mCSF1, a nucleus-encoded CRM protein required for the processing of many mitochondrial introns, is involved in the biogenesis of respiratory complexes I and IV in Arabidopsis


  • Michal Zmudjak,

    1. Institute of Plant Sciences, Agricultural Research Organization (ARO), Volcani Center, Bet Dagan, Israel
    2. Department of Plant Sciences, The Hebrew University of Jerusalem, Rehovot, Israel
    Search for more papers by this author
  • Catherine Colas des Francs-Small,

    1. Australian Research Council (ARC) Centre of Excellence in Plant Energy Biology, University of Western Australia, Crawley, WA, Australia
    Search for more papers by this author
  • Ido Keren,

    1. Center for Plant Science Innovation, University of Nebraska, Lincoln, USA
    Search for more papers by this author
  • Felix Shaya,

    1. Institute of Plant Sciences, Agricultural Research Organization (ARO), Volcani Center, Bet Dagan, Israel
    Search for more papers by this author
  • Eduard Belausov,

    1. Institute of Plant Sciences, Agricultural Research Organization (ARO), Volcani Center, Bet Dagan, Israel
    Search for more papers by this author
  • Ian Small,

    1. Australian Research Council (ARC) Centre of Excellence in Plant Energy Biology, University of Western Australia, Crawley, WA, Australia
    Search for more papers by this author
  • Oren Ostersetzer-Biran

    Corresponding authorCurrent affiliation:
    1. Department of Plant and Environmental Sciences, Alexander Silberman Institute of Life Sciences, Givat Ram, Hebrew University of Jerusalem, Jerusalem, Israel
    • Institute of Plant Sciences, Agricultural Research Organization (ARO), Volcani Center, Bet Dagan, Israel
    Search for more papers by this author

Author for correspondence:

Oren Ostersetzer-Biran

Tel: +972 3 968 3397



  • The coding regions of many mitochondrial genes in plants are interrupted by intervening sequences that are classified as group II introns. Their splicing is essential for the expression of the genes they interrupt and hence for respiratory function, and is facilitated by various protein cofactors. Despite the importance of these cofactors, only a few of them have been characterized.
  • CRS1-YhbY domain (CRM) is a recently recognized RNA-binding domain that is present in several characterized splicing factors in plant chloroplasts. The Arabidopsis genome encodes 16 CRM proteins, but these are largely uncharacterized.
  • Here, we analyzed the intracellular location of one of these hypothetical proteins in Arabidopsis, mitochondrial CAF-like splicing factor 1 (mCSF1; At4 g31010), and analyzed the growth phenotypes and organellar activities associated with mcsf1 mutants in plants.
  • Our data indicated that mCSF1 resides within mitochondria and its functions are essential during embryogenesis. Mutant plants with reduced mCSF1 displayed inhibited germination and retarded growth phenotypes that were tightly associated with reduced complex I and IV activities. Analogously to the functions of plastid-localized CRM proteins, analysis of the RNA profiles in wildtype and mcsf1 plants showed that mCSF1 acts in the splicing of many of the group II intron RNAs in Arabidopsis mitochondria.


Mitochondrial genomes (mtDNAs) in angiosperms consist largely of noncoding sequences, within which c. 60 known functional genes are embedded (Unseld et al., 1997; Kubo et al., 2000; Adams et al., 2002; Notsu et al., 2002; Handa, 2003; Clifton et al., 2004; Ogihara et al., 2005; Sugiyama et al., 2005). These encode tRNAs, rRNAs, ribosomal proteins, subunits of the respiratory machinery (NADH:ubiquinone oxidoreductase (complex I), cytochrome bc1 complex (complex III), cytochrome c oxidase (complex IV), and ATP-synthase (complex V)), a twin-arginine translocation pathway component (TatC) and enzymes involved in cytochrome c biogenesis (Knoop, 2012). Yet the vast majority of mitochondrial proteins are encoded by nuclear genes, translated on cytosolic ribosomes, imported into the organelle and, in the case of the ribosomes and respiratory chain complexes, subsequently assembled together with organelle-encoded subunits. These processes require complex mechanisms to coordinate the expression and accumulation of proteins that are derived from two physically separate genetic systems (Barkan, 2011). Much of this control is thought to be at the post-transcriptional level, via nucleus-encoded RNA-binding cofactors, which are targeted to the mitochondria and function in the processing of the organellar transcripts.

The expression of mitochondrial genes in angiosperms is catalyzed by single subunit phage-type RNA polymerases, possibly in conjunction with accessory factors that aid promoter recognition (Kühn et al., 2009). The primary transcripts undergo extensive RNA processing steps, which include the splicing of numerous group II introns found within many essential genes (Unseld et al., 1997; Gagliardi & Binder, 2007; Bonen, 2008). The removal of these introns from the coding sequences they interrupt is essential for organellar function and is mediated by various protein cofactors.

Group II introns are large catalytic RNAs found in bacteria and in the organelles of fungi and certain protists, but they are particularly numerous within plant mitochondria (Gagliardi & Binder, 2007; Bonen, 2008). The organellar introns in plants are degenerate, lacking many intronic regions that were once considered to be essential for the splicing activity (Bonen, 2008). Several of these introns in angiosperms became fragmented, such that they are transcribed in pieces and are then spliced in ‘trans’ (Bonen, 2008). Given their degeneracy and the fact that none of the introns in plant mitochondria have been shown to self-splice in vitro, it is anticipated that they require the participation of protein cofactors for their efficient splicing in vivo. However, only a small number of such factors have been identified in plants, and even less is known about their specific roles in splicing. Proteins that function in the splicing of mitochondrial group II introns in plants include maturase-related proteins (Keren et al., 2009, 2012), pentatricopeptide repeat (PPR) proteins (Falcon de Longevialle et al., 2007; Koprivova et al., 2010; Liu et al., 2010), a homolog of ‘regulator of chromosome condensation’ (RUG3; Kühn et al., 2011), a ‘PORR-domain’ family member (WTF9; Colas des Francs-Small et al., 2011) and a DEAD-box RNA-helicase protein (PMH2) which influences the processing, or the stability, of many mitochondrial transcripts in Arabidopsis (Köhler et al., 2010). These proteins are diverse in origin and most probably also in their mechanism of action.

CRS1-YhbY domain (CRM; Pfam-PF01985) is a recently recognized RNA-binding motif of bacterial origin (Barkan et al., 2007; Keren et al., 2008) that is present in several group II intron splicing factors in plant chloroplasts: CRS2-associated factor 1 (CAF1), CAF2, CRM Family Member 2 (CFM2), CFM3 and CRS1 (Jenkins et al., 1997; Till et al., 2001; Ostersetzer et al., 2005; Asakura & Barkan, 2007; Barkan et al., 2007; Asakura et al., 2008). Interestingly, CAF1 and CAF2 are closely related paralogs, each containing two CRM domains, which form functional splicing complexes with a peptidyl-tRNA hydrolase homolog (CRS2) to promote the splicing of many group II introns in the chloroplasts (Jenkins & Barkan, 2001; Ostheimer et al., 2003; Asakura & Barkan, 2006; Asakura et al., 2008).

