into pCR2.1-TOPO and verified by sequencing. The NotI site in the vector backbone was destroyed by cleavage with NotI, Klenow treatment and religation. All inserts were released by digestion with BamHI and XhoI and introduced twice (in opposite orientations) into pSLcomp1.

RNA immunoprecipitation (RIP) and RT-PCR

Parasites were washed with PBS and incubated with 0.1% paraformaldehyde (w/v) in PBS for 8 min at room temperature in order to cross-link proteins and RNA. The reaction was stopped by adding glycine to a final concentration of 125 mM and incubating for 5 min. Cells were washed in PBS and resuspended in RNP lysis buffer (20 mM Tris pH 7.5, 140 mM KCl, 1.8 mM MgCl2, 0.1% NP40, 10% glycerol, 1 mM DTT) containing protease inhibitor cocktail EDTA free (Roche) and 2 mM vanadyl ribonucleoside complex. Cells were lysed by sonication using a Branson Digital Sonifier three times 10 s, 30 s interval on ice at 10% power. Soluble supernatant was used for immunoprecipitation using anti-HA-affinity matrix (Roche). For isolation of RNA bound to NRG1, the RNA–protein complex was resuspended in 20 mM Tris-HCl, pH 7.5, 5 mM EDTA, 50 mM NaCl containing 0.1% SDS and 50 μg ml−1 proteinase K and incubated at 70°C for 40 min. RNA was purified by phenol-chloroform extraction and ethanol precipitation. Purified RNA was subjected to DNase treatment and used for cDNA synthesis.

Reverse transcription was performed using the Omniscript RT kit (Qiagen) according to the manufacturer's instructions with random hexamers as primers. qPCR with the primers aatagatatcggatccggatgcaagcgtgtaaagcg/gaccgtggatccaaattcaaag was performed using MESA GREEN qPCR MasterMix Plus for SYBR® Assay (Eurogentec) in the ABI Prism 7000 Sequence Detection System (Applied Biosystems). Specificity of the reactions was confirmed by agarose gel electrophoresis and melting temperature analysis. Reactions without reverse transcriptase were performed to obtain background values. The data were analysed using 7000 System SDS software v1.2 (Applied Biosystems). EP and GPEET were distinguished by PCR amplification (35 cycles) with a sense primer corresponding to the spliced leader (cgctattattagaacagtttctgtac) and antisense primer (gaccgtggatccaaattcaaag) complementary to a conserved sequence at the end of all procyclin coding regions.

Antibodies, immunofluorescence and immunoblot analysis

To generate polyclonal antibodies against NRG1, a fragment encoding the N-terminal 397 amino acids was released from the GFP–NRG1 fusion construct by cleavage with BamHI and BglII and cloned into the BamHI site of the expression vector pMBP-parallel3 (Sheffield et al., 1999). The MBP fusion protein was expressed in E. coli BL21 (Stratagene), purified over an amylose column and used for immunization of a rabbit. The polyclonal antiserum was affinity-purified for increased specificity. Immunofluorescence analysis: cells were washed in cold PBS and fixed for 20 min at room temperature in PBS containing 4% formaldehyde. The cells were permeabilized for 5 min with PBS + 0.2% Triton X-100 followed by incubation with PBS + 2% BSA to block unspecific binding sites. The following primary antibodies were used: rabbit anti-GPEET K1 1:1000 (Ruepp et al., 1997), mouse anti-GPEET 5H3 1:500, (Bütikofer et al., 1999), monoclonal mouse anti-nucleolar antigen L1C6 (1:50; kindly provided by K. Gull, Oxford University) and rabbit anti-NRG1 (1:100; overnight at 4°C). CyTM3-conjugated goat anti-rabbit IgG (1:1000; Jackson Immuno Research), and Alexa fluor 488 goat anti-mouse IgG (1:3000; Invitrogen) were used as secondary antibodies.

