SEARCH

SEARCH BY CITATION

Keywords:

  • Apple latent spherical virus vector;
  • early flowering;
  • apple seedling;
  • reduction in generation time;
  • new breeding technique

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Fruit trees have a long juvenile phase. For example, the juvenile phase of apple (Malus × domestica) generally lasts for 5–12 years and is a serious constraint for genetic analysis and for creating new apple cultivars through cross-breeding. If modification of the genes involved in the transition from the juvenile phase to the adult phase can enable apple to complete its life cycle within 1 year, as seen in herbaceous plants, a significant enhancement in apple breeding will be realized. Here, we report a novel technology that simultaneously promotes expression of Arabidopsis FLOWERING LOCUS T gene (AtFT) and silencing of apple TERMINAL FLOWER 1 gene (MdTFL1-1) using an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) to accelerate flowering time and life cycle in apple seedlings. When apple cotyledons were inoculated with ALSV-AtFT/MdTFL1 immediately after germination, more than 90% of infected seedlings started flowering within 1.5–3 months, and almost all early-flowering seedlings continuously produced flower buds on the lateral and axillary shoots. Cross-pollination between early-flowering apple plants produced fruits with seeds, indicating that ALSV-AtFT/MdTFL1 inoculation successfully reduced the time required for completion of the apple life cycle to 1 year or less. Apple latent spherical virus was not transmitted via seeds to successive progenies in most cases, and thus, this method will serve as a new breeding technique that does not pass genetic modification to the next generation.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

The life cycle of plants is divided into several phases. The vegetative phase, which comprises the juvenile and adult vegetative phases, starts after germination. Plants in the juvenile phase are not competent to flower even under inductive conditions, while those in the adult vegetative phase can produce flowers in response to floral inductive signals under the appropriate conditions. Plants acquire reproductive competence during the adult vegetative phase and enter the adult phase (Bäurle and Dean, 2006; Huijser and Schmid, 2011; Mimida et al., 2009).

Apple (Malus × domestica) has a long juvenile phase (approximately 5–12 years) that is a constraint for genetic analysis and the creation of new apple cultivars through cross-breeding (Crosby et al., 1992, 1994). Both genetic and environmental factors are known to influence the duration of the juvenile phase in apple. Although several agrotechnical approaches, such as grafting juvenile twigs onto mature rootstocks, have been used to accelerate the phase transition in apple breeding, a period of at least a few years is still required for apple seedlings to produce flowers (Fischer, 1994; Flachowsky et al., 2009).

Arabidopsis thaliana is an annual plant, and its transition from the vegetative phase to the adult phase has been well studied. Four signalling pathways (gibberellin, autonomous, vernalization and light-dependent pathways) determine the initiation of phase transition, and a protein encoded by the FLOWERING LOCUS T (AtFT) gene, namely FT protein of the phosphatidylethanolamine-binding protein (PEBP) family, serves as a signal integrator. Pivotal roles of FT-like proteins in floral induction have been demonstrated in various plant species including woody plants (Abe et al., 2005; Corbesier et al., 2007; Hecht et al., 2011; Imamura et al., 2011; Kong et al., 2010; Lv et al., 2012; Notaguchi et al., 2008; Tamaki et al., 2007; Tränkner et al., 2010), while a different PEBP family protein encoded by Arabidopsis TERMINAL FLOWER 1 (TFL1) gene was shown to control vegetative meristem identity and to suppress floral induction (Bradlley et al., 1997; Ratcliffe et al., 1998, 1999).

Homologues of such genes, namely MdFT1 and MdFT2 (orthologues of AtFT) and MdTFL1-1 and MdTFL1-2 (orthologues of TFL1) (Esumi et al., 2005; Kotoda and Wada, 2005; Kotoda et al., 2010; Mimida et al., 2009), were discovered in apple, and up-regulation of MdFT genes and down-regulation of MdTFL1 genes during flower formation in apple have been reported (Hättach et al., 2008; Mimida et al., 2011).

It would be of great significance in apple breeding if the genes involved in the transition from the juvenile phase to the adult phase can be modified with the aim of floral induction (Flachowsky et al., 2011). Several studies have demonstrated that modification of the genes involved in floral induction by a transformation approach successfully shortens the juvenile period. For example, overexpression of AtFT-homologous genes accelerates flowering time in apple, plum, poplar, citrus and pear (Böhlenius et al., 2006; Endo et al., 2005; Hsu et al., 2006; Matsuda et al., 2009; Srinivasan et al., 2012; Tränkner et al., 2010; Zhang et al., 2010), while repression of TFL1-like genes has a similar effect in apple and pear (Flachowsky et al., 2012; Freiman et al., 2012; Kotoda et al., 2006).

Other useful floral induction approaches include plant virus vector-based methods, such as those that promote expression of endogenous genes, and virus-induced gene silencing (VIGS). Plant virus vector system can be used to add new traits to plants without altering the host genome (Gleba et al., 2004; Purkayastha and Dasgupta, 2009). We previously reported that approximately 30% of apple seedlings inoculated with an Apple latent spherical virus (ALSV) vector containing the AtFT produced flowers 1.5–2 months after inoculation (7–9 leaf stage) (Yamagishi et al., 2011) and that approximately 10% of apple seedlings produced early flowers when MdTFL1-1 was silenced by VIGS using an ALSV vector (Sasaki et al., 2011). In this study, we simultaneously expressed AtFT and silenced MdTFL1-1 in apple through an ALSV vector-based approach. We found that more than 90% of apple seedlings started flowering 1.5–3 months after inoculation with this ALSV vector and that almost all early-flowering seedlings continuously produced flower buds on the lateral and axillary shoots. In addition, cross-pollination between early-flowering apple plants produced seed-bearing fruit, indicating that our approach can shorten the protracted life cycle (sometimes longer than 10 years) of apple to 1 year or less. To the best of our knowledge, this study is the first to demonstrate successful shortening of the life cycle in apple to 1 year or less without genome modification. We also examined seed transmission of ALSV and confirmed the absence of ALSV in most progenies. Thus, despite utilization of a genetically modified virus, our technique does not pass genetic modification to the next generation and will serve as a new plant-breeding technique. Moreover, our technique can be expected to significantly reduce the breeding time in both apple and other fruit-producing plants and crops.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Expression of FT genes derived from various plant species by means of an ALSV vector and the inductive effect on flowering