In angiosperms, the CRM family is represented by 14 orthologous gene groups, containing between one and four repeats of the conserved domain (Barkan et al., 2007), but these are largely uncharacterized. Two of these hypothetical proteins, annotated here as mitochondria CAF-like splicing factor 1 (mCSF1; At4 g31010) and mCSF2 (At5 g54890), are closely related to CAF factors and are predicted to be targeted to mitochondria (Ostheimer et al., 2006). These are therefore excellent candidates for mitochondrial group II intron splicing factors in plants.

In this study, we show the mitochondrial localization of mCSF1 and establish its roles in the splicing of group II introns in plants. The effects of lowering the expression of this novel mitochondria-localized CRM-associated factor on the phenotype and physiology of ‘knockdown’ mutants in Arabidopsis thaliana are discussed.

Materials and Methods

Plant material and growth conditions

Arabidopsis thaliana (L.) Heynh (ecotype Columbia) was used in all experiments. Wildtype and individual mutants were obtained from the Arabidopsis Biological Resource Center at Ohio State University (Columbus, OH, USA). Before germination, seeds of wildtype and mutant lines were surface-sterilized with bleach (10% (v/v) sodium hypochlorite) and sown on MS-agar plates containing 1% (w/v) sucrose. The plates were kept in the dark for 2 d at 4°C and then grown under either short-day (SD 8: 16 h) or long-day (LD 16 : 8 h) conditions in a controlled temperature and light growth chamber (22°C, 150 μmol photon m−2 s−1 ). PCR was used to screen the plant collection and check the insertion integrity of each individual line (specific oligonucleotides are listed in the Supporting Information, Table S1). Sequencing of specific PCR products was used to analyze the precise insertion sites in each T-DNA line.

Microscopy analysis of siliques, embryos and mitochondria

Siliques obtained from heterozygous and wildtype plants at different developmental stages were opened lengthwise and examined under a stereoscopic (dissecting) microscope (binocular). For analysis of embryos, immature seeds were removed from green siliques at various times after pollination with a dissecting microscope and cleared in a small amount of Hoyer's solution (30 ml water, 100 g chloral hydrate, 7.5 g gum arabic, and 5 ml glycerin) on a glass slide. Embryos of wildtype and mutant seeds were visualized using a Leica DMLB microscope fitted with Nomarski optics (Leica Microsystems GmbH, Wetzlar, Germany). Images were captured using a Nikon DS-Fi1 digital microscope camera and edited using Photoshop (Adobe Systems, San Jose, CA, USA) software.

The morphology of mitochondria in wildtype and mcsf1 seedlings was analyzed by transmission electron microscopy in ultrathin sections obtained from 5-d-old plants, grown on sucrose-containing MS medium, as described previously (Keren et al., 2012).

Protoplast preparation and green fluorescent protein (GFP)-based transient assays

GFP (Green fluorescent protein)-fusion proteins were expressed and imaged as previously described (Keren et al., 2012). A PCR-amplified fragment (c. 150 amino acids long; specific oligonucleotides are listed in Table S2) of the N-terminus of each gene was fused in-frame to GFP by cloning with NcoI and XhoI sites into the pTEX-GFP vector (gift of Dr Yoram Eyal; ARO). GFP-fusion constructs containing the N-termini of Rubisco small subunit (RbcS, 65 amino acids) and mitochondrial AtpB (mAtpB, 54 amino acids) were used as controls for the integrity of the localization assays (Keren et al., 2009). The resulting vectors were introduced into tobacco protoplasts (Nicotiana tabacum cv Samsun; NN) by electroporation, as described previously (Keren et al., 2009). The protoplasts were transferred to growth medium and incubated for 48 h in the dark (27°C) before visual analysis. Images were obtained by laser scanning confocal microscopy (Olympus Fluoview 500). Mitochondria were visualized by MitoTracker-orange (0.4 μM; Molecular Probes, Invitrogen, Carlsbad, CA, USA).

Establishment of artificial microRNA lines

Artificial microRNAs (miRs) were designed to knock down the endogenous mCsf1 gene in Arabidopsis (At4 g31010). The miR design algorithm, provided by WMD3 web microRNA designer (Ossowski et al., 2008), was used to select target sequences. The alignment search tool (BLAST) was used with the A. thaliana (ecotype Columbia) genome database to verify unique regions in At4 g31010 locus. A region near the C-termini of the first CRM domain (i.e. GAGGGCGAAACTACGATCCCA, nucleotides 191–211) was chosen to target the mCsf1 gene. The miR-mCSF1 was synthesized commercially and cloned into a pUC57 vector (GenScript, Piscataway, NJ, USA). The construct was cloned into the pART27 binary vector (Gleave, 1992) under the control of the 35S promoter. This construct was introduced into Arabidopsis by Agrobacterium-mediated transformation, using the floral-dip method (Clough & Bent, 1998).

RNA extraction and analysis

RNA was extracted from 3-wk-old Arabidopsis rosette leaves using Tri-Reagent (Sigma-Aldrich), according to the manufacturer's instructions. The RNA was then treated with RNase-free RQ1-DNase (Promega) before its use in the assays. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed with specific oligonucleotides designed from both intron and exon regions, corresponding to the 23 group-II introns in Arabidopsis mtDNA in wildtype and mcsf1 mutant plants, as previously described (Koprivova et al., 2010; Kühn et al., 2011; Keren et al., 2012). Specific oligonucleotides are listed in Table S3. The ratio of primary and mature RNAs between wildtype and mcsf1 plants was then evaluated for each transcript.

Respiration activity

The respiratory activities were measured using a Clark-type oxygen electrode (Yellow Springs Instrument Co., Cleveland, OH, USA), connected to a 1 mV recorder (Electronik; Honeywell Control System Ltd, Bracknell, UK). A crude organellar suspension (c. 200 μg proteins; Keren et al., 2012) was incubated in 2 ml oxygen-electrode buffer (25 mM N-(Tris(hydroxymethyl)methyl)-2-aminoethanesulfonic acid (TES), 10 mM KCl, 2 mM MgSO4, 5 mM KH2PO4, 0.3 M sucrose, 0.1% BSA, pH 7.5) and applied to the electrode in a sealed glass chamber. Respiration was initiated by the addition of 5 mM NADH for complex I activity assays or 5 mM ascorbate and 50 μM cytochrome c in the presence of Triton X-100 (0.025% v/v) for complex IV activity assays. The specificity of the reactions was also measured in the presence of electron transport inhibitors, rotenone (40 μM) and KCN (2 mM).