Immunoblotting: proteins were separated by SDS-PAGE and transferred to Immobilon-P (Millipore, USA). Membranes were incubated overnight at 4°C with primary antibodies: rabbit anti-NRG1 (1:400), mouse anti-EP TRBP1/247 hybridoma supernatant 1:50 (Richardson et al., 1988), mouse anti-Hsp60 1:40 000 (Chanez et al., 2006), rabbit anti-GPEET K1 1:1000 (Ruepp et al., 1997), rat anti-HA 3F10 1:1000 (Roche), mouse anti-EF1α 1:25 000 (Santa Cruz Biotechnology) and HRP-coupled mouse anti-protein C (clone HPC4 from Roche, 1:2000 in the presence of 1 mM CaCl2). As secondary antibodies swine anti-rabbit IgG/HRP, rabbit anti-rat IgG/HRP or rabbit anti-mouse IgG/HRP were used (1:3000, all from Dako Denmark). The blots were incubated with Enhanced Chemiluminescent Substrate (Pierce, USA) and signals were detected on X-ray film.

RNA isolation and Northern blotting

Total RNA was extracted using hot phenol (Roditi et al., 1989) or guanidine thiocyanate (Chomczynski and Sacchi, 1987). Northern blot analysis of 10 μg total RNA per lane was performed as described (Roditi et al., 1989). Hybridization probes corresponding to the open reading frames of NRG1, PUF7, PUF10, BOP1 and α-tubulin, and to an internal region of GPEET encoding the pentapeptide repeats were labelled with 32P using the Megaprime system (Amersham Biosciences, UK). 32P-labelled oligonucleotides were used to detect 18S rRNA (Flück et al., 2003), the mature and precursor forms of 5.8S rRNA (CZ1427) and the 7S RNA moiety from the signal recognition particle (CZ1478, Estevez et al., 2001).

Co-immunoprecipitation and tandem affinity purification (TAP)