We previously showed that inoculation of apple cotyledons with an ALSV vector bearing AtFT (ALSV-AtFT) immediately after germination resulted in the formation of flower buds and early flowering in approximately 30% of infected seedlings (Yamagishi et al., 2011). Here, we tested 18 orthologues of FT found in the genomes of the following 13 plant species: Arabidopsis thaliana, satsuma (Citrus unshiu), cucumber (Cucumis sativus), pumpkin (Cucurbita moschata), soybean (Glycine max), Japanese gentian (Gentiana triflora), white edge morning-glory (Ipomoea nil), tomato (Solanum lycopersicum), apple (Malus x domestica), Japanese apricot (Prunus mume), pea (Pisum sativum), poplar (Populus tremula) and grapevine (Vitis vinifera). Briefly, we constructed ALSV vectors bearing an FT orthologue from the above species by inserting each orthologue into the XSB site of the ALSV vector (Figure 1), and we inoculated apple seedlings with each construct to examine its inductive effect on flowering. All tested FT orthologues accelerated flowering when expressed in A. thaliana, albeit to different extents (Table S1 and Figure S1). When expressed in tobacco plants, constructs were classified into four groups according to the extent of flowering induction (high, moderate, low and none) (Table S1 and Figure S1). On the other hand, only four orthologues, namely, AtFT, A. thaliana TWIN SISTER OF FT (AtTSF), G. max (GmFT2a) and G. triflora orthologue (GtFT1) orthologue, accelerated flowering when expressed in apple (Table 1). Flowering of apple seedlings infected with an ALSV vector bearing AtTSF (ALSV-AtTSF) and GtFT1 (ALSV-GtFT1) were shown in Figure 2a,b. Expression of other orthologues, including apple FT-like genes (MdFT1 and MdFT2) did not show floral induction (Table 1). Inoculation with ALSV-AtTSF or ALSV-AtFT yielded a flowering rate (number of seedlings with flowers/number of infected specimens) of approximately 30%, while inoculation with an ALSV vector bearing GmFT2a (ALSV-GmFT2a) or ALSV-GtFT1 yielded a flowering rate of approximately 10% (Table 1). Seedlings inoculated with ALSV-AtTSF, ALSV-GmFT2a or ALSV-GtFT1 (Figure 2b,c) developed only one terminal flower at the 7–9 leaf stage before entering the vegetative growth stage. Flowering-associated characteristics in these seedlings were similar to those in ALSV-AtFT-infected early-flowering seedlings (Table 2).

Table 1. Promotion of flowering in apple seedlings infected with Apple latent spherical virus (ALSV) vectors expressing a FT orthologue from various plants
Plant speciesFT orthologueAccession No.ALSV vectorFlowering rate (%)
  1. a

    Figures in parenthesis indicate number of flowered plants/Number of infected plants.

  2. b

    Effect of a wild-type (wt)ALSV vector with no FT gene.

Arabidopsis thaliana AtFT AF152096 ALSV-AtFT29.3 (17/58)a
A. thaliana AtTSF NM118156 ALSV-AtTSF30.8 (8/26)
Citrus unshiu CiFT AB027456 ALSV-CiFT0 (0/28)
Cucumis sativus CsFT AB383152 ALSV-CsFT0 (0/9)
C. moschata ComFT2 EF462212 ALSV-ComFT20 (0/9)
Glycine max GmFT2a AB550122 ALSV-GmFT2a10 (1/10)
G. max GmFT5a AB550126 ALSV-GmFT5a0 (0/8)
Gentiana triflora GtFT1 AB605176 ALSV-GtFT17.7 (1/13)
G. triflora GtFT2 AB605177 ALSV-GtFT20 (0/7)
Ipomoea nil InFT1 EU178859 ALSV-InFT10 (0/11)
I. nil InFT2 EU178860 ALSV-InFT20 (0/5)
Solanum lycopersicum LeFT AY186735 ALSV-LeFT0 (0/11)
Malus x domestica MdFT1 AB161112 ALSV-MdFT10 (0/31)
Malus x domestica MdFT2 AB458504 ALSV-MdFT20 (0/11)
Prunus mume PmFT AM943979 ALSV-PmFT0 (0/8)
Pisum sativum PsFTa1 HQ538822 ALSV-PsFTa10 (0/9)
P. sativum PsFTc HQ538826 ALSV-PsFTc0 (0/7)
Populus tremula PtFT1 DQ387859 ALSV-PtFT10 (0/10)
Vitis vinifera VvFT EF157728 ALSV-VvFT0 (0/9)
bNonewtALSV0 (0/50)
Table 2. Comparison of flowering aspects in apple seedlings infected with ALSV-AtFT, ALSV-MdTFL1 or ALSV-AtFT/MdTFL1
ALSV vectorExpression geneSuppression geneFlowering rate (%)Leaf stage of first floweringNo. of flowersGrowth after first flowering
  1. a

    Data from Yamagishi et al. (2011).

  2. b

    Data from Sasaki et al. (2011).

ALSV-AtFTa AtFT 307–91Vegetative
ALSV-MdTFL1b MdTFL1-1 108–14MultipleContinuous flowering
ALSV-AtFT/MdTFL1 AtFT MdTFL1-1 >907–22MultipleContinuous flowering
image

Figure 1. Schematic of the ALSV-RNA1 vector (pEALSR1-3′SM) with a cloning site (SalI-MluI) at the 3′ terminus and the ALSV-RNA2 vector (pEALSR2mL5mR5) with cloning sites (XhoI-SmaI-BamHI) between MP and Vp25. P35S, enhanced CaMV 35S promoter; Tnos, nopaline synthase terminator; HEL, NTP-binding helicase; C-PRO, cysteine protease; POL, RNA polymerase; MP, 42K movement protein; Vp25, Vp20, and Vp24, capsid proteins; Q/G, protease cleavage site.

