SEARCH

SEARCH BY CITATION

Contents

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

Progesterone exerts its effect by binding to specific progesterone receptors (PR) within the cell. In dogs and cats, no data are available on PR isoforms as found in other species. We therefore investigated the sequence of the PR gene and encoded protein in dogs and cats, the expression of PR isoforms in mammary tissue using Western blots and the presence of PR in mammary tissue using immunohistochemistry. Comparison of the amino acid sequence of the canine and feline PR with human PR revealed major differences in the PR-B-specific upstream segment (BUS). However, the essential activation function 3 (AF3) domain was intact in the cat but mutated in the dog. The DNA and ligand-binding domains were highly similar among the species. In cats with fibroadenomatous hyperplasia (FAH), high expression of PR mRNA together with growth hormone (GH), GH receptor (GHR) and IGF-I mRNA was found in comparison with feline mammary carcinomas. Immunohistochemical analysis showed strong nuclear as well as cytoplasmic staining for PR in FAH. Western blot analysis revealed expression of the PR-A and PR-B isoforms in the feline mammary gland. In canine mammary tissue, the most abundant PR staining was found in proliferative zones of the mammary gland. Western blot analyses showed mainly staining for PR-A with lower PR-B staining. It is concluded that in dogs and cats both PR isoforms are expressed. The role of mutations found in the canine PR-B is discussed.


Introduction

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

As in other species, progesterone (P4) plays an important role in reproductive processes in dogs and cats. The signal transduction cascades involved in P4 signalling start with binding of P4 to specific receptors. The two well-known P4 receptors (PR) are transcribed from a single gene but – through use of different promoters – two different PR isoforms are synthesized. The shorter form, PR-A, contains the hormone-binding domain, a hinge region and a DNA-binding domain, but it lacks an amino-terminal sequence that is unique for the longer PR-B receptor (Fig. 1). This PR-B-upstream segment (BUS) contains an activation domain, AF3, which results in a much higher transactivation potential of the PR-B in relation to PR-A in humans (Daniel et al. 2011). PR-A is mainly found within the nucleus, whereas PR-B is present both in the nucleus and in the cytoplasm. Classically, ligand-activated PR forms homo- or heterodimers of PR-A and PR-B that bind to progesterone response elements (PRE) in promoter regions of target genes. However, because of its cytosolic localization, PR-B may also interact with mitogen-activated protein kinase (MAPK) or with oestrogen receptors (ER) and thus may activate gene expression by alternative pathways (Ballare et al. 2003).

image

Figure 1. General structure of progesterone receptors (PR) isoforms. The shorter PR-A isoform lacks the B-upstream segment (BUS) and activation function 3 (AF3) domain. Both receptors have the activation domains AF1 and AF2, the inhibitory domain (ID) and the sequences important for receptor dimerization (DIM). BUS, PR-B-upstream segment; DBD, DNA-binding domain; H, Hinge region; LBD, Ligand-binding domain

Download figure to PowerPoint

P4 plays a central role in the regulation of stem cells and progenitor cells within the mammary gland (Axlund and Sartorius 2012) where PR expressing cells act as sensors towards the P4 signal and secrete growth factors that activate neighbouring stem cells to proliferate and differentiate (Brisken and Duss 2007). Although already much is known on P4 effects in dogs and cats (including its role in mammary hyperplasia and tumorigenesis), no data are available yet on PR isoforms in both species. We therefore investigated the presence of these isoforms in feline and canine mammary tissue. In addition, the amino acid sequences of canine and feline PR were compared with that of the human PR.

Material and Methods

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

Tissues

Feline and canine abnormal mammary tissues were obtained by surgery from client-owned animals referred to the Department of Clinical Sciences of Companion Animals of Utrecht University. Part of the tissue was frozen in liquid nitrogen and stored at −80°C until analysis. For immunohistochemistry (IHC) tissue, samples were fixed in neutral-buffered formalin, paraffin embedded, and processed for routine histopathology. For expression analysis in cats, five carcinomas and 17 fibroadenomatous hyperplasia (FAH) tissues were used, and no normal tissue was available. For Western blot analysis in the feline mammary tissue, three FAH and two carcinomas were used. For the dog, two normal mammary glands and three medroxyprogesterone acetate (MPA)-induced hyperplasias were obtained from previous studies (Bhatti et al. 2007) and three carcinomas came from the clinic.