PTP-tagged BOP1 was purified essentially as described (Schimanski et al., 2005), but with a modification in the preparation of cell extracts. Cells were washed three times in washing buffer (100 mM NaCl, 3 mM MgCl2 and 20 mM Tris-HCl pH 7.7) and once in E buffer (150 mM sucrose, 20 mM l-glutamic acid, 20 mM Tris-HCl pH 7.7, 3 mM MgCl2, 0.5 mM DTT and protease inhibitor, EDTA free). After washing, the cells were resuspended in 1.5 volumes of the packed cell volume in ice-cold lysis buffer (E buffer containing 0.1% NP-40) and put on ice for 15 min. Aliquots of 1 ml were broken by shock freezing in liquid nitrogen. After thawing, lysed cells were added to 100 μl of pre-cooled extraction buffer (1.5 M KCl, 20 mM Tris-HCl pH 7.7, 3 mM MgCl2, 0.5 mM DTT, 1% Tween20) and mixed immediately. After 20 min of incubation on ice, the extracts were centrifuged for 15 min at 4°C and 13 000 g and the supernatants were collected in new tubes. Input, TEV eluate and final eluate samples were separated on 10% SDS-PAGE gels and stained by the blue silver Coomassie method (Candiano et al., 2004). Protein bands were cut from gels, subjected to trypsin digestion and analysed by LC-MS/MS (Wetterwald et al., 2010). Pull-down experiments using PTP-tagged NRG1, PUF7, PUF10 and BOP1 were performed using the first purification step of the TAP protocol. Proteins associated with PTP-tagged NRG1 were analysed by MS/MS; interactions between endogenous NRG1 and PTP-tagged partners were analysed by Western blot.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Keith Gull, André Schneider and Osvaldo de Melo Neto for antibodies and Marina Cristodero for constructive comments on the manuscript. This research was supported by grants from the Swiss National Science Foundation and Howard Hughes Medical Institute to I.R. and a scholarship from CNPq to P.R.d.A. Santuza Teixeira is thanked for allowing P.R.d.A. to spend a year of her PhD in Bern.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Abbasi, N., Kim, H.B., Park, N.I., Kim, H.S., Kim, Y.K., Park, Y.I., and Choi, S.B. (2010) APUM23, a nucleolar Puf domain protein, is involved in pre-ribosomal RNA processing and normal growth patterning in Arabidopsis. Plant J 64: 960976.
  • Brun, R., and Schonenberger (1979) Cultivation and in vitro cloning or procyclic culture forms of Trypanosoma brucei in a semi-defined medium. Short communication. Acta Trop 36: 289292.
  • Burkard, G., Fragoso, C.M., and Roditi, I. (2007) Highly efficient stable transformation of bloodstream forms of Trypanosoma brucei. Mol Biochem Parasitol 153: 220223.
  • Bütikofer, P., Vassella, E., Ruepp, S., Boschung, M., Civenni, G., Seebeck, T., et al. (1999) Phosphorylation of a major GPI-anchored surface protein of Trypanosoma brucei during transport to the plasma membrane. J Cell Sci 112 (Part 11): 17851795.
  • Candiano, G., Bruschi, M., Musante, L., Santucci, L., Ghiggeri, G.M., Carnemolla, B., et al. (2004) Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis 25: 13271333.
  • Carrington, M., Miller, N., Blum, M., Roditi, I., Wiley, D., and Turner, M. (1991) Variant specific glycoprotein of Trypanosoma brucei consists of two domains each having an independently conserved pattern of cysteine residues. J Mol Biol 221: 823835.
  • Carruthers, V.B., van der Ploeg, L.H., and Cross, G.A. (1993) DNA-mediated transformation of bloodstream-form Trypanosoma brucei. Nucleic Acids Res 21: 25372538.
  • Chanez, A.L., Hehl, A.B., Engstler, M., and Schneider, A. (2006) Ablation of the single dynamin of T. brucei blocks mitochondrial fission and endocytosis and leads to a precise cytokinesis arrest. J Cell Sci 119: 29682974.
  • Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159.
  • Droll, D., Archer, S., Fenn, K., Delhi, P., Matthews, K., and Clayton, C. (2010) The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation. FEBS Lett 584: 11561162.
  • Engstler, M., and Boshart, M. (2004) Cold shock and regulation of surface protein trafficking convey sensitization to inducers of stage differentiation in Trypanosoma brucei. Genes Dev 18: 27982811.
  • Estevez, A.M., Kempf, T., and Clayton, C. (2001) The exosome of Trypanosoma brucei. EMBO J 20: 38313839.
