SEARCH

SEARCH BY CITATION

Keywords:

  • ampulla of Vater;
  • intraductal dissemination;
  • pancreatic duct;
  • papillary adenocarcinoma

Abstract

  1. Top of page
  2. Abstract
  3. Clinical Summary
  4. Pathological Findings
  5. Discussion
  6. Acknowledgments
  7. References

It has been speculated that intraductal dissemination, via the pancreatic duct, bile duct, or mammary duct, is a unique form of cancer cell spread. However, clinical evidence to confirm this form of dissemination has been lacking. Here we report a case of papillary adenocarcinoma of the ampulla of Vater in which retrograde dissemination to the pancreatic duct was strongly suggested. A 79-year-old woman underwent pancreatoduodenectomy for a 22 mm microinvasive papillary adenocarcinoma of the ampulla. Multiple carcinomas in situ were found in the pancreatic duct distant from the ampulla. Seven months later, she underwent a second operation for a recurrent papillary adenocarcinoma at the pancreato-jejunal anastomosis showing exophytic and expansive growth into the jejunal lumen that connected to an intraductal adenocarcinoma in the pancreatic body. None of these tumors showed invasive growth, or vascular or neural invasion, being separate from each other but sharing identical histological, immunohistochemical, and molecular features; papillary growth, a pancreatobiliary phenotype, the same pattern of genomic loss of heterozygosity, and no mutation of the KRAS, TP53, and GNAS genes. These results imply that this papillary adenocarcinoma of the ampulla of Vater had disseminated to the pancreatic duct in a retrograde manner and recurred in the remnant pancreas.

During tumor growth, cancer cells that have developed in the epithelial layer begin to invade by breaking through the basement membrane to extend into the surrounding stroma, followed by further continuous invasion. They can also spread discontinuously through metastasis or dissemination, which is usually achieved by carriage through the hematogeneous or lymphatic pathways, or within the peritoneal cavity. Similarly, dissemination of cancer cells via ducts such as the pancreatic duct or mammary duct would provide a further potential corridor for cancer cells in patients with pancreatic cancer and breast cancer. Empirically, several suspected cases of tumor spread or dissemination via the pancreatic or mammary duct have been reported, although pathologically proven cases have been very scant.[1]

Adenocarcinoma of the ampulla of Vater is a rare malignant epithelial tumor, with an incidence of 0.5–5% among all gastrointestinal malignancies.[2] Carcinoma of the ampulla of Vater usually spreads to neighboring tissue directly, as well as showing lymph node and distant metastasis. However, no proven case of dissemination via the pancreatic duct, bile duct, or digestive tract has been reported. Here we describe the first reported case of adenocarcinoma of the ampulla of Vater showing retrograde dissemination via multiple branches of the pancreatic duct.

Clinical Summary

  1. Top of page
  2. Abstract
  3. Clinical Summary
  4. Pathological Findings
  5. Discussion
  6. Acknowledgments
  7. References

A 79-year-old Japanese woman was admitted to our hospital with abdominal fullness, abdominal pain, and nausea. She had no significant medical history. Abdominal computed tomography (CT) revealed a 2.0 cm slightly enhanced mass in the ampulla of Vater, and dilation of the bile duct. Ultrasonography yielded similar findings. Serum examination revealed no elevation of any tumor marker levels. She underwent pylorus-preserving pancreatoduodenectomy for carcinoma of ampulla of Vater and reconstruction of duodenal-jejunal and pancreato-jejunal anastomoses. The surgery was uneventful, and the postoperative course was good. Seven month later, abdominal CT revealed a 5.0 cm tumor at the site of the pancreato-jejunal anastomosis. A second operation was performed to resect the pancreatic body and tail with partial anastomosis of the jejunum to the pancreatic body. The operation was uneventful, and no recurrence has been observed during 22 months of follow-up.