Blue native (BN) electrophoresis for isolation of native organellar complexes

Blue native polyacrylamide gel electrophoresis (BN-PAGE) of crude membranous fractions was performed according to the method described by Colas des Francs-Small et al. (2011). An aliquot equivalent to 40 mg of crude Arabidopsis membrane extracts, obtained from wildtype and mcsf1 plants, was solubilized with n-dodecyl-β-maltoside (1.5% (w/v)) in ACA buffer (750 mM amino-caproic acid, 0.5 mM EDTA, and 50 mM Tris-HCl, pH 7.0), and then incubated on ice for 20 min. The samples were centrifuged at c. 20 000 g for 10 min, and Serva Blue G (0.2% (v/v)) was added to the supernatant. The samples were then loaded onto a native 4.5–16% gradient gel. For nondenaturing-PAGE-Western blotting, the gel was transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad) in cathode buffer (50 mM Tricine and 15 mM Bis-Tris-HCl, pH 7.0) for 16 h at 4°C (at a constant current of 40 mA). The membrane was incubated with various antibodies, as indicated in each figure, and detection was carried out by chemiluminescence assay after incubation with an appropriate horseradish peroxidase (HRP)-conjugated secondary antibody. In-gel (complex I) and succinate dehydrogenase (complex II) activity assays were performed as described previously (Meyer et al., 2009; Huang et al., 2012).

Total protein extraction and analysis

Crude Arabidopsis membrane extracts were prepared essentially as described in Colas des Francs-Small et al. (2011). Protein concentration was determined using the Bradford method (Bio-Rad) according to the manufacturer's protocol, with BSA as a calibrator. For immunoassays, total membrane fractions were isolated, and the protein was isolated by acetone (85% (v/v)) precipitation. Protein was then suspended in sample loading buffer (Laemmli, 1970) and subjected to sodium dodecyl sulfate PAGE (SDS-PAGE) (at a constant 100 V). Following electrophoresis, the proteins were transferred to a PVDF membrane (Bio-Rad) and incubated overnight (at 4°C) with various primary antibodies (Table S4). Detection was carried out by chemiluminescence assay after incubation with an appropriate HRP-conjugated secondary antibody.


mCSFs – mitochondrial homologs of plastid CAF splicing factors

CRM is a novel RNA-binding domain of c. 10 kDa, which is represented in a small family of proteins in plants (Barkan et al., 2007; Keren et al., 2008). Phylogenetic analysis was used to infer the evolutionary relationships between several CRM proteins in the plant lineage. As indicated in Fig. S1, CRM proteins from various plants form several distinct subfamilies, which we have designated following the orthologous reference proteins in maize. These include CAF1 and CAF2 (Ostheimer et al., 2003), CRS1 (Till et al., 2001; Ostersetzer et al., 2005), CFM3 (Asakura et al., 2008) and CFM2-related proteins (Asakura & Barkan, 2007).

In addition to known CRM factors, plant genomes also encode two additional CRM members, designated here as mCSF1 (At4 g31010) and mCSF2 (At5 g54890), which are closely related to CAF1 and CAF2, but predicted to be localized to the mitochondria (Table 1; Ostheimer et al., 2003). Interestingly, the nonflowering plants, including Selaginella and Physcomitrella, have CRM orthologs for chloroplast splicing factors (Fig. S1), where introns are conserved, but seem to lack the mitochondrial orthologs, where introns differ between seed and nonseed plants to varying degrees (Bonen & Vogel, 2001; Knoop, 2004, 2012; Hazle & Bonen, 2007). The phylogram topology of the CRM family in plants is consistent with a previous report (Barkan et al., 2007).

Table 1. Putative CRS2-associated factor (CAF) and CRS2 splicing factors in Arabidopsis thaliana
At gene identifierNamePredotar predictionTargetP predictionOrtholog (s) in maizeIn vivo localizationEstablished function(s)
  1. a

    MS/MS analyses – SUBA3 database (Heazlewood et al., 2007).

  2. b

    Data presented in Asakura & Barkan (2006).

  3. c

    The localization of the Arabidopsis CAF2 ortholog to plastids has not been yet determined.

  4. d

    GFP-localization data presented in Fig. 2.

  5. e

    Mitochondria transcript profile by reverse transcription ‘real-time’ quantitative polymerase chain reaction (RT-qPCR) in this manuscript (see Fig. 6 and Supporting Information Figs S3, S5).

  6. f

    CRS2/PTH gene annotations as indicated by Ostheimer et al. (2005).

  7. g

    N.D., not determined.

At2 g20020CAF1PlastidPlastidCAF1PlastidaSplicing of plastidial intronsb
At1 g23400CAF2PlastidPlastidCAF2N.D.;c plausibly plastidsSplicing of plastidial intronsb
At4 g31010mCSF1MitochondrionMitochondrionCAF-relatedMitochondriadSplicing of mitochondrial intronse
At5 g54890mCSF2MitochondrionMitochondrionCAF-relatedMitochondriadN.D.g
At5 g38290CRS2.AfUnknownPlastidCRS2-relatedfUncleardN.D.
At5 g16140cCRS2.BfUnknownUnknownCRS2-relatedfPlastiddN.D.
At5 g19830mPTH/CRS2fMitochondrionMitochondrionCRS2 or PTHfMitochondriadN.D.
At1 g18440cPTHfMitochondrionPlastidPTH-relatedfPlastida,dN.D.

Similar to the CAF factors, both mCSF1 and mCSF2 contain two CRM repeats, separated by a short linker region (Fig. 1). However, unlike their plastidial counterparts, the deduced amino acid sequences of mCSF1 and mCSF2 terminate shortly after the second CRM domain. Analysis of their expression profiles, available in the ‘Genevestigator’ microarray (Hruz et al., 2008) and expressed sequence tag (EST) database, suggested that mCSF1 and mCSF2 are expressed at low levels in different tissues throughout the plant development. Like other genes implicated in mtDNA expression and RNA metabolism in plants, the mcsf genes show an expression profile that peaks in abundance during the very early developmental stages (c. 12 h after seed imbibition), before decreasing over time (Narsai et al., 2011; Law et al., 2012).

Figure 1.

Alignment of CRS2-associated factor (CAF) paralogs from Arabidopsis. Arabidopsis homologs to CAF were obtained by BLAST-P search, using the nonredundant (nr) protein DB (NCBI). The deduced amino acid sequences of the CAF-related proteins in Arabidopsis were aligned using the CLUSTAL program (Jeanmougin et al., 1998). Identical residues are shaded in black; similar residues are shaded in gray. Dashed lines indicate predicted organellar targeting presequence in plants by the SUBA database (Heazlewood et al., 2007), whereas thick lines indicates low conservation regions. The positions of the CRM domains and the putative CRS2-binding site in the Arabidopsis CAF-related proteins are indicated by shaded boxes, according to Ostheimer et al. (2003).

mCSF1 and mCSF2 are localized to mitochondria in vivo

Plants contain several CRM homologs that are predicted to reside within mitochondria by the computer programs TargetP (Emanuelsson et al., 2000) and Predotar (Small et al., 2004; Table 1 and Barkan et al., 2007). However, subcellular localization prediction algorithms are still not entirely accurate, and no unique peptides corresponding to these proteins are currently available in plant proteome databases (Heazlewood et al., 2007; Baerenfaller et al., 2011). To establish the intracellular locations of the mCSF proteins in vivo, constructs encoding the N-terminal regions (c. 150 amino acids) of the mCSF1 and mCSF2 paralogs in Arabidopsis were cloned in-frame to GFP, introduced into tobacco protoplasts and the location of each GFP fusion protein was determined by confocal microscopy. The N-terminal regions of the Rubisco small subunit (RbcS; plastid control) and ATP synthase β-subunit (AtpB; mitochondrial control), fused in-frame to GFP, were used as controls for the GFP localization analysis (Keren et al., 2009). 5′ RACE (rapid amplification of cDNA ends) was used to ensure the correct identification of the start codon in each construct.