  • Flück, C., Salomone, J.Y., Kurath, U., and Roditi, I. (2003) Cycloheximide-mediated accumulation of transcripts from a procyclin expression site depends on the intergenic region. Mol Biochem Parasitol 127: 9397.
  • Furger, A., Schürch, N., Kurath, U., and Roditi, I. (1997) Elements in the 3′ untranslated region of procyclin mRNA regulate expression in insect forms of Trypanosoma brucei by modulating RNA stability and translation. Mol Cell Biol 17: 43724380.
  • Günzl, A., Bruderer, T., Laufer, G., Schimanski, B., Tu, L.C., Chung, H.M., et al. (2003) RNA polymerase I transcribes procyclin genes and variant surface glycoprotein gene expression sites in Trypanosoma brucei. Eukaryot Cell 2: 542551.
  • Haenni, S., Kunz Renggli, C., Fragoso, C.M., Oberle, M., and Roditi, I. (2006) The procyclin-associated genes of Trypanosoma brucei are not essential for cyclical transmission by tsetse. Mol Biochem Parasitol 150: 144156.
  • Hartshorne, T., and Toyofuku, W. (1999) Two 5′-ETS regions implicated in interactions with U3 snoRNA are required for small subunit rRNA maturation in Trypanosoma brucei. Nucleic Acids Res 27: 33003309.
  • Hehl, A., Vassella, E., Braun, R., and Roditi, I. (1994) A conserved stem-loop structure in the 3′ untranslated region of procyclin mRNAs regulates expression in Trypanosoma brucei. Proc Natl Acad Sci USA 91: 370374.
  • Hölzel, M., Rohrmoser, M., Schlee, M., Grimm, T., Harasim, T., Malamoussi, A., et al. (2005) Mammalian WDR12 is a novel member of the Pes1–Bop1 complex and is required for ribosome biogenesis and cell proliferation. J Cell Biol 170: 367378.
  • Le Ray, D., Barry, J.D., Easton, C., and Vickerman, K. (1977) First tsetse fly transmission of the ‘AnTat’ serodeme of Trypanosoma brucei. Ann Soc Belg Med Trop 57: 369381.
  • Leeds, N.B., Small, E.C., Hiley, S.L., Hughes, T.R., and Staley, J.P. (2006) The splicing factor Prp43p, a DEAH box ATPase, functions in ribosome biogenesis. Mol Cell Biol 26: 513522.
  • Mani, J., Güttinger, A., Schimanski, B., Heller, M., Acosta-Serrano, A., Pescher, P., et al. (2011) Alba-domain proteins of Trypanosoma brucei are cytoplasmic RNA-binding proteins that interact with the translation machinery. PLoS ONE 6: e22463.
  • Morris, J.C., Wang, Z., Drew, M.E., and Englund, P.T. (2002) Glycolysis modulates trypanosome glycoprotein expression as revealed by an RNAi library. EMBO J 21: 44294438.
  • Oeffinger, M., Fatica, A., Rout, M., and Tollervey, D. (2007) Yeast Rrp14p is required for ribosomal subunit synthesis and for correct positioning of the mitotic spindle during mitosis. Nucleic Acids Res 35: 13541366.
  • Pays, E., Coquelet, H., Tebabi, P., Pays, A., Jefferies, D., Steinert, M., et al. (1990) Trypanosoma brucei: constitutive activity of the VSG and procyclin gene promoters. EMBO J 9: 31453151.
  • Pestov, D.G., Stockelman, M.G., Strezoska, Z., and Lau, L.F. (2001a) ERB1, the yeast homolog of mammalian Bop1, is an essential gene required for maturation of the 25S and 5.8S ribosomal RNAs. Nucleic Acids Res 29: 36213630.
  • Pestov, D.G., Strezoska, Z., and Lau, L.F. (2001b) Evidence of p53-dependent cross-talk between ribosome biogenesis and the cell cycle: effects of nucleolar protein Bop1 on G(1)/S transition. Mol Cell Biol 21: 42464255.
  • Richardson, J.P., Beecroft, R.P., Tolson, D.L., Liu, M.K., and Pearson, T.W. (1988) Procyclin: an unusual immunodominant glycoprotein surface antigen from the procyclic stage of African trypanosomes. Mol Biochem Parasitol 31: 203216.
  • Roditi, I., and Clayton, C. (1999) An unambiguous nomenclature for the major surface glycoproteins of the procyclic form of Trypanosoma brucei. Mol Biochem Parasitol 103: 99100.
  • Roditi, I., Schwarz, H., Pearson, T.W., Beecroft, R.P., Liu, M.K., Richardson, J.P., et al. (1989) Procyclin gene expression and loss of the variant surface glycoprotein during differentiation of Trypanosoma brucei. J Cell Biol 108: 737746.
  • Rudenko, G. (2010) Epigenetics and transcriptional control in African trypanosomes. Essays Biochem 48: 201219.
  • Rudenko, G., Le Blancq, S., Smith, J., Lee, M.G., Rattray, A., and Van der Ploeg, L.H. (1990) Procyclic acidic repetitive protein (PARP) genes located in an unusually small alpha-amanitin-resistant transcription unit: PARP promoter activity assayed by transient DNA transfection of Trypanosoma brucei. Mol Cell Biol 10: 34923504.
