SEARCH

SEARCH BY CITATION

Keywords:

  • symphysis;
  • ramus;
  • mandible;
  • osteoblast;
  • bone tissue engineering

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

Objectives

Autografts from mandibular symphysis and ramus are often used for bone reconstruction. Based on this, we hypothesized that these sites could be useful cell sources for bone tissue engineering approaches. Thus, our study aimed at evaluating the proliferation and osteoblast phenotype development of cells derived from mandibular symphysis and ramus.

Materials and Methods

Cells were isolated from bone fragments of four patients by enzymatic digestion and cultured under osteogenic condition for up to 17 days. Cultures were assayed for cell proliferation, gene expression of key bone markers runt-related transcription factor 2 (Runx2), distal-less homeobox 5 (DLX5), SATB homeobox 2 (SATB2), Osterix (OSX), family with sequence similarity 20, member C (FAM20C), bone sialoprotein (BSP), osteopontin (OPN) and osteocalcin (OC), alkaline phosphatase (ALP) expression and activity, and extracellular matrix mineralization. Data were compared by two-way ANOVA or t-test for independent samples when appropriate.

Results

Cells derived from ramus displayed lower proliferative activity and higher gene expression of Runx2, DLX5, SATB2, OSX, FAM20C, BSP, OPN and OC, ALP protein expression and activity and extracellular matrix mineralization compared with symphysis-derived cells.

Conclusion

Symphysis and ramus may be considered as cell sources for bone tissue engineering approaches but due to the higher osteogenic potential, ramus-derived cells are more appealing for constructing cell-based biomaterials.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

Bone tissue engineering has been defined as the application of principles and techniques of the life sciences and the engineering that relays on the combination of cells, biomaterials and growth factors to repair bone tissue (Rosa et al, 2008). While all these three elements play important roles, the source of cells is recognized as a key factor to engineer bone (Colnot, 2011). Bone marrow cells are the most often used, but cells from several other tissues represent good alternatives (Colnot, 2011). From intraoral sites, periosteum and dental pulp either of deciduous or permanent teeth are source of cells that have been successfully used prior to the placement of dental implants (Ribeiro et al, 2010; Ito et al, 2011; Yamamoto et al, 2011). Besides, mandibular symphysis and ramus have been extensively and efficiently used as autografts for bone reconstruction. Such use is mainly due to their osteoconduction, osteoinduction and osteogenic capabilities, the later based on the cells embedded within the graft (Roccuzzo et al, 2004; Greenberg et al, 2012). Despite this, the potential of the cells harvested from these sites for bone tissue engineering purposes has not yet been explored. So, in this study we have carried out an in vitro evaluation of the proliferation and the osteoblast phenotype development of cells derived from mandibular symphysis and ramus cultured under osteogenic conditions. Our results show that ramus-derived cells displayed higher osteogenic potential compared to cells derived from symphysis, despite they share the same embryonic origin and intramembranous bone formation mechanism.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

Cell isolation and culture of osteoblastic cells

Bone fragments derived from symphysis and ramus of four healthy patients submitted to oral surgery were obtained after the written consent of each patient and using the research protocols approved by the Committee of Ethics in Research of the School of Dentistry of Ribeirao Preto, University of Sao Paulo. Osteoblastic cells were isolated from these fragments by enzymatic digestion using collagenase type II (Invitrogen, Carlsbad, CA, USA) and expanded in α-minimum essential medium (Invitrogen), supplemented with 10% foetal bovine serum (Invitrogen), 50 μg ml−1 gentamicin (Invitrogen), 0.3 μg ml−1 fungisone (Invitrogen), 10−7 M dexamethasone (Sigma-Aldrich, St Louis, MO, USA), 5 μg ml−1 ascorbic acid (Invitrogen) and 7 mM β-glycerophosphate (Sigma-Aldrich). First passage cells were cultured in 24-well culture plates (Falcon, Franklin Lakes, NJ, USA) at a cell density of 2 × 104 cells/well. During the culture period, cells were incubated at 37°C in a humidified atmosphere of 5% CO2 and 95% air; the medium was changed every 3 days.

Cell proliferation

Cell proliferation was evaluated at days 3, 7 and 10 by the 3-(4,5-dimethylthiazol-2-yl)- 2,5- diphenyl tetrazolium bromide (MTT) assay. Cells were incubated with 100 μl of MTT (5 mg ml−1) in PBS at 37°C for 4 h. Then, 1 ml of acid isopropanol (0.04 N HCl in isopropanol) was added to each well, after the medium aspiration. The plates were then agitated on a plate shaker for 5 min, and 150 μl of this solution was transferred to a 96-well format using opaque-walled transparent-bottomed plates (Fisher Scientific, Pittsburgh, PA, USA). The optical density was read at 570 nm on the plate reader (μQuant, Biotek, Winooski, VT, USA), and data were expressed as absorbance.