Sequence alignment

In the past, we have sequenced the canine gene encoding the progesterone receptor (Lantinga-van Leeuwen et al. 2000). The translation into protein is available under accession number AF177470 at the NCBI database. The human sequence was also derived from the NCBI database (accession no. AAG09282) and the partially known feline sequence (transcript ENSFCAT00000011493) came from the Ensembl database (www.ensembl.org). The sequences were compared using Clustal W analysis (DNASTAR, Madison, WI).

Quantitative RT-PCR

Expression of PR, GH, GHR and IGF-I for canine tissues has been reported previously (Bhatti et al. 2007). In the current study, we analysed these genes in feline mammary tissue. RNA was isolated from mammary tissues and treated with DNase using the RNeasy mini kit (Qiagen, Venlo, The Netherlands) according to the manufacturer's protocol. cDNA synthesis was performed using iScript kit (BioRad, Veenendaal, The Netherlands). For primers and annealing temperatures, see Table 1. RT-PCR was performed using BioRad MyIQ detection system (BioRad) with SYBR green fluorophore. Relative target gene expression was normalized to that of the reference genes HPRT, RPL17 and RPS19. Relative gene expression was statistically assessed using REST-XL (Pfaffl et al. 2002).

Table 1. Primers used for quantitative RT-PCR. Given are the amplicon length and the annealing temperatures used
GeneForward primerReverse primerAmpliconTa (°C)
  1. PR, progesterone receptors.

PRCAATGGAAGGGCAGCATAATCAGCCTGGCAACACTTTCTAA11157
GHCGAGGGACAGAGGTACTCCAACGACTGGATGAGCAGCAG14363
GHRTCCCCAGGCCAAAAGAATAAGCAGAAGTAGGCGTTGTCCAT10559
IGF-ITGTCCTCCTCGCATCTCTTGTCTCCGCACACGAACTG12260
HPRTACTGTAATGACCAGTCAACAGGGGTGTATCCAACACTTCGAGGAGTCC21060
RPL17CTCTGGTCTTGAGCACATCCTCAATGTGGCAGGGAGAGC10858
RPS19TCATGCCCAGCCACTTTAGCGAGGTGTCAGTTTGCGTCCC11659

Immunohistochemistry

Formalin-fixed paraffin-embedded mammary tissue samples were used. Slides of 10 μm were deparaffinized with xylene and rehydrated in decreasing concentrations of ethanol. Peroxidase-blocking was performed using 3% H2O2 in TBS for 15 min. Antigen retrieval was carried out by boiling in 50 mm citrate buffer for 20 min and then left to cool down for another 20 min. Nonspecific antibody binding was blocked using 10% normal goat serum and 1% BSA for 30 min at RT. Slides were next incubated using a PR antibody (SC-539; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at a dilution of 1 : 1500 and kept overnight at 4°C. The second antibody (Envision anti-rabbit, K4003; DAKO, Heverlee, Belgium) was incubated for 30 min and then washed off. The slides were then incubated with chromogen 3,3′-diaminobenzidine tetrahydrochloride (DAB) to visualize the immunoreactions. Finally, they were covered with haematoxylin (Hematoxylin QS, Vector H3404; DAKO, Heverlee, Belgium) for 5-s, dehydrated and then mounted with Vecta mount (Vector H-5000).

Western blotting

For expression analysis, protein was isolated from tissue dissolved in 0.5 ml lysis buffer consisting of 10 mm Tris-HCl (pH 7.4), containing 1.5 mm EDTA, 10 mm sodium molybdate, 10% glycerol, 1 mm DTT, 1 mm sodium orthovanadate, 1 mm PMSF and 10 μg/ml aprotinine. Tissues were homogenized on ice using an Ultra Turrax tissue grinder. Next samples were centrifuged for 20 min at 16 000 g and 4°C. In the supernatant, protein concentration was determined using BioRad Dc Protein Assay (BioRad). Fifty microgram protein of total cell lysates was subjected to SDS-PAGE and analysed by Western blot using primary antibody against human PR (sc-539, 1 : 1000; Santa Cruz Biotechnology) and the secondary goat anti-rabbit HRP-conjugated antibody (HAF008; R&D Systems, Abingdon, UK). HRP was visualized using Advance TM-Enhanced chemiluminescence (ECL, Amersham; GE Healthcare, Eindhoven, The Netherlands) and analysed using GelDoc2000 (BioRad).