Download figure to PowerPoint

image

Figure 2. Promotion of flowering in apple seedlings infected with ALSV-AtTSF (a), ALSV-GtFT1 (b and c) and ALSV-AtFT/MdTFL1 (d, e and f, respectively) (b) and (c) show the same apple seedling on different days postinoculation. Yellow arrowheads in (b) and (c) indicate the same position of flowering. Apple seedlings infected with ALSV-AtTSF, or ALSV-GtFT1 usually developed only one flower, followed by vegetative growth of shoots, as shown in (c). Circles in (f) show continuous flowering in an apple seedling infected with ALSV-AtFT/MdTFL1.

Download figure to PowerPoint

Simultaneous expression of AtFT and silencing of MdTFL1 efficiently accelerated flowering in apple

Only limited types of FT orthologues accelerated flowering with low efficiency (10%–30%) when expressed in apple seedlings. We previously reported that silencing of MdTFL1-1 by the ALSV-based method introduced early- and perpetual-flowering traits to apple seedlings, albeit with low efficiency (Sasaki et al., 2011). In this study, we constructed an ALSV vector to expresses the AtFT gene as well as to silence endogenous MdTFL1-1 in apple. Briefly, the ALSV-RNA1 vector bearing a partial sequence of MdTFL1-1 (201-nt) in the 3′ untranslated region (SM site immediately downstream of the end of open reading frame) and the RNA2 vector bearing the full length of AtFT in the XSB site were combined (Figure 1). When the resulting ALSV-AtFT/MdTFL1 were used for inoculation of seedlings immediately after germination, more than 90% of infected seedlings developed their first flower at the 7–22 leaf stage (1.5–3 months after inoculation), and most continued flowering (Table 2 and Figure 2d–f). Real-time polymerase chain reaction (PCR) analysis revealed that the expression of MdTFL1 mRNA in the tip of the stems in ALSV-AtFT/MdTFL1-infected seedlings approximately 2 weeks after inoculation was approximately 25% that of seedlings without inoculation (Figure 3). Floral organs, such as petals, sepals and stamens, were morphologically normal in most of the early-flowering apple seedlings, but an increase in the number of petals and a lack of pistils were occasionally observed (data not shown).

image

Figure 3. Relative quantification of MdTFL1-1 mRNA levels by quantitative real-time RT-PCR analysis in apple seedlings infected with ALSV-AtFT/MdTFL1. The mRNA of Mdrbc S was used as a control.

Download figure to PowerPoint

Following the findings that the simultaneous alteration of expression of two genes, more precisely, the expression of AtFT and silencing of MdTFL1-1, drastically accelerated flowering in apple seedlings, we examined whether apple FT orthologue genes (MdFT1 and MdFT2) and MdTFL1-2, a MdTFL1-1 homologue, were useful in a similar strategy. When MdTFL1-2 was silenced simultaneously with the expression of AtFT, flowering was accelerated in only 1 of 7 infected seedlings (Table 3). Simultaneous silencing of MdTFL1-1 and expression of an apple FT orthologue gene (MdFT1 or MdFT2) did not accelerate flowering in any of the infected seedlings (Table 3).

Table 3. Effect of Apple latent spherical virus (ALSV) vectors expressing FT and suppressing TFL on the promotion of flowering in apple seedlings
ALSV vectorExpression geneSuppression geneFlowering rate (%)
  1. a

    Figures in parenthesis indicate No. of flowered plants/No. of infected plants.

ALSV-AtFT/MdTFL1 AtFT MdTFL1-1 90.6 (29/32)a
ALSV-AtFT/MdTFL2 AtFT MdTFL1-2 14.2 (1/7)
ALSV-MdFT/MdTFL1 MdFT1 MdTFL1-1 0 (0/11)
ALSV-MdFT/MdTFL1 MdFT2 MdTFL1-1 0 (0/9)

ALSV-AtFT/MdTFL1-infected apple seedlings with an early-flowering trait repeated the cycle of flowering and lateral branch extension

As shown earlier (Table 2 and Figure 2b,c) as well as in the previous study (Yamagishi et al., 2011), early-flowering seedlings infected with ALSV-AtFT, ALSV-AtTSF, ALSV-GmFT2a or ALSV-GtFT1 produced one terminal flower at the 7–9 leaf stage, followed by the growth of lateral shoots, but not by the formation of additional flower buds in most cases. On the other hand, many apple seedlings inoculated with ALSV-AtFT/MdTFL1 showed perpetual-flowering traits and repeated the cycle of flowering and lateral branch extension over a 7-month period (Figure 4). Specifically, after the first terminal flower bud completed the flowering process, lateral shoots started growing until the formation of a new terminal bud: this cycle was repeated in ALSV-AtFT/MdTFL1-infected apple seedlings. Marked growth impairment due to rapid flower formation on an axillary shoot, and/or before the completion of lateral shoot extension, was observed in approximately 20% of the infected seedlings (data not shown), and the remaining 80% (25/32) of infected seedling showed the continuous flowering phenotype.

image

Figure 4. Continuous flowering in an apple seedling infected with ALSV-AtFT/MdTFL1 at (a) 1.5 months postinoculation (mpi), (b) 3 mpi and (c) 7 mpi. Arrows in (c) show continuous flowering, even after 7 mpi.