Pathological Findings

  1. Top of page
  2. Abstract
  3. Clinical Summary
  4. Pathological Findings
  5. Discussion
  6. Acknowledgments
  7. References

First surgical specimen

Surgically resected specimens were observed macroscopically, fixed in 10% formalin, and cut into serial slices 5 mm thick, almost frontally in the specimen. All of these sections were then subjected to detailed histopathological examination. On gross examination, the ampulla of Vater was swollen by a protruding tumor (Fig. 1a) and the tumor had grown expansively at the ampulla (Fig. 1b). Histologically, the tumor had proliferated and filled the lumen of the common channel with slight extension to the ampullary pancreatic and bile ducts without invasion to the surrounding organs (Fig. 1c), although microinvasion to the Oddi sphincter was evident (Fig. 1d). The tumor consisted of atypical tall columnar epithelial cells with marked cytological atypia, and showing a markedly complex papillary architecture (Fig. 1e), indicating a diagnosis of microinvasive papillary adenocarcinoma arising in association with pancreatobiliary (PB)-type non-invasive papillary neoplasm. The tumor measured 22 × 15 × 15 mm and had no evidence of lymphatic, venous, or neural invasion, or nodal metastasis.

figure

Figure 1. Gross and microscopic appearance of the specimen obtained by pancreatoduodenectomy (a–g). (a) On the luminal surface of the fresh duodenum, the ampulla of Vater is swollen by a 3 cm protruding tumor covered by intact duodenal mucosa, without tumor exposure. (b) In the frontally cut surface of the fixed specimen, the white, solid, and well demarcated tumor is seen to be localized in the ampulla of Vater. No tumor is evident in the pancreas. (c) Loupe view of the ampulla of Vater. The tumor has grown expansively in the common channel with a papillary structure that spreads slightly to both the ampullary bile duct (arrow) and the ampullary pancreatic duct (arrow head). The tumor is well demarcated and covered by the Oddi sphincter. (d and e) Medium-power (d) and high-power (e) view of the ampullary tumor. The tumor consists of atypical tall columnar epithelial cells with marked cytological atypia showing a markedly complex papillary architecture (e), being invasive to the Oddi sphincter at a few points, but not beyond it (d). (f and g) There are multiple lesions of carcinoma in situ (CIS) in the pancreatic ducts and ductules in the pancreatic head. The markedly atypical tall columnar cells have proliferated with low papillary features, and microinvasion is evident in one of the lesions (g). (h–m) Gross and microscopic features of the specimen obtained by surgical resection of the remnant pancreatic body and tail with the anastomosed jejunum. (h) In the luminal surface of the fresh jejunum, there is a protruding tumor at the pancreato-jejunal anastomosis, which shows exophytic, lobulated, crumbly, and polypoid features and is covered by hemorrhagic and necrotic debris on the surface. (i) In the horizontally cut surface of the fresh jejunum (black arrow) and pancreatic body and tail, the exophytically growing tumor (white arrows) is dark brownish, hemorrhagic, fragile, and well demarcated. Many white, hemorrhagic, and medullary tumors (arrow heads) have squeezed out from the cut surface of the pancreatic ducts in a ‘tooth paste'-like manner in the pancreatic body. (j) Loupe view of the pancreatic body (sagittal section). The papillary tumor has proliferated and fills the cystically dilated pancreatic ducts, the surrounding pancreatic parenchyma having been replaced by fibrous tissue with chronic inflammation. (k–m) Low-power (k) and medium-power (l, m) views of the intraductal proliferating tumor in the pancreatic body. The exophytic polypoid tumor and the proliferating tumors in the pancreatic ducts are connected, and both tumors show a markedly complex papillary architecture and cytological atypia (l), quite similar to the histology of the ampullary tumor. Tumor cells have replaced the ductal covering epithelia (l), and the tumor cells are floating and proliferating in a papillary manner in the pancreatic ducts (m).

Download figure to PowerPoint

Multiple carcinomas in situ (CISs) were seen in the pancreatic ducts (Fig. 1f,g) without any atypical epithelial hyperplasia (corresponding to a low grade pancreatic intraepithelial neoplasm) around them. Each CIS was microscopic in dimension, the largest one measuring 3 mm. Multiple CISs were scattered in the pancreatic head and tended to be localized at the periphery of pancreatic lobules. The distance between the CISs and the ampullary tumor was at least 1.2 cm. One of the CISs showed microinvasion into the surrounding stroma (Fig. 1g). It was highly suspected that CISs remained in the remnant pancreas, since they were seen in the surgical margin.