Results

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

Protein sequence analysis

The human, canine and partially known feline protein sequences of the PR were compared using Clustal W (Fig. 2). The lowest homology between these species was found in the BUS. In the sequence of the canine PR BUS area, a polyalanine repeat is present. The BUS region contains the activation function 3 (AF3) domain. In human, two nuclear receptor motifs (55,115LxxLL) and a tryptophan (140W) residue are essential for AF3 function (Tung et al. 2001). The sequences of all three motifs are different in the dog, whereas in the cat, these motifs are identical to the human sequence (Fig. 2). The sequence of the N-terminal part of the PR-A has high homology among the three species. This region contains the nuclear localization signal, the activation function 1 (AF1) domain, two areas that interact with the oestrogen receptor within the cytoplasm (ERID-I and ERID-II) and a proline-rich domain that interacts with the c-Src family of tyrosine kinases. Both the BUS area and the amino-terminal PR sequence contain multiple serine residues that are prone to phosphorylation reactions. The carboxy-terminal part is highly conserved among the species investigated. This part contains the DNA-binding domains (zinc fingers), a hinge region, the ligand-binding domain and also the activation function 2 (AF2) domain.

image

Figure 2. Alignment of human (Hs), canine (Cf) and feline (Fc) progesterone receptors (PR) amino acid sequences. The B-upstream segment (BUS) area is unique for PR-B (1–165) and contains the activation function 3 (AF3) domain. The amino-terminus of PR-A (165–345) and (456–556) contain two oestrogen receptor interacting domains (ERID-I, and -II), AF1 and the SH3 domain that interact with the c-Src family of tyrosine kinases. The carboxy-terminal part contains a DNA-binding domain with two zinc finger motifs (box), a hinge region and the ligand-binding domain including AF2. Different amino acids are marked bold

Download figure to PowerPoint

Progesterone receptors in feline mammary tissue

In the cat, endogenous P4 and synthetic progestins may induce FAH of the mammary gland. Expression analysis using quantitative RT-PCR showed large differences between the FAH and carcinoma. In FAH > 100-fold higher PR mRNA expression was found together with approximately 30-fold higher expression of GH, GHR and IGF-I mRNA. In FAH tissues examined by IHC, we found predominant staining for PR in ductal epithelium with both nuclear and cytoplasmic localization (Fig. 3). Also in stromal cells, cytoplasmic staining was observed. Western blot analysis demonstrated the presence of both PR isoforms, PR-A (80–86 kDa) and PR-B (116–120 kDa).

image

Figure 3. (a) Western blot of progesterone receptors (PR) in feline mammary tissue. F, fibroadenomatous hyperplasia; C, carcinoma. The FAH tissues were from cats treated with progestins. (b) Immunohistochemical staining for PR in feline FAH

Download figure to PowerPoint

Progesterone receptors in canine mammary tissue

Canine mammary tissue was used for IHC and Western blotting of the PR. Predominant nuclear staining and weak cytoplasmic staining for PR was found in epithelial cells in proliferative zones of the mammary gland (Fig. 4), whereas in differentiated mammary tissue, the number of PR-positive cells was low. In stromal cells hardly any PR staining was found. Western blot analysis revealed predominant staining for PR-A, with less intensive staining for the PR-B isoform. In carcinomas, increased PR-A expression was noticed in comparison with normal and hyperplastic tissue (Fig. 4).

image

Figure 4. (a) Western blot of progesterone receptors (PR) canine mammary tissue. N, Normal; H, hyperplastic (after treatment with progestins); C, carcinoma. (b) Immunohistochemical staining for PR in canine mammary tissue

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

In the current study, we investigated the presence of PR isoforms in feline and canine mammary tissue. Compared to feline mammary carcinoma, PR expression as measured by RT-PCR was greatly increased in FAH with a concomitant increased expression of GH, GHR and IGF-I mRNA. The role of P4 in FAH is also convincingly shown by the fact that cats with FAH can be treated successfully with the PR antagonist aglepristone (Gorlinger et al. 2002). In feline FAH, both PR-A and PR-B proteins are present. This is comparable to healthy human mammary tissue where a PR-A:PR-B ratio of 1 : 1 is found, and when expressed in the same cell results in the formation of both hetero- and homodimers of ligand-activated PR (Scarpin et al. 2009). Studies in mice have shown that the PR-B isoform is required for proper mammary development (Mulac-Jericevic et al. 2003) and may also have a role in the development of FAH. Expression of the PR has been shown to be increased in FAH (Millanta et al. 2006) and the PR-B isoform is clearly present as shown in our study. The presence of PR-B may be due to amplification of PR-B protein levels by P4, similar to what is found in rodents (Aupperlee and Haslam 2007). The relative low expression of PR mRNA in carcinomas are in line with the reported low or non-detectable expression of PR in feline invasive mammary carcinomas using IHC (Millanta et al. 2006).