  • Ruepp, S., Furger, A., Kurath, U., Kunz Renggli, C., Hemphill, A., Brun, R., and Roditi, I. (1997) Survival of Trypanosoma brucei in the tsetse fly is enhanced by the expression of specific forms of procyclin. J Cell Biol 137: 13691379.
  • Schimanski, B., Nguyen, T.N., and Gunzl, A. (2005) Highly efficient tandem affinity purification of trypanosome protein complexes based on a novel epitope combination. Eukaryot Cell 4: 19421950.
  • Schwede, A., Kramer, S., and Carrington, M. (2012) How do trypanosomes change gene expression in response to the environment? Protoplasma 249: 223238.
  • Sheffield, P., Garrard, S., and Derewenda, Z. (1999) Overcoming expression and purification problems of RhoGDI using a family of ‘parallel’ expression vectors. Protein Expr Purif 15: 3439.
  • Sherman, D.R., Janz, L., Hug, M., and Clayton, C. (1991) Anatomy of the parp gene promoter of Trypanosoma brucei. EMBO J 10: 33793386.
  • Strezoska, Z., Pestov, D.G., and Lau, L.F. (2000) Bop1 is a mouse WD40 repeat nucleolar protein involved in 28S and 5. 8S RRNA processing and 60S ribosome biogenesis. Mol Cell Biol 20: 55165528.
  • Thomson, E., Rappsilber, J., and Tollervey, D. (2007) Nop9 is an RNA binding protein present in pre-40S ribosomes and required for 18S rRNA synthesis in yeast. RNA 13: 21652174.
  • Urbaniak, M.D., Guther, M.L., and Ferguson, M.A. (2012) Comparative SILAC proteomic analysis of Trypanosoma brucei bloodstream and procyclic lifecycle stages. PLoS ONE 7: e36619.
  • Urwyler, S., Vassella, E., Van Den Abbeele, J., Kunz Renggli, C., Blundell, P., Barry, J.D., and Roditi, I. (2005) Expression of procyclin mRNAs during cyclical transmission of Trypanosoma brucei. PLoS Pathog 1: e22.
  • Valasek, L., Hasek, J., Nielsen, K.H., and Hinnebusch, A.G. (2001) Dual function of eIF3j/Hcr1p in processing 20 S pre-rRNA and translation initiation. J Biol Chem 276: 4335143360.
  • Vassella, E., and Boshart, M. (1996) High molecular mass agarose matrix supports growth of bloodstream forms of pleomorphic Trypanosoma brucei strains in axenic culture. Mol Biochem Parasitol 82: 91105.
  • Vassella, E., Den Abbeele, J.V., Butikofer, P., Kunz Renggli, C., Furger, A., Brun, R., and Roditi, I. (2000) A major surface glycoprotein of Trypanosoma brucei is expressed transiently during development and can be regulated post-transcriptionally by glycerol or hypoxia. Genes Dev 14: 615626.
  • Vassella, E., Probst, M., Schneider, A., Studer, E., Kunz Renggli, C., and Roditi, I. (2004) Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes. Mol Biol Cell 15: 39863993.
  • Vassella, E., Oberle, M., Urwyler, S., Kunz Renggli, C., Studer, E., Hemphill, A., et al. (2009) Major surface glycoproteins of insect forms of Trypanosoma brucei are not essential for cyclical transmission by tsetse. PLoS ONE 4: e4493.
  • Walrad, P., Paterou, A., Acosta-Serrano, A., and Matthews, K.R. (2009) Differential trypanosome surface coat regulation by a CCCH protein that co-associates with procyclin mRNA cis-elements. PLoS Pathog 5: e1000317.
  • Wang, Z., Morris, J.C., Drew, M.E., and Englund, P.T. (2000) Inhibition of Trypanosoma brucei gene expression by RNA interference using an integratable vector with opposing T7 promoters. J Biol Chem 275: 4017440179.
  • Wetterwald, C., Roth, T., Kaeslin, M., Annaheim, M., Wespi, G., Heller, M., et al. (2010) Identification of bracovirus particle proteins and analysis of their transcript levels at the stage of virion formation. J Gen Virol 91: 26102619.
  • White, T.C., Rudenko, G., and Borst, P. (1986) Three small RNAs within the 10 kb trypanosome rRNA transcription unit are analogous to domain VII of other eukaryotic 28S rRNAs. Nucleic Acids Res 14: 94719489.
  • Wirtz, E., Leal, S., Ochatt, C., and Cross, G.A. (1999) A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei. Mol Biochem Parasitol 99: 89101.
  • Yamada, H., Horigome, C., Okada, T., Shirai, C., and Mizuta, K. (2007) Yeast Rrp14p is a nucleolar protein involved in both ribosome biogenesis and cell polarity. RNA 13: 19771987.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
mmi12227-sup-0001-si.pdf2606K

Supporting Information

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.