As indicated in Fig. 2, the signals of RbcS-GFP and AtpB-GFP colocalized with those of chlorophyll autoflorescence and the MitoTracker marker (a mitochondrion-specific fluorescent probe), respectively. By contrast, protoplasts expressing GFP alone showed green fluorescence throughout the nucleus and cytoplasm (Fig. 2). When protoplasts were transfected with the N-terminal region of mCSF1 fused to GFP, the signal was exclusively detected as rod-shaped granules colocalizing with those of the MitoTracker marker (Fig. 2). Similarly, the transit peptide of mCSF2 also directs the import of GFP into mitochondria. These results confirm the prediction that both mCSF proteins are targeted to mitochondria in vivo (Table 1).

Figure 2.

Localization of mitochondrial CAF-like splicing factor 1–green fluorescent protein (mCSF1-GFP) fusion protein to mitochondria. Tobacco protoplasts were transformed with expression plasmids encoding GFP fused to the N-termini of Rubisco small subunit (RbcS, 65 amino acids), mitochondrial AtpB (mAtpB, 54 amino acids), and the N-termini regions of Arabidopsis mCSF1 and mCSF2 paralogs (Table 1). For each construct, images are shown of GFP (green, upper left panel), MitoTracker (red, upper right panel), merged images with chlorophyll autoflorescence (blue, lower left panel), and light microscopy (lower right panel).

Embryo development is arrested during the early globular stage in mcsf1 plants

To analyze the roles of mCSF proteins in plant mitochondrial biogenesis and function, we screened the available T-DNA lines for insertions in the mCSF1 (At4 g31010) and mCSF2 (At5 g54890) loci in Arabidopsis.

Sequencing of genomic PCR products, spanning the T-DNA insertion junction in the SALK-086774 line, confirmed that the T-DNA was inserted within the third exon of mCSF1 (Fig. 3a). Despite this, no plants homozygous for the T-DNA insertion at this locus were recovered among the analyzed population. The selfed progeny of heterozygous SALK-086774 plants showed a kanamycin-resistant/sensitive segregation ratio of c. 2 : 1, suggesting that mCSF1 is an essential gene. PCR genotyping further indicated that the resistant lines were all heterozygous for this mutation. Heterozygous SALK-086774 plants were phenotypically indistinguishable from the wildtype, suggesting that the T-DNA insertion resulted in a recessive embryo-lethal phenotype and that a single copy of the gene is sufficient to support normal growth and development.

Figure 3.

Schematic representation of the mcsf1 gene. (a) Schematic representation of the At4 g31010 gene locus. Shaded boxes represent exons, and solid lines represent introns. The precise location of the T-DNA insertion site in the SALK-086774 line is outlined within the gene. LB, T-DNA left border. Bars represent 100 nucleotides. (b) Schematic representation of the deduced protein sequence of the Arabidopsis thaliana mitochondrial CAF-like splicing factor 1 (mCSF1). Predicted organelle targeting region within the N-terminal part (TP) and the two CRM domains are highlighted within the sequence according to Ostheimer et al. (2003). The miR-CSF1 target site is indicated below the figure.

To confirm this assumption, we compared the embryo development in seeds of immature siliques (5–9 d after fertilization) of heterozygous SALK-086774 plants using Nomarski optics (Fig. 4). Young siliques of SALK-086774 contained c. 25% white translucent seeds (i.e. 24.6 ± 7.1% of the 138 seeds examined), which degenerated into collapsed brown aborted seeds (Fig. 4a). Moreover, while green seeds carried embryos at the heart (i) or cotyledon (iii) stages, white seeds of the same siliques showed delayed embryo development, and carried embryos which were arrested in the early globular stage (ii), or carried distorted embryos (iv) (Fig. 4b).

Figure 4.

Embryo lethality of the mitochondrial CAF-like splicing factor 1 (mCSF1) mutation. (a) Open mature siliques of wildtype (Col-0) and heterozygous SALK-086774 Arabidopsis plants. While siliques of wildtype plants carry normal seeds, the siliques of heterozygous SALK-086774 plants show segregation of c. 3 : 1 normal green seeds : aborting seeds (black arrows). Bar, 1000 μm. (b) Equivalent developmental stages of embryos of green (i, iii) and white aborted seeds (ii, iv) within immature siliques of heterozygous SALK-086774 plants. Normal embryos of green seeds at the late-heart (i) or cotyledon (iii) stages; corresponding white-seed embryos from the same siliques at the early-globular stage (ii and iv, respectively). The Nomarski images are all at the same magnification (×40 objective). Bars, 100 μm.

Homozygous SALK-081851 and SALK-052460 plants (containing T-DNA insertions at the 5′ or 3′ end of the mCSF2 gene, respectively) did not show any obvious phenotypes under normal growth conditions (see the 'Materials and Methods' section). RT-PCR analysis indicated that the T-DNA insertions did not affect the expression of mCSF2 in the homozygous lines.

mCSF1-suppresion lines show reduced germination, growth retardation and malformed leaf phenotypes

As the available T-DNA lines associated with mCSF1 and mCSF2 genes were not informative, we generated several independent knockdown lines in Arabidopsis, using an artificial microRNA gene silencing method (Schwab et al., 2006). The miR-mCSF1 construct was designed to target a unique region (i.e. GAGGGCGAAACTACGATCCCA, nucleotides 191–211) in the mCSF1 transcript, found near the 3′-end of the first CRM domain (Fig. 3b). Positive plants, which carried the miR-mCSF1 transgene, were selected and their T3 progeny were analyzed for mCSF1 mRNA transcript abundance and growth phenotypes.

The suppression efficiency of miR-mCSF1 was determined by reverse transcription ‘real-time’ quantitative PCR (RT-qPCR). Two lines (i.e. mcsf1-1 and mcsf1-2) demonstrated significant reductions (80–90%) in the mRNA levels of mCSF1 (Fig. 5a). RT-qPCR assays further indicated that miR-mCSF1 specifically targets the mRNA of mCSF1, as the expression of several other CRM homologs in Arabidopsis, including mCSF2 (At5 g54890), CAF1 (At2 g20020) and CAF2 (At1 g23400), was not significantly affected in mcsf1-1 or mcsf1-2 plants (Fig. 5b).

Figure 5.