In the dog, exposure to endogenous P4 or to synthetic progestins, such as MPA, may result in acromegalic changes and mammary hyperplasia (Selman et al. 1994). Expression analysis revealed induction by MPA of synthesis of GH and IGF-I mRNA in the mammary gland (Mol et al. 1995), whereas GHR and PR mRNA expression were down-regulated (Bhatti et al. 2007). Gene-profiling studies showed that progestins induced the Wnt-pathway with high expression of Wnt4, but also of genes involved in cell proliferation and cell adhesion molecules (Rao et al. 2009).

We have cloned and sequenced the canine PR and performed IHC in progestin-induced mammary hyperplasia. It was found that all GH-producing cells were positive for PR, emphasizing the relation between P4 exposure and local mammary GH expression (Lantinga-van Leeuwen et al. 2000). Using IHC, strong nuclear and weaker cytoplasmic staining for PR was noticed. Previously, we reported in canine mammary carcinomas marked heterogeneous staining including perinuclear staining of tumorous cells and cytoplasmic staining in spindle cells (Lantinga-van Leeuwen et al. 2000). PR-A has been reported to be present in nuclei, irrespective whether they are ligand-activated or not (Leslie et al. 2005). PR-B, however, is found in the cytoplasm as well where it may function by the nteraction with ER, c-Src and phosphorylation by MAPK (Daniel et al. 2011). The presence of cytoplasmic PR staining in the canine mammary tissue is in line with the expression of PR-B. Western blot analysis showed also PR-B immunoreactivity in normal and hyperplastic mammary tissue and in carcinoma but clearly less than PR-A. In human breast cancer, a high PR-A:PR-B ratio can be found and is associated with a more malignant phenotype (Scarpin et al. 2009). In dogs, exposure to MPA resulted (in contrast with cats) in down-regulation of PR mRNA expression. So, although we present evidence for expression of PR-B in canine mammary tissue, its role is far from being clear.

In addition, we recently analysed the transactivation potential of the canine PR-A and PR-B isoforms (Gracanin et al. 2012). Canine PR-A had transactivation potential comparable to human PR-A, but the canine PR-B isoform had a low and very limited transactivation potential in comparison with human PR-B. The combination of lower expression and limited transactivation brings into question the role of the canine PR-B isoform in reproductive processes. Studies in mice show that PR-B is essential for mammary development. Despite the low transactivation potential, dogs do develop mammary tissue and even more have a high incidence of mammary carcinoma. Further studies are needed to determine whether canine PR-B, which seems to be devoid of nuclear activity, still regulates a subset of genes through cytoplasmic pathways. Other studies show a role for PR-B in inhibition of basal and GnRH-induced expression of LH ß-subunit (Thackray et al. 2009), but in dogs progestins hardly inhibit LH secretion (Beijerink et al. 2008). PR-B has an anti-inflammatory action in myometrial cells (Tan et al. 2012), but dogs are highly sensitive to progestin-induced cystic endometrial hyperplasia with concomitant infections (Bhatti et al. 2007). Further studies are clearly needed to evaluate the effect of the unique features of the canine PR-B on reproductive function and carcinogenesis of the mammary gland.

Acknowledgements

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

Ana Gracanin was supported by Mozaiek grant (#017.004.081) from Dutch Society for Scientific Research (NWO).

Conflicts of interest

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References

None of the authors have any conflicts of interest to declare.