Second surgical specimen

The 47 × 45 × 25 mm exophytic tumor projecting into the jejunal lumen at the pancreato-jejunal anastomosis was lobulated, crumbly, and polypoid, and covered with necrotic debris (Fig. 1h). The cut surface was dark brownish and hemorrhagic, and in addition, it was possible to squeeze white medullary tumors from the cut surface of the pancreatic ducts (Fig. 1i). Histologically, both the exophytic polypoid tumor and the intraductal proliferating tumors in the pancreatic ducts in the pancreatic body were PB-type papillary adenocarcinoma, similar to the ampullary tumor (Fig. 1j,k). The polypoid tumor grew expansively into the surrounding stroma, being connected to the intraductal tumors in the pancreatic ducts (Fig. 1l,m). The tumor showed no evidence of lymphatic, venous, or neural invasion, or nodal metastasis.

Immunohistochemical analysis

Immunohistochemistry was carried out on formalin-fixed, paraffin-embedded tissue sections as described previously,[3] using antibodies shown in Table 1. The ampullary tumor and the CISs in the pancreatic ducts were positive for MUC1, MUC5AC, and MUC6, and negative for MUC2 and CD10. The recurrent tumor at the pancreato-jejunal anastomosis and the intraductal tumor in the pancreatic body showed identical profiles. All of the above tumors showed a tumor cell phenotype compatible with the PB type.

Table 1. Primary antibodies used in the immunohistochemistry
AntigensClone namesWorking dilutionAntigen retrievalSource
  1. a

    A/C (Cit): autoclave in citrate buffer (pH 6.0).

MUC1Ma6951:100A/C (Cit)aLeica Biosystems, Newcatsle, UK
MUC5ACCLH21:200A/C (Cit)aLeica Biosystems
MUC6CLH51:100A/C (Cit)aLeica Biosystems
MUC2Ccp581:200A/C (Cit)aLeica Biosystems
CD1056C61:200A/C (Cit)aLeica Biosystems

Molecular analysis

We analyzed gene mutations and loss of heterozygosity (LOH) in the ampullary tumor, six independent CIS lesions selected randomly, and the recurrent tumor at the pancreato-jejunal anastomosis. Mutation analyses were performed as described previously,[4] and the PCR primers used in this study were shown in Table 2. LOH was analyzed as described previously.[5] Genomic DNA was amplified by PCR using oligonucleotide primers for 14 microsatellite markers: BAT25 (4q12), BAT40 (1p13.1), D16S408 (16q), D16S168 (16q21 to 22.1), IFNA (9q22), D18S69 (18q21), UT762 (21), ACTBP2 (6q), AR (X), DRPLA (12p13.31), D16S409 (16q), D16S410 (16p), D17S261 (17p12 to 11.1), and BAT26 (2p22 to 21). All of the tumors showed 4 retention of heterozygosity (IFNA, ACTBP2, DRPLA, and D16S409) and 3 LOH (D18S69, AR, and D17S261) among seven informative polymorphic genome loci within a total of 14 loci tested (Fig. 2); none of the tumors showed mutations of the KRAS, TP53, and GNAS genes These results strongly suggested that the ampullary tumor, multiple lesions of CIS in the pancreatic ducts and ductules, and the recurrent tumors in the pancreatic body were identical.

figure

Figure 2. Example results from loss of heterozygosity (LOH) analyses. DNA samples obtained from (a) the normal pancreas, (b) microinvasive papillary adenocarcinoma of the ampulla of Vater, (c) the recurrent papillary adenocarcinoma at the pancreato-jejunal anastomosis, and (d–f) three independent small foci of carcinoma in situ (CIS) in the pancreatic head were amplified with the markers D18S69 (left column) and D17S261 (right column). Allele sizes (bp) are indicated on the top horizontal axis. LOH was identified when the relative intensity of one allele was reduced by more than 70% in an informative case (arrows).