Plant phenotypes associated with mitochondrial CAF-like splicing factor 1 (mCSF1) suppression in Arabidopsis. mRNA transcript accumulation of mCSF1 (a) and CRS2-associated factor 1 (CAF1), CAF2 and mCSF2 (b) in wildtype (Col-0) and transgenic mcsf1-1, mcsf1-2 and mcsf1-3 plants carrying the miR-mCSF1 transgene. Data were obtained by real-time reverse transcription polymerase chain reaction (RT-qPCR) normalized against rpl5B (At5 g39740), 18S-rRNA (At3 g41768) and actin2 (At3 g18780). The values are means of three biological replicates (error bars represent the means ± SD). (c) The effects of mCSF1 suppression on growth phenotypes and leaf morphology of wildtype and mcsf1-1, mcsf1-2 and mcsf1-3 lines (45-d-old seedlings). Germination efficiencies (%) are indicated in brackets (wildtype, 97.6 ± 1.6; mcsf1-1, 72.1 ± 7.5; mcsf1-2, 64.2 ± 6.7; mcsf1-3, 95.7 ± 3.8). Genotypes were confirmed by PCR and sequencing (Supporting Information Table S1).

Transgenic plants carrying microRNAs designed to target mCSF2 transcripts failed to show evidence of mCSF2 silencing and were not further analyzed. Additional experimental investigation will be required to determine whether mCSF2 functions in the processing of mitochondrial transcripts in plants. Here, we analyzed in detail the growth phenotypes and mitochondrial activities associated with several miR-mCSF1 lines.

Under SD or LD conditions, mcsf1-1 and mcsf1-2 displayed lower germination efficiencies and altered growth phenotypes (Fig. 5c). Also, their leaves were smaller, roundish and slightly paler when compared with those of wildtype plants (Fig. 5c, lower panel). These phenotypes resemble those of nMat2 plants, which are affected in the processing of several group II introns in Arabidopsis mitochondria (Keren et al., 2009). PCR analysis confirmed that the above phenotypes cosegregate with the miR-mCSF1 transgene. In addition, no obvious phenotypes were associated with the mcsf1-3 line, which contained the miR-mCSF1 construct but showed only little decrease in mCSF1 expression (Fig. 5a).

Fig. S2 shows the mitochondrial morphology of 5-d-old wildtype and mcsf1 plants using transmission electron microscopy. While wildtype mitochondria showed the characteristic internal cristae as dense folds in the inner-membrane sections (Fig. S2, upper panel), the electron micrographs of mcsf1-1 and mcsf1-2 indicated mitochondrial defects, as reflected by reduced cristae density in both mutants. The aberrant mitochondria morphology phenotypes of mcsf1 plants resemble those of Arabidopsis plants affected in mitochondrial biogenesis (Rigas et al., 2009; Keren et al., 2012), which are consistent with the postulated roles of mCSF1 in mitochondrial RNA metabolism.

RNA interference-mediated silencing of mCSF1 leads to splicing defects in numerous mitochondrial group II intron RNAs in A. thaliana

The homology of mCSF1 to known RNA-binding cofactors, together with the growth phenotypes and mitochondrial morphology defects seen in mcsf1 mutants, strongly suggested that mCSF1 functions in the metabolism of mitochondrial RNAs. To test this hypothesis, we analyzed the splicing efficiencies of each of the 23 introns in Arabidopsis mitochondria (Unseld et al., 1997), in wildtype plants and mCSF1-reduced lines, by RT-qPCR. Expression profiling by RT-qPCR was performed essentially as described previously (Falcon de Longevialle et al., 2007; Koprivova et al., 2010; Colas des Francs-Small et al., 2011; Keren et al., 2012).

As indicated in Figs 6 and S3, splicing defects were observed for numerous individual mitochondrial group II introns in mcsf1-1 and mscf1-2. These included the single introns within cox2 and rps3 (cis configuration), the second (cis-spliced) and third (trans-spliced) introns within nad1, the four introns in nad2 (in both cis and trans configurations), nad5 introns 1 (cis-spliced), 2 and 3 (trans-spliced), and nad7 intron 2 (cis-spliced). In each case, an accumulation of unspliced pre-mRNA (Fig. 6a) was correlated with decreased transcript abundance in the corresponding mRNA in both mcsf1-1 and mcsf1-2 lines (Fig. 6b). Accordingly, nonquantitative RT-PCR with oligonucleotides designed to amplify the mature transcripts confirmed decreased mRNA levels of cox2, nad1, nad2, nad5, nad7 and rps3 (Fig. S3, marked with arrows). Nevertheless, significant levels of processed mRNAs were found for all of these transcripts (Figs 6b, S3). Sequencing analysis indicated that the nad1, nad2, nad5, nad7, cox2 and rps3 mRNAs were correctly processed in the mutants (Fig. S4).

Figure 6.

Abundance of mitochondrial transcripts in mitochondrial CAF-like splicing factor 1 (mCSF1)-reduced lines. Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) analysis of the 23 intron-containing mitochondrial transcripts in Arabidopsis thaliana (Unseld et al., 1997). RNA, extracted from 3-wk-old seedlings of wildtype (Col-0) and mcsf1 plants, was analyzed by RT-qPCR with primers that specifically amplified group II intron containing (unspliced) pre-mRNAs (a) or mRNAs (b) (i.e. cox2, ccmFc, nad1, nad2, nad3, nad4, nad5, nad6, nad7, nad9 and rps3). The histogram shows the log2-transformed ratios of transcript abundances in mCSF1-reduced lines compared with those of wildtype siblings. The values are means of four biological replicates (error bars indicate ± 1 SD).

Accumulation of pre-mRNAs in mcsf1-reduced lines was also apparent for nad4 introns 2 and 3 and nad5 intron 4 (Fig. 6a). However, as their corresponding mRNA levels were not significantly affected in mcsf1 mutants (Figs 6b, S3), we could not draw any firm conclusions regarding the putative roles of mCSF1 in the splicing of either of these introns. No significant differences in the transcript abundances of nad1 introns 1 and 4, nad4 intron 1, the single introns within cytochrome c biogenesis factor C (ccmFC) and ribosomal protein L2 subunit (rpl2) were observed between wildtype and mcsf1 plants (Figs 6, S3). Therefore, we concluded that the splicing of these introns does not require mCSF1.

mCSF1 suppression has a strong effect on mitochondrial respiration

The splicing defects and retarded growth phenotypes we observed in mcsf1 plants suggest altered mitochondrial activities, as a result of lower availability of various organellar-encoded subunits. We monitored the oxygen (O2) uptake of wildtype and mcsf1 plants with a Clark-type electrode and found that, in the presence of NADH, the respiration activities of both mcsf1-1 and mcsf1-2 plants were substantially lower (58.4 ± 8.6 and 51.7 ± 4.7 nmol O2 min−1, respectively) than those of wildtype (99.5 ± 11.9 nmol O2 min−1) and mcsf1-3 plants (102.8 ± 8.3 nmol O2 min−1; Fig. 7a). The average O2 uptake rates of wildtype plants (Col-0) and mcsf1 suppression lines were also measured in the presence of rotenone (40 μM), a specific inhibitor of complex I electron transport. While the respiratory activities of wildtype and mcsf1-3 plants were strongly affected by 40 μM rotenone (c. 50% reduction), the inhibitor had only a minor effect on the O2 uptake rates of mcsf1-1 and mcsf1-2 plants (55.3 ± 8.6 and 56.1 ± 12.7 nmol O2 min−1, respectively; Fig. 7a).