Gene expression of the key bone markers

Quantitative real-time PCR was carried out at day 10 to evaluate the gene expression of runt-related transcription factor 2 (Runx2), distal-less homeobox 5 (DLX5), SATB homeobox 2 (SATB2), Osterix (OSX), family with sequence similarity 20, member C (FAM20C), bone sialoprotein (BSP), osteopontin (OPN) and osteocalcin (OC). The total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer's instructions. The concentration and purity of RNA samples were determined by optical density at a wavelength of 260 and 260:280 nm, respectively and only samples presenting 260:280 ratios higher than 1.8 were analysed. Complementary DNA (cDNA) was synthesized using 2 μg of the RNA through a reverse transcription reaction (M–MLV reverse transcriptase, Promega Corporation, Madison, WI, USA). Real-time PCR was carried out in a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories Philadelphia, PA, USA) using SybrGreen PCR Master-Mix (Applied Biosystems, Warrington, UK), specific primers (Table 1) designed with Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) and 2.5 ng of cDNA. The relative gene expressions were normalized by β-actin expression and the real changes were expressed relative to the gene expression of symphysis-derived cells.

Table 1. Primer sequences and product sizes (bp) for Real-time PCR
GeneSense Anti-sensebp
  1. Runx2, runt-related transcription factor 2; DLX5, distal-less homeobox 5; SATB2, SATB homeobox 2; OSX, Osterix; FAM20C, family with sequence similarity 20, member C; BSP, bone sialoprotein; OPN, osteopontin; OC, osteocalcin.

Runx2

CACAAACAACCACAGAACCAC

TTGCTGTCCTCCTGGAGAAA

56
DLX5

CCTCGCTGGGATTGACACAA

GGGCATCTCCCCGTTTTTCA

92
SATB2

AGGAGAACACTGCAAAGCCA

ATAAAACGCACAGGGACTGCT

124
OSX

AGGTTCCCCCAGCTCTCTCCATC

TCCTCAAGCAGGGAGGACGCC

82
FAM20C

CCCATGAAACAAACGAGGGAG

AATCTCCGCATTGTGCCTCT

81
BSP

AATCTGTGCCACTCACTGCCTT

CCTCTATTTTGACTCTTCGATGCAA

157
OPN

AGGCATCACCTGTGCCATAC

TCTGGGTATTTGTTGTAAAGCTGC

81
OC

CAAAGGTGCAGCCTTTGTGTC

TCACAGTCCGGATTGAGCTCA

150
β-Actin

ATGTTTGAGACCTTCAACA

CACGTCAGACTTCATGATGG

495

Alkaline phosphatase activity

At days 10 and 14, the release of thymolphthalein from thymolphthalein monophosphate was determined to measure the alkaline phosphatase (ALP) activity using a commercial kit (Labtest Diagnostica SA, Belo Horizonte, MG, Brazil). A mixture of 50 μl of thymolphthalein monophosphate and 0.5 ml of 0.3 M diethanolamine buffer, pH 10.1 was kept for 2 min at 37°C. Then, 50 μl of the cell lysates obtained by five cycles of thermal shock (−20°C for 20 min and 37°C for 15 min) from each well was added and after 10 min at 37°C, 2 ml of a solution of Na2CO3 (0.09 mmol ml−1) and NaOH (0.25 mmol ml−1) were used to stop the reaction. The absorbance was measured at 590 nm using the plate reader μQuant (Biotek) and ALP activity was expressed as μmol thymolphthalein normalized by the total protein content at the respective time-point.

ALP protein expression

Immunofluorescence labelling

At 10 days, cells cultured on thermanox were fixed using 4% paraformaldehyde in 0.1 M sodium phosphate buffer (PB), pH 7.2 and processed for immunofluorescence labelling as previously described (De Oliveira et al, 2007). Briefly, samples were permeabilized with 0.5% Triton X-100 in PB for 10 min, followed by blocking with 5% skimmed milk in PB for 30 min. Primary antibody to human bone ALP (monoclonal B4-78, 1:100; Developmental Studies Hybridoma Bank – DSHB, Iowa City, IA, USA) was used, followed by Alexa Fluor 594 (red fluorescence)-conjugated goat anti-mouse secondary antibody (1:200; Invitrogen, Eugene, OR, USA). Alexa Fluor 488 (green fluorescence)-conjugated phalloidin (1:200; Invitrogen) was used to label actin cytoskeleton. Before mounting for microscope observation, cell nuclei were stained with 300 nM 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 5 min. The samples were examined under epifluorescence using an Axio Imager microscope (Zeiss, TU, Germany).