Download figure to PowerPoint

Upper leaves of ALSV-AtFT/MdTFL1-infected apple seedlings with an early-flowering trait were harvested 6 months after inoculation to test for the presence of the AtFT gene and the exogenous MdTFL1-1 fragment introduced by the ALSV vector. The AtFT gene was maintained in approximately 60% of tested seedlings and absent in the remaining seedlings (Figure S2). On the other hand, the MdTFL1-1 fragment of ALSV-AtFT/MdTFL1 origin was confirmed in all seedlings tested (Figure S2). Seedlings wherein AtFT was not maintained showed gradual termination of new flower formation and exhibited continuous vegetative growth of branches (Figure S2).

ALSV-based floral induction technique successfully shortened the apple life cycle to 1 year or less

ALSV-AtFT-infected seedlings produced a single flower once at the 7–9 leaf stage and were unable to produce a seed-bearing fruit due to insufficient size (Yamagishi et al., 2011). On the other hand, ALSV-AtFT/MdTFL1-infected apple seedlings repeated the cycle of flowering and vegetative growth over a period of at least 6 months (Table 2 and Figures 4 and 5). Artificial pollination between these early-flowering apple seedlings resulted in the development and subsequent maturation of fruits (Figure 5a,b). These fruits ripened approximately 5 months after pollination and produced morphologically normal seeds (Figure 5c,d), indicating that ALSV-AtFT/MdTFL1-infected apple seedlings produced flowers with fertile pistils and pollens. After low-temperature treatment at 4 °C, all 9 seeds shown in Figure 5c germinated (Figure 5e).

image

Figure 5. Fruit production in apple seedlings infected with ALSV-AtFT/MdTFL1. Pollination was conducted between early-flowering apple seedlings. (a) Fruit produced on the apple seedling (9 mpi) 5 months after pollination. (b) Seedling (11 mpi) with four fruits 5 months after pollination. (c and d) Ripe fruits on apple seedlings (a) and (b) with viable seeds, respectively. (e) Seedlings germinated from seeds in (c) after low-temperature treatment for 3 months.

Download figure to PowerPoint

Taken together, these results provide evidence for possible harvesting of seeds within 8–10 months by inoculating apple cotyledons with ALSV-AtFT/MdTFL1 immediately after germination. In other words, with the ALSV-AtFT/MdTFL1-utilizing technique, apple can complete one life cycle (from the seed of the first generation to the production of seeds of the successive generation) within 1 year.

Life cycle acceleration by means of a virus vector serves as a new breeding technique with no transmission of genetic modification to successive progenies.

Plant RNA virus genomes are generally not integrated into host genomes, but some plant viruses are seed-transmitted. For example, we previously reported a seed transmission rate of a few per cent in ALSV-infected apple seedlings (‘Indo’ variety) based on the results of enzyme-linked immunosorbent assay (ELISA) and reverse transcription (RT)-PCR (Nakamura et al., 2011). In this study, we employed a more sensitive approach, real-time quantitative RT-PCR (qRT-PCR), to test for the presence of ALSV in seed embryos (cotyledons before germination) produced by ALSV-infected apple plants (‘Indo’ and ‘Golden delicious’ varieties), in cotyledons (after germination) and in true leaves grown from these seeds. The detection limit of qPCR was 500 attogram of the template per reaction, and thus, its sensitivity was 10 000–100 000-fold higher than that of ELISA and RT-PCR. When seed embryos were tested to determine levels of ALSV, 2% (2/100) of ‘Indo’ samples, as well as the positive control (ALSV-infected leaves), showed strong positive signals at around 15 cycles, indicating the high content of ALSV. On the other hand, the remaining ‘Indo’ samples and all of the 115 ‘Golden delicious’ samples showed weaker signals at around 25–35 cycles, indicating a low content of ALSV (Figure 6b). When cotyledons collected 3 weeks after germination and the third true leaves from the next-generation seedlings were tested, a high ALSV-RNA content was detected in 2.3% (2/87) of ‘Indo’ samples, but not in any of the 137 ‘Golden delicious’ samples (Figure 6c,d). In clear contrast to the results of seed embryo qRT-PCR, weak signals at 25–35 cycles, indicative of very low ALSV-RNA content, were absent in all samples harvested from seedlings 3 weeks after germination (Figure 6c,d). Thus, a trace amount of noninfectious virus RNA is likely to account for the weak positive signals detected in a small proportion of seed embryo samples. Further, when samples collected 2 months after germination were tested by ELISA, the detection rate was 0.98% (2/205) in ‘Indo’ seedlings and 0% (0/176) in ‘Golden delicious’ seedlings. The results of qPCR of samples collected from the corresponding seedlings 4 months after germination showed no discrepancy with the ELISA results. Thus, seed transmission of ALSV appears to have occurred at a low rate (a few per cent) in ‘Indo’ apple, but not in ‘Golden delicious’ apple. Apple latent spherical virus transmitted by seeds was already detectable in the seed embryo before germination, enabling definitive diagnosis of ALSV infection at an early stage. Taken together, ALSV was absent in most of the progenies of infected maternal plants. In other words, the genetic makeup was generally intact in the successive generation of ALSV-infected plants—the products of the present breeding technique.

image

Figure 6. Detection by quantitative real-time RT-PCR analysis of ALSV-RNA1 from apple seeds (cotyledons) before germination (a and b), from uninfected (a) and ALSV-infected (b) trees, from cotyledons (c), and from the third true leaves (d) of apple seedlings of ALSV-infected trees three weeks after germination. Samples in (a) from ‘Ourin’, and samples in (b), (c) and (d) from ‘Indo’ and ‘Golden delicious (GD)’. PC, positive control (samples from infected leaves); S, Examples of 20 samples of seeds and seedlings; Ct, cycle threshold; ▵Rn, fluorescent signal of amplified by PCR.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Perennial trees require a long juvenile phase before producing flowers. The juvenile period is 5–12 years in apple and is a serious constraint for apple breeding. We previously showed that approximately 30% of seedlings inoculated with ALSV-AtFT started flowering roughly 1.5 months after inoculation (Yamagishi et al., 2011). In this study, we first tested whether 18 FT orthologues found in various plant species, as well as AtFT, accelerate flowering by expressing each construct in apple seedlings by means of an ALSV vector. AtFT and AtTSF induced flowering more potently than other FT orthologues, including apple orthologues of FT (MdFT1 and MdFT2). In addition, early flowering was observed in only approximately 30% of apple seedlings expressing AtFT and AtTSF. Thus, we concluded that the low rate of early flowering cannot be improved solely by expression of an FT gene (Table 1).