Figure 7.

Respiration activity in wildtype and mitochondrial CAF-like splicing factor 1 (mCSF1)-reduced lines. Oxygen (O2) uptake rates of crude organellar extracts, obtained from 3-wk-old wildtype (Col-0) and mcsf1 mutant Arabidopsis plants, were analyzed with a Clark-type electrode. For each assay, c. 200 μg total protein was resuspended in 2 ml reaction medium containing 25 mM N-(Tris(hydroxymethyl)methyl)-2-aminoethanesulfonic acid (TES), 10 mM KCl, 2 mM MgSO4, 5 mM KH2PO4, 0.3 M sucrose, and 0.1% BSA (pH 7.5), and applied to the electrode in a sealed glass chamber under continuous stirring in the dark. O2 uptake was initiated by the addition of 5 mM NADH (complex I) or 5 mM ascorbate + 50 μM cytochrome c (complex IV) to the reaction medium and measured in the presence or absence of rotenone (40 μM) and potassium cyanide (KCN, 2 mM). N.D, not determined. Bars show means ± SD of five biological replicates.

The COX2 subunit is essential for cytochrome c oxidase (complex IV) assembly and function (reviewed by Mick et al., 2011). As splicing defects were observed in the case of cox2 (Figs 6, S3) and its mRNA levels were notably reduced in the mutants (Fig. 6b), we also monitored complex IV respiratory activity in wildtype and mcsf1 plants. In the presence of ascorbate and cytochrome c, the average O2 uptake rates of wildtype (24.2 ± 5.6) or mcsf1-3 control plants (23.8 ± 4.5 nmol O2 min−1) were substantially greater than those measured for mcsf1-1 and mcsf1-2 mutants (8.4 ± 2.5 and 11.3 ± 1.3 nmol O2 min−1, respectively; Fig. 7b). When KCN, a potent inhibitor of complex IV, was added to the reaction mix (see the 'Materials and Methods' section) the respiration rates of both wildtype and mcsf1 plants’ mitochondria were notably reduced (Fig. 7b). Together, these results indicated that complex I and IV activities were decreased in mcsf1 plants.

The biogenesis of complexes I and IV is affected in the mCSF1-suppression lines

The relative accumulation of native organellar complexes in wildtype plants and mcsf1 lines was analyzed by BN-PAGE, to determine whether mCSF1 suppression affects the biogenesis of the respiratory machinery. The equivalent of 40 mg crude membrane fractions, obtained from 3-wk-old wildtype and mcsf1 plants, were solubilized with 1.5% n-dodecyl-β-maltoside (DDM), loaded onto native gradient gels and separated by electrophoresis (Colas des Francs-Small et al., 2011).

Blue native polyacrylamide gel electrophoresis separation of organellar complexes, followed by ‘in-gel’ detection of NADH-dehydrogenase activity assays, revealed a large reduction in complex I activity in both mcsf1-1 and mcsf1-2 (Fig. 8). Immunoblot analysis, following native gel electrophoresis, with antibodies raised to complex I γ-type carbonic anhydrase-like subunit 2 (CA2; Perales et al., 2005) and Nad9 (Lamattina et al., 1993), further indicated that complex I exists only in trace amounts in mcsf1 mutants (Fig. 8).

Figure 8.

Respiratory chain complexes I and IV are reduced in mcsf1 mitochondria. Crude membrane fractions obtained from 3-wk-old wildtype (Col-0) and mcsf1 Arabidopsis plants were solubilized with n-dodecyl-β-maltoside (DDM; 1.5% (w/v)) and the membrane complexes were resolved by blue native polyacrylamide gel electrophoresis (BN-PAGE), as described in Colas des Francs-Small et al. (2011). Proteins were visualized with Coomassie staining. For in-gel activity assays of complex I, gels were incubated in 100 mM Tris-HCl, 0.14 mM NADH, and 1 mg ml−1 nitroblue tetrazolium (NBT), pH 7.4, for up to 1 h at room temperature. For complex II activity assays, the gel was incubated for 1–3 h in a solution containing 50 mM phosphate buffer, 84 mM succinate, 0.2 mM N-methylphenazinium sulfate (PMS), 2 mg ml−1 NBT, 4.5 mM EDTA, and 10 mM KCN at room temperature. For immunodetections, the proteins were transferred from the native gels onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad) in cathode buffer for 15 h at 40 mA, using a Bio-Rad Mini Trans-Blot Cell. The membrane was then distained with ethanol before probing it with specific antibodies, as indicated below each blot. Bands corresponding to native mitochondria complexes I, II, III, IV (C-I, C-II, C-II, C-IV) and the ATP-synthase enzyme (C-V) are indicated by thick arrows, while thin arrows indicate native photosystem I (PSI), photosystem II (PSII), and the light-harvesting complex II (LHCII) of the chloroplast. RISP, Rieske iron-sulfur protein; CA2, carbonic anhydrase-like subunit 2.

Organellar proteins in plants are prone to degradation following heat denaturation or oxidative damage, as well as in the presence of imbalances in the stoichiometry of multisubunit complexes (Keser & Langer, 2000; Adam & Ostersetzer, 2001). The accumulation of various complex I subunits was further analyzed by denaturing SDS-PAGE, followed by immunoblotting of crude organellar extracts. These assays indicated notable reductions (three- to fivefold) in the steady-state levels of the 18 kDa (NDUFS4; Meyer et al., 2011) and Nad9 subunits of the matrix-exposed domain (peripheral arm) of complex I in both mcsf1 lines (Fig. 9). Yet the CA2 subunit of the membrane-arm accumulated to higher degrees (two- to threefold) in mcsf1 plants. As carbonic anhydrase-like subunits are thought to be incorporated into complex I at an early stage (Klodmann et al., 2010; Meyer et al., 2011), the additional bands of lower apparent molecular mass in the BN-PAGE blots with CA2 antibodies in the mutants (Fig. 8) may indicate the accumulation of partially assembled subcomplex I particles containing the CA2 subunit in mcsf1 plants.

Figure 9.

Relative accumulation of organellar proteins in mcsf1 mutants. Crude membrane extracts, obtained from 3-wk-old rosette leaves of Arabidopsis wildtype and mcsf1 plants, were equally loaded based on total proteins (c. 50 μg total protein) and separated by 12 or 15% sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). Following electrophoresis, the proteins were blotted onto polyvinylidene difluoride (PVDF) membrane (Bio-Rad). The upper panel represents Coomassie blue staining of the SDS-PAGE. The panels below show immunoblots with antibodies raised to various mitochondrial proteins (see Table S4). Detection was carried out by chemiluminescence assay (Roche) with the Image Quant RT ECL Analyzer (GE Healthcare, Buckinghamshire, UK). C-I, C-III, C-IV, C-V, complexes I, III, IV and V, respectively.