Western blot

At 14 days, cells were lysed in 500 μl of lysis buffer containing 1X protease inhibitor mixture (Roche Applied Science, Indianapolis, IN, USA), and 25 μM MG132 proteasome inhibitor (Roche Applied Science) and boiled for 5 min. Equal amount of total protein (30 μg) for each sample was subjected to electrophoresis in a denaturing 8.5% polyacrylamide gel and transferred to a Hybond C-Extra membrane (GE Healthcare Life Science, Piscataway, NJ, USA) using a semidry transfer apparatus (Bio-Rad Laboratories). Membrane was blocked for 1 h in Tris-buffered saline, 0.1% Tween 20 (TBS-T, Sigma-Aldrich) containing 5% non-fat powdered milk (Bio-Rad Laboratories). ALP protein was detected by incubating the membrane with rabbit polyclonal anti-ALP antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) followed by goat anti-rabbit IgG HRP secondary antibody (Santa Cruz Biotechnology). Both primary and secondary antibodies were diluted 1:2000 in TBS-T containing 2.5% non-fat powdered milk (Bio-Rad Laboratories). Mouse monoclonal anti-α-tubulin (1:8000, Sigma-Aldrich) was used as a control followed by goat anti-mouse IgG HRP secondary antibody (1:2000, Santa Cruz Biotechnology). Secondary antibodies were detected using western lightning chemiluminescence reagent (Perkin Elmer Life Sciences, Waltham, MA, USA) and the images were acquired using G-Box gel imaging (Syngene, Cambridge, UK). The ALP was quantified by counting pixels and normalized by α-tubulin.

Extracellular matrix mineralization

At 17 days, cells were fixed in 10% formalin for 2 h at room temperature, dehydrated and stained with 2% Alizarin Red S (Sigma-Aldrich), pH 4.2, for 10 min. The calcium content was detected using a colorimetric method. Succinctly, 280 μl of 10% acetic acid was added to each well and the plate was incubated at room temperature for 30 min under shaking. This solution was vortexed for 1 min, the slurry was overlaid with 100 μl of mineral oil (Sigma-Aldrich), heated to 85°C for 10 min, and transferred to ice for 5 min. The slurry was centrifuged at 20 000 g for 15 min and 150 μl of the supernatant was mixed with 60 μl of 10% ammonium hydroxide and this solution was spectrophotometrically read at 405 nm in the plate reader μQuant (Biotek) and the data were expressed as absorbance.

Statistical analysis

In order to preclude the influence of variability common to primary cultures, the comparisons between symphysis and ramus were donor-matched and the results presented here are representative of four sets of experiments conducted with cells from four different patients. All evaluations were carried out in quintuplicates with exception of the gene expression that was carried out in quadruplicates. Cell proliferation and ALP activity were analysed by two-way ANOVA followed by Tukey-b test when appropriate. Extracellular matrix mineralization and gene expression were compared by t-test for independent samples. For all tests, differences at  0.05 were considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

Cell proliferation was affected by cell source (= 0.012), time (= 0.001) and the interaction cell source/time (= 0.001; Figure 1). Cells derived from symphysis exhibited higher proliferative activity compared with ramus-derived cells. The culture growth peaked at day 7 for cells from both origins. Gene expression of Runx2 (= 0.0001), DLX5 (= 0.0001), SATB2 (= 0.0001), OSX (= 0.0001), FAM20C (= 0.0001), BSP (= 0.0001), OPN (= 0.0001) and OC (= 0.001) was higher in ramus-derived cells compared with cells derived from symphysis (Figure 2). ALP activity was affected by cell source (= 0.001), time (= 0.008) and the interaction cell source/time (= 0.001; Figure 3a). Cells derived from ramus displayed higher ALP activity than symphysis-derived cells. ALP protein was observed in both cultures, being higher in ramus-derived cells than in cells from symphysis as detected by immunofluorescence labelling at day 10 (Figure 3b) and Western blot at day 14 (Figure 3c). Extracellular matrix mineralization evaluated at day 17 was higher (= 0.001) in cultures derived from ramus compared with that one's derived from symphysis (Figure 4).

image

Figure 1. Proliferation at days 3, 7 and 10 of cells derived from mandibular symphysis and ramus. Bars with the same letter are not significantly different (> 0.05)

Download figure to PowerPoint

image

Figure 2. Relative gene expression at day 10 of runt-related transcription factor 2 (Runx2), distal-less homeobox 5 (DLX5), SATB homeobox 2 (SATB2), Osterix (OSX), family with sequence similarity 20, member C (FAM20C), bone sialoprotein (BSP), osteopontin (OPN) and osteocalcin (OC). Bars with the same letter are not significantly different (> 0.05)