Following these findings, we constructed a modified ALSV vector (ALSV-AtFT/MdTFL1) that expresses AtFT while silencing MdTFL1-1, and we examined its inductive effect on flowering. The first flower was observed in more than 90% of infected seedlings at 1.5–3 months after inoculation with ALSV-AtFT/MdTFL1 (Table 2 and Figure 2), and this induction was likely attributed to the increased translation of AtFT combined with VIGS of MdTFL1-1 as a result of the proliferation of ALSV-AtFT/MdTFL1 in the stem tips of infected seedlings (Figure 3) (Yamagishi et al., 2011). Hättach et al. (2008) examined the changes in gene expression in the apple stem apex upon transition from vegetative to reproductive growth states and found increases in MdFT expression and decreases in MdTFL1-1 expression during the formation of flower buds. Similarly, Mimida et al. (2011) examined shoot apical meristems by in situ hybridization and found increases in MdFT expression and decreases in MdTFL1-1/-2 expression in the stem apex during the phase transition. It is likely that similar changes were induced in the stem apex in apple seedlings infected with ALSV-AtFT/MdTFL1. In other words, ALSV-AtFT/MdTFL1 induces changes in gene expression in the stem apex of seedlings a few months after germination, and such changes—which normally occur in the meristem of mature trees—accelerate flowering.

In contrast, the same strategy did not work with apple FT orthologues (MdFT1 and MdFT2) (Table 3). An alignment of FT amino acid sequences showed that the functional domain and the amino acids important for AtFT function were conserved in MdFT1 and MdFT2 (Figure S3). Probably, MdFT1 and/or MdFT2 need to be supplemented by other genetic factors. Indeed, among the 18 FT genes tested, MdFT1 induced flowering more weakly than other FT orthologues in both A. thaliana and tobacco plants. It would be intriguing to know which genetic factors control flowering in apples.

ALSV-AtFT/MdTFL1 introduced an early-flowering trait into a much larger proportion of apple seedlings while also introducing a perpetual-flowering trait (Figure 2F and Figure 4b,c). The perpetual-flowering trait was observed in pear when PcTFL1-1 (TFL1-1 orthologue) and PcTFL1-2 (TFL1-2 orthologue) were silenced by a transformation approach (Freiman et al., 2012) and also in plum transformed with poplar FT1 (Srinivasan et al., 2012). It is likely that ALSV-AtFT/MdTFL1 creates conditions that induce perpetual flowering in the stem apex through a mechanism involving both AtFT expression and MdTFL1 repression. It is noteworthy that AtFT was not maintained in approximately 40% of infected seedlings 6 months after inoculation with ALSV-AtFT/MdTFL1 and that the repetitive cycle of flowering and vegetative growth, characteristic of ALSV-AtFT/MdTFL1-infected seedlings, was gradually replaced by continuous vegetative growth in infected seedlings (Figure S2). This suggests that the balance between AtFT expression and MdTFL1 repression is important for floral differentiation from the shoot apical meristem, an early-flowering trait is transient, and the transition to the reproductive phase is incomplete in ALSV-AtFT/MdTFL1-infected seedlings. Recently, involvement of micro RNA (miRNA) in phase transition was reported in both annual and perennial plants (Huijser and Schmid, 2011; Wang et al., 2011). Future advances in apple miRNA research may lead to development of a new technique that enables the induction of phase transition.

ALSV-AtFT/MdTFL1-infected seedlings kept producing early flowers while growing for at least 6 months, and thus, successfully produced fruits (Figure 5). Although regulation of genes related to flower bud formation through transformation was shown to accelerate breeding of fruit trees within a 1-year cycle (Flachowsky et al., 2009, 2011; Freiman et al., 2012; Le Roux et al., 2012), the present study is to the best of our knowledge the first to demonstrate a technique that enables harvesting of seeds for the next-generation progenies within 1 year without genome modification. At present, ALSV vector techniques could be effectively applied to only cotyledons from seedlings, not to apple varieties of well-known genotype. However, this method is very useful for promotion of a breeding cycle that starts with apple seeds.

The present study also showed that the rate of seed transmission of ALSV is extremely low and that the transmission can be diagnosed in a definitive manner. We previously reported that ALSV had not spread from the infected apple trees to the neighbouring apple trees as the virus was first detected in 1984, indicating that there is no vector(s) for transmission of ALSV in the orchard tested and that horizontal transmission of ALSV via pollen has not occurred among these apple trees (Nakamura et al., 2010). Thus, ALSV vector is easy to manage safely in terms of biocontainment. Taken together, our rapid breeding technique using an ALSV vector instills apple seedlings with an early-flowering trait that enables life cycle completion within 1 year, while eliminating transmission of the ALSV vector to successive progenies in most cases. In other words, successive progenies cannot be distinguished from genetically unmodified apple seedlings, and thus, we believe the products of this technique (the successive progenies) are not subject to the regulations of genetically modified organisms. Our ALSV vector-based technique, which accelerates the plant life cycle, is distinguishable from conventional transgenic approaches and therefore needs to be evaluated from a new perspective.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Construction of ALSV vectors expressing each of several FT orthologues from various plant species

Eighteen FT orthologues from 13 species (A. thaliana, Citrus unshiu, Cucumis sativus, Cucurbita moschata, Glycine max, Gentiana triflora, Ipomoea nil, Solanum lycopersicum, Malus x domestica, Prunus mume, Pisum sativum, Populus tremula and Vitis vinifera) were synthesized and inserted into the XSB site of pEALSR2mL5mR5 (Figure 1) (Li et al., 2004). Chenopodium quinoa was infected with each of the resulting FT-bearing vectors plus pEALSR1 to obtain ALSV vectors that promote expression of their respective FT orthologue (Igarashi et al., 2009).