Download figure to PowerPoint

Table 2. Sequencing primers
GeneRegionForward 5′-3′Reverse 5′-3′
KRASexon 2AGGCCTGCTGAAAATGACTGGGTCCTGCACCAGTAATATGCA
exon 6AGAGACGACAGGGCTGGTTCTTAACCCCTCCTCCCAGAG
TP53exon 7CCTGCTTGCCACAGGTCTGTGTGCAGGGTGGCAAGT
exon 8TTCCTTACTGCCTCTTGCTTCGCTTCTTGTCCTGCTTGCTT
GNASexon 8ACTGTTTCGGTTGGCTTTGGTGAAGGGACTGGGGTGAATGTCAAGA
exon 9GACATTCACCCCAGTCCCTCTGGGAACAGCCAAGCCCACAGCA

Discussion

  1. Top of page
  2. Abstract
  3. Clinical Summary
  4. Pathological Findings
  5. Discussion
  6. Acknowledgments
  7. References

Intraductal dissemination as a unique mode of cancer cell spread has been speculated for at least four decades. Transductal dissemination of cancer cells injected into the pancreatic duct has been observed in a rabbit model.[6] Empirically, several cases suspected to have involved tumor dissemination via the ducts of the mammary gland[7] and pancreas[6] have been reported. However, there was no firm clinical evidence to support this possibility except for only a case of acinar cell carcinoma that showed multiple intraductal dissemination from the tail to the head of the pancreas.[1] Clearly, it is necessary to confirm unequivocally that this mode of cancer cell spread occurs. However, appropriate cases that would allow this to be confirmed are very rare. Such cases would need to involve a non-invasive primary cancer of the pancreatic duct unassociated with any lymphatic or venous invasion, and multiple intraductal cancer foci, all of which are identical.

In the present case, the ampullary tumor and multiple small foci of CIS in the pancreatic ducts were non-invasive or microinvasive and lacked any lymphatic, venous, or neural invasion. The recurrent tumors in the pancreatic body also showed expansive growth and no lymphatic, venous, or neural invasion. These tumors may have been multicentrically developing primary tumors or a primary tumor with associated metastatic tumors. We considered the latter scenario to be more likely because all the tumors were discrete but shared identical histological, immunohistochemical, and molecular features, i.e., all showed intraductal papillary growth, a pancreatobiliary tumor cell phenotype, and the same pattern of LOH without mutations of the KRAS, TP53, and GNAS genes. The apparently larger size of the tumor in the ampulla of Vater allowed us to speculate that this was the primary. The KRAS and TP53 gene mutations are the most important drivers for the development of ductal adenocarcinoma of the pancreas,[8] being detectable in more than 95% and 75% of cases, respectively,[8] compared with 28–46%[9, 10] and 53–94%[11, 12] of ampullary carcinomas, respectively. These findings further support our speculation that the primary tumor developed in the ampulla of Vater. If so, the multiple CISs and the recurrent tumors were thought to be metastatic lesions, although none of the recurrent tumors in the pancreatic body had any lymphatic, venous, or neural invasion. It was thought that retrograde intraductal dissemination was the most probable explanation for the mode of cancer spread.

Ohike et al. have proposed the intra-ampullary papillary-tubular neoplasm (IAPN) of the ampulla, representing the intra-ampullary counterpart of intraductal papillary mucinous neoplasm (IPMN) of the pancreas.[13] Recently, the GNAS mutation has been shown to be characteristic of IPMN.[14, 15] Our present case fits the category of IAPN, although no GNAS mutation was detected. However, absence of GNAS mutations in IAPN is still inadmissible, as many more cases need to be analyzed to determine the true frequency of GNAS mutation.

In conclusion, we have presented a case of microinvasive papillary adenocarcinoma at the ampulla of Vater in which it was strongly suggested that the tumor cells had disseminated retrogradely to the pancreatic ducts and ductules from the primary, and recurred in the remnant pancreas after pancreatoduodenectomy. The case appears to be unique and valuable for considering whether cancer cells can disseminate via the pancreatic duct and its branches.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Clinical Summary
  4. Pathological Findings
  5. Discussion
  6. Acknowledgments
  7. References

The authors wish to thank Ms. Rie Yamazaki-Itoh and Reiko Ogawa for excellent technical assistance. This work was supported by a Grant-in-Aid for Third Term Comprehensive 10-year Strategy for Cancer Control from the Ministry of Health, Labor and Welfare of Japan (NH) and the National Cancer Center Research and Development Fund (NH).