Download figure to PowerPoint

image

Figure 3. Alkaline phosphatase (ALP) activity at days 10 and 14 (a) and ALP protein detection by immunofluorescence labelling at day 10 (b) and by Western blot at day 14 (c). Bars with the same letter are not significantly different (> 0.05, A). Scale bar for B = 200 μm

Download figure to PowerPoint

image

Figure 4. Extracellular matrix mineralization at day 17 (showed above the bars) of cells derived from mandibular symphysis and ramus. Bars with distinct letters are significantly different ( 0.05)

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

Mandibular symphysis and ramus have been successfully used as bone graft donor sites. The symphysis offers the greatest volume of bone but is associated with a higher incidence of postoperative complications compared with ramus (Misch, 1997, 2011). Thus, mandibular ramus has become the preferred donor site of many clinicians (Misch, 2011). However, from a clinical point of view, both sites display similar results in terms of bone augmentation prior to dental implant placement (Greenberg et al, 2012). Based on that, we hypothesized that the cells derived from these sites could be considered for bone tissue engineering approaches. In this context, our study was designed to compare the osteogenic potential of the cells derived from mandibular symphysis and ramus. The results indicate that the ramus-derived cells exhibit a more pronounced osteoblast phenotype during the culture progression as evidenced by lower cell proliferation and higher gene expression of key bone markers as well as higher ALP protein expression and activity, and extracellular matrix mineralization.

The production of a cell-based construct to be used in bone tissue engineering depends on the ability of cells to proliferate and consequently to colonize the scaffold surface (Beloti et al, 2012). Based on our results, cells derived from both sites are able to grow with symphysis-derived cells exhibiting a higher proliferation rate. The time-course progression of osteoblast differentiation is characterized by fluctuations on the expression of specific bone markers such as Runx2, OPN and OC (Stein and Lian, 1993). Here, we evaluated a panel of genes encoding key transcription factors and non-collagenous matrix proteins involved in osteoblast differentiation and extracellular matrix mineralization. All of them were upregulated in cells derived from ramus compared with that one's derived from symphysis.

To confirm the osteoblast differentiation progression at the protein level, we analysed both expression and activity of ALP, an enzyme that plays a primary role in the mineralization phenomenon (Beck et al, 1998). A typical peak of ALP activity at day 10 as well as higher protein expression was noticed for cultures derived from ramus as described elsewhere (De Oliveira et al, 2007), while symphysis-derived cells exhibited a lower ALP activity at 10 and 14 days. Additionally, ramus-derived cells exhibited more extracellular matrix mineralization compared with cells from symphysis. Taken together, our results confirm the well-known inverse correlation between cell proliferation and differentiation, as cells derived from ramus presented lower proliferation rate and higher expression of the osteoblast phenotype development (Rosa et al, 2009).

Considering that both cell sources mandibular symphysis and ramus share the same embryologic origin, that is, neural crest, and intramembranous ossification (Chai et al, 2000; Helms and Schneider, 2003; Jaskoll et al, 2008), the differences in terms of osteoblast phenotype development we observed here cannot be attributed to these site features. Also, as this study was carried out under carefully controlled culture conditions, such as donor-matched comparisons, the use of foetal bovine serum from the same batch and the same cell density at the beginning of the cultures, methodological influences on the results were ruled out. An apparent explanation for the observed distinct osteogenic potential could be due to the different mechanical stress that mandibular symphysis and ramus are exposed. Indeed, agreeing with our suggestion, it has been shown that in vitro osteoblast activity is modulated by mechanical forces (Yanagisawa et al, 2007; Yamamoto et al, 2011; Zhang et al, 2012).

In conclusion, our results have shown that cells derived from mandibular symphysis and ramus are able to proliferate and to express the osteoblast phenotype. Therefore, additionally to bone graft donor sites, symphysis and ramus may be considered as cell sources to engineer bone tissue for oral and maxillofacial surgery applications such as maxillary sinus floor elevation and bone defects reconstruction. As a final point, the higher osteogenic potential makes ramus-derived cells the first choice for constructing cell-based biomaterials.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

The authors would like to thank FAPESP and CNPq for financial support. Fabiola S. de Oliveira and Roger R. Fernandes are acknowledged for technical assistance during the experiments.

Author contributions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References

EP Ferraz and SP Xavier: designed the study, performed the experiments, analysed the data and approved the final version of the paper. PT de Oliveira: designed the study, analysed the data and approved the final version of the paper. MM Beloti and AL Rosa: designed the study, analysed the data, drafted the paper and approved the final version of the paper.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author contributions
  9. References