Construction of ALSV vectors that simultaneously promote expression of AtFT and silencing of MdTFL1-1

A partial sequence of MdTFL1-1 (accession no. AB052994) (Sasaki et al., 2011) was inserted into the SM site of pEALSR1SM. Chenopodium quinoa was infected with the resulting construct plus AtFT-bearing pEALSR2mL5mR5 to obtain ALSV-AtFT/MdTFL1 that simultaneously promotes the expression of AtFT and silencing of MdTFL1-1.

Plant materials and inocula

Arabidopsis thaliana (Col) plants were grown at 25 °C under short day condition (8 h : 16 h light/dark photoperiod) in a growth chamber. Tobacco plants were grown at 25 °C under the long day condition (18 h : 6 h light/dark photoperiod) in a growth chamber. Homogenates of infected C. quinoa leaves were used as inocula for mechanical inoculation of A. thaliana and tobacco plants (Igarashi et al., 2009). Apple seed embryos were inoculated with an ALSV vector according to the method reported by Yamagishi et al. (2010). Briefly, total RNA extracted from ALSV vector-infected C. quinoa leaves was used as inocula for biolistic inoculation of apple cotyledons (seed embryos immediately after germination). Apple seeds were kept at 4 °C before use.

RNA extraction and quantitative RT-real-time PCR

Total RNA was extracted from shoot apices according to a previously reported method (Sasaki et al., 2011). After DNase I treatment and the following phenol/chloroform extraction, ethanol precipitation was performed and the resulting RNA pellets were dissolved in RNase-free water. First strand cDNA was synthesized using 500 ng of total RNA as a template, oligo (dT) primers and Rever Tra Ace reverse transcriptase (Toyobo, Osaka Japan). Quantitative real-time PCR was performed in a reaction volume of 20 μL using 2 μL of cDNA, SYBR Premix Ex Taq (Tli RNase H Plus) (TaKaRa, Kyoto, Japan) and the following primer pairs (final concentrations of 0.2 μm): MdrbcS380(+) 5′atggaaggtactggacaatg3′ and MdrbcS500(−) 5′cgatgatacggatgaagg3′ (for amplification of MdrbcS); MdTFL1-1391(+) 5′tcaatcaacacaccttcctc3′ and MdTFL1-1515(−) 5′cgtcttctagctgcagtttc3′ (for amplification of MdTFL1-1). MdrbcS served as a reference gene. The conditions of real-time PCR performed with the Eco Real-Time PCR system (Illmina, Inc., San Diego, CA) were 95 °C for 30 s followed by 40 cycles at 95 °C for 5 s, annealing at 60 °C for 30 s, and a final melting step up to 95 °C for 15 s, 55 °C for 15 s and 95 °C for 15 s. Data (5 seedlings/experiment) were analysed by 2-∆∆CT data analysis.

Determination of ALSV by quantitative RT-real-time PCR

RNA was extracted from test specimens as described above to make 100 μg/mL RNA solutions. First strand cDNA was synthesized as described above but using 100 ng of total RNA as a template. Determination of ALSV infection in seed embryos was performed by the SYBR method. Briefly, quantitative real-time PCR was performed as described above, but using the following primer pair (final concentrations of 0.15 μm): primer4F6150+(+) 5′ cgatgaatctccctgataga3′ and primer4R6279(−) 5′agagtagtggtctccagcaa3′. The conditions of real-time PCR performed with the Eco Real-Time PCR system were 95 °C for 30 s followed by 35 cycles at 95 °C for 5 s, annealing at 60 °C for 30 s, and a final melting step up to 95 °C for 15 s, 55 °C for 15 s and 95 °C for 15 s. Tenfold serial dilutions of in vitro-transcribed ALSV RNA1 (concentration range, 500 ng/μL-500 ag/μL) were used to make a calibration curve.

Determination of ALSV by ELISA

The levels of ALSV in apple leaves were determined by ELISA according to the method reported by Nakamura et al. (2011).