References

  1. Top of page
  2. Contents
  3. Introduction
  4. Material and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  • Aupperlee MD, Haslam SZ, 2007: Differential hormonal regulation and function of progesterone receptor isoforms in normal adult mouse mammary gland. Endocrinology 148, 22902300.
  • Axlund SD, Sartorius CA, 2012: Progesterone regulation of stem and progenitor cells in normal and malignant breast. Mol Cell Endocrinol 357, 7179.
  • Ballare C, Uhrig M, Bechtold T, Sancho E, Di Domenico M, Migliaccio A, Auricchio F, Beato M, 2003: Two domains of the progesterone receptor interact with the estrogen receptor and are required for progesterone activation of the c-Src/Erk pathway in mammalian cells. Mol Cell Biol 23, 19942008.
  • Beijerink NJ, Bhatti SF, Okkens AC, Dieleman SJ, Duchateau L, Kooistra HS, 2008: Pulsatile plasma profiles of FSH and LH before and during medroxyprogesterone acetate treatment in the bitch. Theriogenology 70, 179185.
  • Bhatti SF, Rao NA, Okkens AC, Mol JA, Duchateau L, Ducatelle R, van den Ingh TS, Tshamala M, Van Ham LM, Coryn M, Rijnberk A, Kooistra HS, 2007: Role of progestin-induced mammary-derived growth hormone in the pathogenesis of cystic endometrial hyperplasia in the bitch. Domest Anim Endocrinol 33, 294312.
  • Brisken C, Duss S, 2007: Stem cells and the stem cell niche in the breast: an integrated hormonal and developmental perspective. Stem Cell Rev 3, 147156.
  • Daniel AR, Hagan CR, Lange CA, 2011: Progesterone receptor action: defining a role in breast cancer. Expert Rev Endocrinol Metab 6, 359369.
  • Gorlinger S, Kooistra HS, van den Broek A, Okkens AC, 2002: Treatment of fibroadenomatous hyperplasia in cats with aglepristone. J Vet Intern Med 16, 710713.
  • Gracanin A, van Wolferen ME, Sartorius CA, Brenkman AB, Schoonen WG, Mol JA, 2012: Loss of AF3 Domain Function in Canid Progesterone Receptor. Endocrinology, accepted.
  • Lantinga-van Leeuwen IS, van Garderen E, Rutteman GR, Mol JA, 2000: Cloning and cellular localization of the canine progesterone receptor: co-localization with growth hormone in the mammary gland. J Steroid Biochem Mol Biol 75, 219228.
  • Leslie KK, Stein MP, Kumar NS, Dai D, Stephens J, Wandinger-Ness A, Glueck DH, 2005: Progesterone receptor isoform identification and subcellular localization in endometrial cancer. Gynecol Oncol 96, 3241.
  • Millanta F, Calandrella M, Vannozzi I, Poli A, 2006: Steroid hormone receptors in normal, dysplastic and neoplastic feline mammary tissues and their prognostic significance. Vet Rec 158, 821824.
  • Mol JA, van Garderen E, Selman PJ, Wolfswinkel J, Rijnberk A, Rutteman GR, 1995: Growth hormone mRNA in mammary gland tumors of dogs and cats. J Clin Invest 95, 20282034.
  • Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM, 2003: Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Nat Acad Sci USA 100, 97449749.
  • Pfaffl MW, Horgan GW, Dempfle L, 2002: Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30, e36.
  • Rao NA, van Wolferen ME, Gracanin A, Bhatti SF, Krol M, Holstege FC, Mol JA, 2009: Gene expression profiles of progestin-induced canine mammary hyperplasia and spontaneous mammary tumors. J Physiol Pharmacol 60(Suppl. 1), 7384.
  • Scarpin KM, Graham JD, Mote PA, Clarke CL, 2009: Progesterone action in human tissues: regulation by progesterone receptor (PR) isoform expression, nuclear positioning and coregulator expression. Nucl Recept Signal 7, e009.
  • Selman PJ, Mol JA, Rutteman GR, van Garderen E, Rijnberk A, 1994: Progestin-induced growth hormone excess in the dog originates in the mammary gland. Endocrinology 134, 287292.
  • Tan H, Yi L, Rote NS, Hurd WW, Mesiano S, 2012: Progesterone receptor-A and -B have opposite effects on proinflammatory gene expression in human myometrial cells: implications for progesterone actions in human pregnancy and parturition. J Clin Endocrinol Metab 97, E719E730.
  • Thackray VG, Hunnicutt J, Memon AK, Ghochani Y, Mellon PL, 2009: Progesterone inhibits basal and gonadotropin-releasing hormone induction of luteinizing hormone beta-subunit gene expression. Endocrinology 150, 23952403.
  • Tung L, Shen T, Abel MG, Powell RL, Takimoto GS, Sartorius CA, Horwitz KB, 2001: Mapping the unique activation function 3 in the progesterone B-receptor upstream segment. Two LXXLL motifs and a tryptophan residue are required for activity. J Biol Chem 276, 3984339851.