In addition to complex I, we also analyzed the effect of mCSF1 suppression on the biogenesis of complexes II, III, IV and V. Characterization of succinate-dehydrogenase activity indicated that complex II was not significantly affected in mcsf1 plants (Fig. 8). Similarly, immunoblots of native and denatured membrane fractions with an antibody against the Rieske iron-sulfur protein (RISP; Carrie et al., 2010) indicated that complex III is found in similar abundances in wildtype and mcsf1 plants (Figs 8, 9).

In agreement with the RNA profiles (Figs 6, S3) and respiration analysis (Fig. 7), the SDS-PAGE/immunoblots showed lower steady-state levels of COX2 subunit (Fig. 9). Similarly, immunoassays of the native gels with COX2 antibodies also suggested a reduction in fully assembled complex IV particles in mcsf1 plants (Fig. 8). Unfortunately, no antibodies are currently available against complex IV subunits other than COX2. Nevertheless, as COX2 is a central component of the catalytic core of complex IV (Soto et al., 2012), a large reduction in COX2 is expected to affect the assembly and/or stability of the cytochrome c oxidase enzyme, as indicated for yeast mitochondria (Horan et al., 2005). By contrast, complex V accumulated to a higher degree in mcsf1 lines, as shown by immunoblot analysis of BN-PAGE (Fig. 8) and denaturing gels of crude organellar extracts with antibodies against the ATP-synthase AtpA and AtpB subunits (Fig. 9).

Elevated concentrations of the major external NADH-dehydrogenase (NDB2; Carrie et al., 2008) and alternative oxidase subunit 1a (AOX1a) were also evident (Fig. 9). These results are consistent with the feeble inhibition of NADH oxidation by rotenone in the mutants (see Fig. 7 and Rasmusson et al., 2008). No significant differences in the abundance of the anion-channel Porin (VDAC) protein were observed between mcsf1 and wildtype plants (Fig. 9).


mCSF1, a nuclear-encoded factor required for the processing of numerous mitochondrial pre-mRNAs, is essential for embryo development in A. thaliana

CRM is a recently recognized RNA-binding domain (c. 10 kDa) of ancient origin that has been retained in eukaryotes only within plant and algal genomes (Fig. S1; Barkan et al., 2007; Keren et al., 2008). One of these members, mCSF1, which is related to the plastid CAF splicing factors, is localized exclusively to mitochondria (Fig. 2). Analysis of a T-DNA knockout line (Fig. 3) indicated that mCSF1 has essential roles during early embryogenesis (Fig. 4), which is in agreement with its postulated roles in mitochondria RNA metabolism.

Phenotypic examination of mCSF1-suppression lines showed that germination, plant height and leaf development (Fig. 5), as well as the efficiency of respiration (Fig. 7), were all affected in the mutants. Analysis of their RNA profiles indicated a role for mCSF1 in the splicing of numerous mitochondrial group II introns found within the coding regions of various complex I subunits, COX2 and RPS3 (Figs 6, S3), in both cis and trans configurations (Table 2 and Unseld et al., 1997). However, significant levels of correctly processed mRNAs were observed for these transcripts in the mutants (Figs 6, S3, S4), indicating either that mCSF1 is involved but not essential for splicing or, more likely, that silencing of mCSF1 expression is not complete in these lines (Fig. 5a). Accordingly, null mutations in mcsf1 would lead to far more severe blocks in the processing of these RNAs. While a complex I knockout in otp43 is viable (Falcon de Longevialle et al., 2007), the functions of complex IV and the translation machinery (e.g. splicing defects in rps3) are considered essential for mitochondria biogenesis in plants (Berg et al., 2005).

Table 2. Mitochondrial group II introns and their identified splicing factors in Arabidopsis
IntronCommentsaSplicing factor(s)References
  1. a

    Data modified from Bonen (2008).

  2. b

    Brackets indicate trans-spliced introns.

  3. c

    A nuclear mutation in Nicotiana sylvestris; the identity of NMS1 is currently unknown.

  4. d

    nad5 intron 4 is accumulating in the mutant, but no significant changes in the mRNA levels are observed (Supporting Information Fig. S3).

(nad1 intron 1)bTrans-spliced; lack the bulged-AOPT43nMAT1Falcon de Longevialle et al. (2007) and Keren et al. (2012)
nad1 intron 2Degenerate; no clear bulged-AnMAT2mCSF1Keren et al. (2009) and Data presented within this article
(nad1 intron 3)Trans-splicedmCSF1Data presented within this article
nad1 intron 4   
nad2 intron 1Lack the bulged-AnMAT1mCSF1Keren et al. (2012) and Data presented within this article
(nad2 intron 2)Trans-splicedRUG3mCSF1Kühn et al. (2011) and Data presented within this article
nad2 intron 3Degenerate intronRUG3ABO5mCSF1Kühn et al. (2011), Liu et al. (2010) and Data presented within this article
nad2 intron 4 mCSF1Data presented within this article
nad4 intron 1 NMS1cBrangeon et al. (2000)
nad4 intron 2Degenerate intron; lack the bulged-AnMAT1Keren et al. (2012)
nad4 intron 3   
nad5 intron 1 mCSF1Data presented within this article
(nad5 intron 2)Trans-spliced; degenerate intronmCSF1Data presented within this article
(nad5 intron 3)Trans-spliced; degenerate intronmCSF1Data presented within this article
nad5 intron 4 mCSF1?dData presented within this article
nad7 intron 1 BIR6Koprivova et al. (2010)
nad7 intron 2 nMAT2mCSF1Keren et al. (2009) and Data presented within this article
nad7 intron 3   
nad7 intron 4   
ccmFc WTF9Colas des Francs-Small et al. (2011)
cox2 nMAT2mCSF1Keren et al. (2009)
rpl2Degenerate intron; no clear bulged-AWTF9Colas des Francs-Small et al. (2011)
rps3 Degenerate intron; no clear bulged-AmCSF1Data presented within this article

It still remains unclear why mCSF1 functions in the splicing of many mitochondrial introns, while the splicing of nad1 introns 1 and 4, nad4 intron 1, ccmFC intron and rpl2 intron is not affected in the mutants (Table 2). It remains possible that these RNAs lack regions that are recognized by mCSF1 that have escaped our notice. Such intronic sequences, particularly within domains I and IV, were shown to play an important role in the recognition of group II intron RNA targets by their splicing factors (Matsuura et al., 2001; Ostersetzer et al., 2005; Keren et al., 2008). Detailed biochemical analysis of mCSF1 binding to its genetically identified RNA targets is required to address these speculations.

mCSF1 suppression is associated with mitochondrial oxidative phosphorylation (OXPHOS) defects in Arabidopsis

The respiratory complexes I and IV are multimeric enzymes, which function as electron-driven proton pumps and play fundamental roles in eukaryotic cell respiration and aerobic energy production. Their biogenesis requires concerted expression of both nuclear- and mitochondria-encoded subunits, as well as assembly factors (reviewed by Millar et al., 2011). Analysis of the respiration activities and BN-PAGE, followed by in-gel activity and immunoblot assays, indicated that the respiratory complexes I and IV were both functionally compromised in mcsf1 plants (Figs 8, 9). However, despite the splicing defects and reduced mRNA levels we observed in rps3 (Figs 6, S3), it is unlikely that organellar translation was significantly affected, as both mcsf1-1 and mcsf1-2 accumulated high quantities of the mitochondrially encoded AtpA and CcmFc proteins (Figs 8, 9).