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Prof. H. Kamada for his helpful discussion and Mr. T. Ito for supplying apple seeds. This work was supported by the Programme for Promotion of Basic and Applied Researches for Innovations in Bio-oriented Industry from the Ministry of Agriculture, Forestry and Fisheries.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Abe, M., Kobayashi, Y., Yamamoto, S., Daimon, Y., Yamaguchi, A., Ikeda, Y., Ichinoki, H., Notaguchi, M., Goto, K. and Araki, T. (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science, 309, 10521056.
  • Bäurle, I. and Dean, C. (2006) The timing of developmental transitions in plants. Cell, 125, 655664.
  • Böhlenius, H., Huang, T., Charbonnel-Campaa, L., Brunner, A.M., Jansson, S., Strauss, S.H. and Nilsson, O. (2006) CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science, 312, 10401043.
  • Bradlley, D., Ratcliffe, O., Vincent, C., Carpenter, R. and Coen, E. (1997) Inflorescence commitment and architecture in Arabidopsis. Science, 275, 8083.
  • Corbesier, L., Vincent, C., Jang, S., Fornara, F., Fan, Q., Searle, I., Giakountis, A., Farrona, S., Gissot, L., Turnbull, C. and Coupland, G. (2007) FT protein movement contributes to long-distance signalling in floral induction of Arabidopsis. Science, 316, 10301033.
  • Crosby, J.A., Janick, J., Pecknold, P.C., Korban, S.S., O'Connon, P.A., Ries, S.M., Goffreda, J. and Voordeckers, A. (1992) Breeding apples for scab resistance: 1945–1990. Fruit Var. J. 46, 145166.
  • Crosby, J.A., Janick, J. and Pecknold, P.C. (1994) ‘GoldRush’ apple. HortSci. 29, 827828.
  • Endo, T., Shimada, T., Fujii, H., Kobayashi, Y., Araki, T. and Omura, M. (2005) Ectopic expression of an FT homolog from Citrus confers an early flowering phenotype on trifoliate orange (Poncirus trifoliate L. Raf). Transgenic Res. 14, 703712.
  • Esumi, T., Tao, R. and Yonemori, K. (2005) Isolation of LEAFY and TERMINAL FLOWER 1 homologues from six fruit tree species in the subfamily Maloideae of the Rosaceae. Sex. Plant Reprod. 17, 277287.
  • Fischer, C. (1994) Shortening of the juvenile period in apple breeding. In Developments in Plant Breeding: Progress in Temperate Fruit Breeding (Schmidt, H. and Kellerhals, M., eds), pp. 161164. London: Kluwer Academic Publishers.
  • Flachowsky, H., Hanke, M.-V., Peil, A., Strauss, S.H. and Fladung, M. (2009) A review on transgenic approaches to accelerate breeding of woody plants. Plant Breed. 128, 217226.
  • Flachowsky, H., Le Roux, P.M., Peil, A., Patocchi, A., Richter, K. and Hanke, M.-V. (2011) Application of a high-speed breeding technology to apple (Malus x domestica) based on transgenic early flowering plants and marker-assisted selection. New Phytol. 192, 364377.
  • Flachowsky, H., Szankowski, I., Waidmann, S., Peil, A., Tränkner, C. and Hanke, M.-V. (2012) The MdTFL1 gene of apple (Malus x domestica Borkh.) reduces vegetative growth and generation time. Tree Physiol. 32, 12881301.
  • Freiman, A., Shlizerman, L., Golobovitch, S., Yablovitz, Z., Korchinsky, R., Cohen, Y., Samach, A., Chevreau, E., Le Roux, P.-M., Patocchi, A. and Flaishman, M.A. (2012) Development of transgenic early flowering pear (Pyrus communis L.) genotype by RNAi silencing of PcTFL1-1 and PcTFL1-2. Planta, 235, 12391251.
  • Gleba, Y., Marillonnet, S. and Klimyuk, V. (2004) Engineering viral expression vectors for plants: the ‘full virus’ and the ‘deconstructed virus’ strategies. Curr. Opin. Plant Biol. 7, 182188.
  • Hättach, C., Flachowsky, H., Kapturska, D. and Hanke, M.-V. (2008) Isolation of flowering genes and seasonal changes in their transcript levels related to flower induction and initiation in apple (Malus x domestica). Tree Physiol. 28, 14591466.
  • Hecht, V., Laurie, R.E., Vander Schoor, J.K., Ridge, S., Knowles, C.L., Liew, L.C., Sussmilch, F.C., Murfet, I.C., Macknight, R.C. and Weller, J.L. (2011) The pea GIGAS gene is a FLOWERING LOCUS T homolog necessary for graft-transmissible specification of flowering but not for responsiveness to photoperiod. Plant Cell, 23, 147161.
  • Hsu, C.-Y., Liu, Y., Luthe, D.S. and Yuceer, C. (2006) Poplar FT2 shortens the juvenile phase and promotes seasonal flowering. The Plant Cell, 18, 18461861 doi: 10.1105/tpc.106.041038.
  • Huijser, P. and Schmid, M. (2011) The control of developmental phase transitions in plants. Development, 138, 41174129.
  • Igarashi, A., Yamagata, K., Sugai, T., Takahashi, Y., Sugawara, E., Tamura, A., Yaegashi, H., Yamagishi, N., Takahashi, T., Isogai, M., Takahashi, H. and Yoshikawa, N. (2009) Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes. Virology, 386, 407416.
  • Imamura, T., Nakatsuka, T., Higuchi, A., Nishihara, M. and Takahashi, H. (2011) The gentian orthorogs of the FT/TFL1 gene family control floral initiation in Gentiana. Plant Cell Physiol. 52, 10311041.
  • Kong, F., Liu, B., Xia, Z., Sato, S., Kim, B., Watanabe, S., Yamada, T., Tabata, S., Kanazawa, A., Harada, K. and Abe, J. (2010) Two coordinately regulated homologs of FLOWERING LOCUS T are involved in the control of photoperiodic flowering in soybean. Plant Physiol. 154, 12201231.
  • Kotoda, N. and Wada, M. (2005) MdTFL1, a TFL1-like gene of apple, retards the transition from the vegetative to reproductive phase in transgenic Arabidopsis. Plant Sci. 168, 95104.
  • Kotoda, N., Iwanami, H., Takahashi, S. and Abe, K. (2006) Antisense expression of MdTFL1, a TFL1-like gene, reduce the juvenile phase in apple. J. Am. Soc. Hort. Sci. 131, 7481.
  • Kotoda, N., Hayashi, H., Suzuki, M., Igarashi, M., Hatsuyama, Y., Kidou, S.-I., Igasaki, T., Nishiguchi, M., Yano, K., Shimizu, T., Takahashi, S., Iwanami, H., Moriya, S. and Abe, K. (2010) Molecular characterization of FLOWERING LOCUS T-like genes of apple (Malus x domestica Borkh.). Plant Cell Physiol. 51, 561575.