References

  1. Top of page
  2. Abstract
  3. Clinical Summary
  4. Pathological Findings
  5. Discussion
  6. Acknowledgments
  7. References
  • 1
    Ban D, Shimada K, Sekine S et al. Pancreatic ducts as an important route of tumor extension for acinar cell carcinoma of the pancreas. Am J Surg Pathol 2010; 34: 10251036.
  • 2
    Albores-Saavedra J, Hruban RH, Klimstra DS, Zamboni G. Invasive adenocarcinoma of the ampullary region. In: Bosman FT , Carneiro F , Hruban RH , Theise ND , eds. WHO Classification of Tumours of the Digestive System. Lyon: International Agency of Research on Cancer, 2010; 8791.
  • 3
    Hiraoka N, Yamazaki-Itoh R, Ino Y et al. CXCL17 and ICAM2 are associated with a potential anti-tumor immune response in early intraepithelial stages of human pancreatic carcinogenesis. Gastroenterology 2011; 140: 310321.
  • 4
    Matsubara A, Sekine S, Kushima R et al. Frequent GNAS and KRAS mutations in pyloric gland adenoma of the stomach and duodenum. J Pathol 2013; 229: 579587.
  • 5
    Kondo Y, Kanai Y, Sakamoto M, Mizokami M, Ueda R, Hirohashi S. Genetic instability and aberrant DNA methylation in chronic hepatitis and cirrhosis—A comprehensive study of loss of heterozygosity and microsatellite instability at 39 loci and DNA hypermethylation on 8 CpG islands in microdissected specimens from patients with hepatocellular carcinoma. Hepatology 2000; 32: 970979.
  • 6
    Fujita N, Nakase A. Experimental study of transductal dissemination of cancer of the pancreas. Gastroenterol Jpn 1977; 12: 224229.
  • 7
    Morimoto T, Komaki K, Inui K et al. Involvement of nipple and areola in early breast cancer. Cancer 1985; 55: 24592463.
  • 8
    Iacobuzio-Donahue CA, Velculescu VE, Wolfgang CL, Hruban RH. Genetic basis of pancreas cancer development and progression: Insights from whole-exome and whole-genome sequencing. Clin Cancer Res 2012; 18: 42574265.
  • 9
    Schonleben F, Qiu W, Allendorf JD, Chabot JA, Remotti HE, Su GH. Molecular analysis of PIK3CA, BRAF, and RAS oncogenes in periampullary and ampullary adenomas and carcinomas. J Gastrointest Surg 2009; 13: 15101516.
  • 10
    Wagner PL, Chen YT, Yantiss RK. Immunohistochemical and molecular features of sporadic and FAP-associated duodenal adenomas of the ampullary and nonampullary mucosa. Am J Surg Pathol 2008; 32: 13881395.
  • 11
    Imai Y, Oda H, Tsurutani N, Nakatsuru Y, Inoue T, Ishikawa T. Frequent somatic mutations of the APC and p53 genes in sporadic ampullary carcinomas. Jpn J Cancer Res 1997; 88: 846854.
  • 12
    Scarpa A, Capelli P, Zamboni G et al. Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations. Am J Pathol 1993; 142: 11631172.
  • 13
    Ohike N, Kim GE, Tajiri T et al. Intra-ampullary papillary-tubular neoplasm (IAPN): Characterization of tumoral intraepithelial neoplasia occurring within the ampulla: A clinicopathologic analysis of 82 cases. Am J Surg Pathol 2010; 34: 17311748.
  • 14
    Furukawa T, Kuboki Y, Tanji E et al. Whole-exome sequencing uncovers frequent GNAS mutations in intraductal papillary mucinous neoplasms of the pancreas. Sci Rep 2011; 1: 161.
  • 15
    Wu J, Matthaei H, Maitra A et al. Recurrent GNAS mutations define an unexpected pathway for pancreatic cyst development. Sci Transl Med 2011; 3: 92ra66.