Similarly to other plants affected in complex I (Clifton et al., 2005; Garmier et al., 2008; Rasmusson et al., 2008; Keren et al., 2009, 2012; Yoshida & Noguchi, 2009) or complex IV (Colas des Francs-Small et al., 2011), NDB2 and AOX1 proteins (Fig. 9), which are known to be induced in a coordinated manner under respiratory chain dysfunction and oxidative conditions of stress, were strongly induced in mcsf1 plants (Clifton et al., 2005; Garmier et al., 2008; Rasmusson et al., 2008; Yoshida & Noguchi, 2009).

Interestingly, other changes in mcsf1 plants may involve the accumulation of higher quantities of the ATP-synthase enzyme (Figs 8, 9). These results differ from those seen in rpoTmp mutants, which are also affected in the expression of complexes I and IV subunits but show no obvious variations in complex V levels (Kühn et al., 2009). The assembly of complex V is tightly regulated in plants, involving a coordinated assembly of F1 and F0 particles, via a mechanism which is currently unknown (Li et al., 2012). In Escherichia coli, exposure to high extracellular pH results in reduced expression of the NADH-dehydrogenase ndh and nuo genes, whereas the ATP-synthase operon is strongly induced (Maurer et al., 2005). RT-qPCR indicated that the mRNA levels of various ATP-synthase subunits, cytochrome c assembly factors and genes encoding ribosomal proteins varied only a little between wildtype and mcsf1-1 plants (Fig. S5). These observations raise the intriguing possibility that the translation of mitochondrial ATP-synthase transcripts in plants is responsive to variations in abundance of the nuclear-encoded subunits. Accordingly, the translation of several genes in algae plastids and yeast mitochondria is coordinated with the availability of their nuclear-encoded partners, by a regulatory mechanism known as control by epistasis of synthesis (CES; Wollman et al., 1999; Barrientos et al., 2004; Minai et al., 2006).

mCSF1: a component of ‘spliceosome-like machinery’ in higher-plant mitochondria?

Group II introns are both catalytic RNAs and retrotransposable elements that have invaded the genetic systems of the three major domains of life (i.e. archaea, bacteria and eukaryotes), but are particularly prevalent in the organellar genomes of plants (Bonen & Vogel, 2001; Lambowitz & Zimmerly, 2004). Based on structural features, the similarities of exon-intron boundaries and a common splicing mechanism, the mitochondria group II introns are proposed to be ancestors of the eukaryotic spliceosomal introns (Sharp, 1985; Cech, 1986; Lynch & Kewalramani, 2003; Martin & Koonin, 2006). Moreover, recent data indicate that the highly conserved spliceosomal Prp8 protein contains a reverse transcriptase (RT) domain that shares the highest sequence homology with group II intron maturases (Dlakic & Mushegian, 2011; Galej et al., 2013). However, the gradual transition of group II introns from prokaryotic-type maturase-dependent ribozymes into the complex spliceosomal machinery in the nuclear genomes of many eukaryotes remains unclear.

Interestingly, while the few group II introns in bacteria are typically found between open reading frames (ORFs) or directly after Rho elements, and are thus expected to be transcribed poorly and to have only a minor effect on bacterial fitness (Dai et al., 2003), the organellar introns in plants reside within many essential genes (Bonen & Vogel, 2001). Throughout their evolution, the organellar introns in plants have diverged considerably, such that they lack many elements that are considered essential for self-splicing activity and have also lost their maturase ORFs (Bonen & Vogel, 2001; Bonen, 2008). The mitochondrial introns in angiosperms belong to the subgroup IIA class, while plastids contain a similar number of group IIA and IIB introns (Bonen & Vogel, 2001; Bonen, 2008). Genetic analyses in maize indicated that the splicing of all but one of the subgroup IIB introns in chloroplasts requires a heteromultimeric complex, consisting of CRS2 and one of the two CAF proteins (Asakura et al., 2008). Other accessory factors have pivotal roles in the splicing of individual introns within this class (Barkan, 2011).

Similarly, in plant mitochondria, the maturation of cox2 pre-mRNA involves nMAT2 (Keren et al., 2009), PMH2 (Köhler et al., 2010) and mCSF1, while the removal of nad2 intron 1 and nad1 intron 2 is facilitated by mCSF1 and at least one maturase protein (nMAT1 and nMAT2, respectively; Keren et al., 2009, 2012). Thus, the evolutionary transition from specific (in bacteria) to versatile splicing factors in plant organelles may relate to the nuclear spliceosome, with its ability to process introns in trans. Table 2 summarizes the different mitochondrial splicing factors and their genetically identified RNA targets in plants. Our hypothesis is that mCSF1 is found within the mitochondria in ribonucleoprotein particles containing many group II introns and specific RNA-binding splicing cofactors. CRS2 (Jenkins & Barkan, 2001) is a strong candidate for one such mitochondrial protein.

Here, we analyzed the intracellular locations of the PTH/CRS2-related members in A. thaliana (Table 1), to investigate whether mitochondria in plants also contain proteins homologous to CRS2. While the signals of cCRS2.B (At5 g16140) and cPTH (At1 g18440) colocalized with those of chlorophyll autoflorescence, the intracellular location of CRS2.A (At5 g38290) was less clear, with a cytosolic distribution of the GFP signal. The GFP data indicate that mpth (At5 g19830) encodes a mitochondrial protein (Fig. S6). However, mPTH lacks the residues required for its association with CAF-related proteins (Ostheimer et al., 2005), and the C-termini regions of mCSF1 and mCSF2 are short and lack the amphipathic CRS2-binding region (Fig. S1 and Ostheimer et al., 2006). It remains possible, therefore, that mPTH carries essential peptidyl-tRNA hydrolase functions (Das & Varshney, 2006), and has no roles in the splicing of mitochondrial transcripts in plant. The association of mCSF1 with specific proteins and RNAs is being investigated by ribonomic assays of purified mitochondrial extracts.


We thank Dr Lea Nave (The Hebrew University) and Dr Ron Ophir (Volcani Center) for their help with respiration activity and phylogenetic analysis, respectively. We would also like to thank Prof. Harvey Millar (University of Western Australia) for his assistance with BN-PAGE and for useful discussions regarding the manuscript. This work was supported by grant to O.O.B. from the Israeli Science Foundation (ISF grant no. 980/11).