  • Le Roux, P.-M., Flachowsky, H., Hanke, M.-V., Gesseler, C. and Patocchi, A. (2012) Use of transgenic early flowering approach in apple (Malus x domestica Borkh.) to introgress fire blight resistance from cultivar Evereste. Mol. Breeding, 30, 857874.
  • Li, C., Sasaki, N., Isogai, M. and Yoshikawa, N. (2004) Stable expression of foreign proteins in herbaceous and apple plants using Apple latent spherical virus RNA2 vectors. Arch. Virol. 149, 15411558.
  • Lv, L., Duan, J., Xie, J.H., Wei, C.B., Liu, Y.G., Liu, S.H. and Sun, G.M. (2012) Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr). Gene, 505, 368373.
  • Matsuda, N., Ikeda, K., Kurosaka, M., Takashina, T., Isuzugawa, K., Endo, T. and Omura, M. (2009) Early flowering phenotype in transgenic pears (Pyrus communis L.) expressing the CiFT gene. J. Japan Soc. Hort. Sci. 78, 410416.
  • Mimida, N., Kotoda, N., Ueda, T., Igarashi, M., Hatsuyama, Y., Iwanami, H., Moriya, S. and Abe, K. (2009) Four TFL1/CEN-like genes on distinct linkage groups show different expression patterns to regulate vegetative and reproductive development in apple (Malus x domestica Borkh.). Plant Cell Physiol. 50, 394412.
  • Mimida, N., Ureshino, A., Tanaka, N., Shigeta, N., Sato, N., Moriya-Tanaka, Y., Iwanami, H., Honda, C., Suzuki, A., Komori, S. and Wada, M. (2011) Expression patterns of several floral genes during flower initiation in the apical buds of apple (Malus x domestica Borkh.) revealed by in situ hybridization. Plant Cell Rep. 30, 14851492.
  • Nakamura, K., Yamagishi, N., Isogai, M., Komori, S., Ito, T. and Yoshikawa, N. (2011) Seed and pollen transmission of Apple latent spherical virus in apple. J. Gen. Plant Pathol. 77, 4853.
  • Notaguchi, M., Abe, M., Kimura, T., Daimon, Y., Kobayashi, T., Yamaguchi, A., Tomita, Y., Dohi, K., Mori, M. and Araki, T. (2008) Long-distance, graft-transmissible action of Arabidopsis FLOWERING LOCUS T protein to promote flowering. Plant Cell Physiol. 49, 16451658.
  • Purkayastha, A. and Dasgupta, I. (2009) Virus-induced gene silencing: a versatile tool for discovery of gene function in plants. Plant Physiol. Biochem. 47, 967976.
  • Ratcliffe, O.J., Amaya, I., Vincent, C.A., Rothstein, S., Carpenter, R., Coen, E.S. and Bradley, D.J. (1998) A common mechanism controls the life cycle and architecture of plants. Development, 125, 16091615.
  • Ratcliffe, O.J., Bradley, D.J. and Coen, E.S. (1999) Separation of shoot and floral identity in Arabidopsis. Development, 126, 11091120.
  • Sasaki, S., Yamagishi, N. and Yoshikawa, N. (2011) Efficient virus-induced gene silencing in apple, pear, and Japanese pear using Apple latent spherical virus vectors. Plant Methods, 7, 15.
  • Srinivasan, C., Dardick, C., Callahan, A. and Scorza, R. (2012) Plum (Prunus domestica) trees transformed with poplar FT1 result in altered architecture, dormancy requirement, and continuous flowering. PLoS ONE, 7, e40715.
  • Tamaki, S., Matsuo, S., Wong, H.L., Yokoi, S. and Shimamoto, K. (2007) Hd3a protein is a mobile flowering signal in rice. Science, 316, 10331036.
  • Tränkner, C., Lehmann, S., Hoenicka, H., Hanke, M.-V., Fladung, M., Lenhardt, D., Dunemann, F., Gau, A., Schlangen, K., Malony, M. and Flachowsky, H. (2010) Over-expression of an FT-homologous gene of apple induces early flowering in annual and perennial plants. Planta, 232, 13091324.
  • Wang, J.-W., Park, M.Y., Wang, L.-J., Koo, Y., Chen, X.-Y., Weigel, D. and Poethig, R.S. (2011) MiRNA control of vegetative phase change in trees. PLoS Genet. 7, e1002012.
  • Yamagishi, N., Sasaki, S. and Yoshikawa, N. (2010) Highly efficient inoculation method of apple viruses to apple seedlings. Julius-Kuhn-Archiv. 427, 226229 (http://icvf.jki.bund.de).
  • Yamagishi, N., Sasaki, S., Yamagata, K., Komori, S., Nagase, M., Wada, M., Yamamoto, T. and Yoshikawa, N. (2011) Promotion of flowering and reduction of a generation time in apple seedlings by ectopical expression of the Arabidopsis thaliana FT gene using the Apple latent spherical virus vector. Plant Mol. Biol. 75, 193204.
  • Zhang, H., Harry, D.E., Ma, C., Yuceer, C., Hsu, C.-Y., Vikram, V., Shevchenko, O., Etherington, E. and Strauss, S.H. (2010) Precocious flowering in trees: the FLOWERING LOCUS T gene as a research and breeding tool in Populus. J. Expt. Botany, 61, 25492560.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
pbi12116-sup-0001-FigureS1-S3.pptxapplication/mspowerpoint4536K

Figure S1 Promotion of flowering in A. thaliana and tobacco plants infected with the ALSV vector expressing FT orthologue genes presented in Table S1.

Figure S2 (a) RT-PCR analysis of apple seedlings infected with ALSV-AtFT/MdTFL1 at 6 mpi MdTFL1 was detected in all 17 samples, but AtFT was not detected in 7 samples No. 2, 3, 6, 9, 11, 19, or 21, indicating that MdTFL1 was stably maintained, while AtFT was deleted in 40% of samples. (b) Apple seedlings infected with ALSV-AtFT/MdTFL1. Sample No. 9, which lost AtFT, shows vegetative growth of the shoot (11 mpi). In contrast, sample No. A1 shows continuous flowering (7.5 mpi).

Figure S3 Multiple alignment of the amino acid sequences of AtFT (A. thaliana, AAF03936), MdFT1 (apple, ACL98164), and MdFT2 (apple, BAD08340).

pbi12116-sup-0002-TableS1.docxWord document15KTable S1 Effect of ALSV vectors expressing various FT orthologues on the promotion of flowering in A. thaliana and tobacco plants.
pbi12116-sup-0003-SupportingInformation.docxWord document13K 

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.