Is Apoptosis a Regulatory Mechanism During Early Canine Pregnancy?

Authors


Author's address (for correspondence): S Schäfer-Somi, Centre for Artificial Insemination and Embryo Transfer, University of Veterinary Medicine Vienna, Veterinärplatz 1, 1210 Vienna, Austria. E-mail: sabine.schaefer@vetmeduni.ac.at

Contents

Fas is a membrane-bound protein which upon activation causes programmed cell death. Fas ligand (FasL) binds Fas on target cells. Both these factors are known to regulate apoptosis at implantation in different species and thus might be involved in the regulation of implantation in dogs. The aim of the study was to assess the expression of Fas and FasL in canine uterine tissue throughout pregnancy as well as in pre-implantation embryos using RT-PCR and RT-qPCR. Uterine tissues was collected from of 21 healthy pregnant bitches (group I: days 10–12, n = 5; group II: days 18–25, n = 6; group III: days 28–45, n = 6) and from 4 non-pregnant bitches (controls: days 10–12). Pregnancy stage was determined by days after mating, that is, 2–3 days after ovulation as determined by vaginal cytology and progesterone measurement. After ovariohysterectomy, uteri from group I bitches were flushed with PBS and the embryos washed and stored frozen at −80°. Tissues from the other groups were taken from the implantation and placentation sites, respectively, covered with Tissue Tek® and frozen at −80°. Extraction of RNA was performed with Trizol Reagent and RT-qPCR using SYBR green probes. In pre-implantation embryos, only FasL but not Fas could be detected. In all tissues from pregnant and non-pregnant bitches, both parameters were detectable. Before implantation (group I) expression of FasL resembled that of non-pregnant bitches in early dioestrus and decreased significantly during implantation and thereafter (p < 0.05). Expression of Fas did not change significantly until day 45. The relative expression of Fas exceeded that of FasL at each stage investigated, which is comparable to observations of other species; however, high standard deviations indicate high individual differences. These preliminary results point towards a regulatory function of the Fas/FasL system during early canine pregnancy.

Introduction

Fas/FasL-induced apoptosis has been intensely investigated as a probable implantation regulating mechanism in human pregnancy. Human trophoblast cells mainly express FasL; however, some also express Fas (Kauma et al., 1999). Human trophoblast cells are resistant to Fas-induced apoptosis (Aschkenazi et al. 2002). It is proposed that by FasL expression human trophoblast cells are able to suppress intrauterine invasion of Fas expressing leucocytes (Minas et al. 2007). The Fas/FasL system thus contributes to maternal immune-tolerance of the foetal allograft (Kauma et al., 1999). In placental tissue, sampled after abortions, leucocytes with increased expression of FasL and trophoblast cells with increased expression of Fas were detected. Authors therefore presumed that the changed expression profile might have contributed to the abortions (Minas et al. 2007). The trophoblast expression of FasL is believed to be an important mechanism to protect the embryo against the cytotoxic effect of Fas-bearing leucocytes and other immune cells. However, during normal pregnancies, the low-grade expression of Fas on cyto- and syncytiotrophoblast cells does not induce apoptosis, because apoptosis blocking mechanism are active; these mechanisms are suppressed during implantation, when an increased rate of apoptosis contributes to successful trophoblast invasion (Gruslin et al. 2001; Straszewski-Chavez et al. 2004). With increasing decidualization of placental cells, the Fas/FasL system loses its relevance and the expression of FasL decreases (Minas et al. 2007).

Human and canine placentae show histological similarities; we therefore hypothesize, that in the pregnant bitch, the Fas/FasL system fulfils similar tasks during implantation as those seen in pregnant women. This study thus aimed to investigate whether the Fas/FasL system is a relevant apoptosis regulating mechanism during canine pregnancy. For this purpose, we assessed the expression of Fas/FasL in uterus and placental tissue of pregnant and non-pregnant bitches, and in flushed pre-implantation embryos, by means of RT-PCR and RT-qPCR, resp.

Animals and Methods

Experimental animals and tissue sampling

All animals were provided from an animal shelter (Ankara, Turkey), and underwent ovariohysterectomy for animal shelter purposes. This project was authorized by the University of Ankara (Tr) and was approved by the local association for animal shelters. Nine bitches that were found to be in oestrus were mated 2–3 days after ovulation as determined by vaginal cytology and measurement of progesterone, and underwent surgery 10–12 days later. After ovariohysterectomy and embryo flush of the oviduct and uterus, five bitches were found pregnant and four non-pregnant. Twelve bitches that were confirmed pregnant by ultrasound examination on presentation were assigned to one of the experimental groups according to the ultrasound criteria defined by Yeager et al. (1992): group I: days 10–12 (pre-implantation), n = 5; group II: days 18–25 (early implantation), n = 6; group III: days 28–45 (post-implantation), n = 6.

Sampling was performed as follows: all embryos flushed from one bitch were washed and stored together frozen at −80°. Tissues were taken from bitches ovariohysterectomized at days 10–12 from the middle of the horn (group I and control group). Tissues from groups II and III were taken from the implantation and placentation sites, respectively. Tissue from the whole uterine wall (serosa, myometrium, endometrium, placental tissue) was excised, and pieces of 2 × 2 cm covered with Tissue Tek® (Sanova Pharma GmbH, Vienna, Austria) and frozen at −80°. The expression of Fas and FasL was assessed by RT-PCR and RT-qPCR in uterine tissues of healthy pregnant bitches and pre-implantation embryos as described by Schäfer-Somi et al. (2008, 2009).

Experimental procedures

Extraction of RNA with Trizol Reagent and RT-PCR as well as RT-qPCR was performed as described previously (Klein 2002; Schäfer-Somi et al. 2008, 2009; Beceriklisoy et al. 2009). For RT-qPCR, two house-keeping genes (GAPDH and ß-Actin) were used (Table 2). For the extraction of RNA from canine embryos, only 0.5 ml of Trizol reagent was added and no DNA digest performed. All embryos from one bitch were analysed together. Prior to PCR, a quality control of the RNA was performed by the assessment of the RNA integrity number (RIN) with the Agilent 2100 Bioanalyzer und RNA LabChip Kits (Agilent technologies GmbH, Vienna, Austria). This method allowed exact determination of the RNA integrity. Values of >5 were suitable for consecutive analysis of the samples (Schäfer-Somi et al. 2009). Primers were purchased from Sigma-Aldrich (Vienna, Austria) and designed using Primer Express Software 2.0 and 3.0 (Applied Biosystems, Forster City, CA, USA) and Nucleoid Blast (NCBI; canis familiaris). For the assessment of RNA expression, primers as given in Tables 1 and 2 were used.

Table 1. Primer for RT-PCR
PrimerSequenceLength of amplicon (bp)Accession no.
FASL-rec fCAGACATCGACCTGAGCAAA263 XM_543595
FASL-rec rGACTCTGAGCCACGTCTTCC
FAS lig fCAAGATCCATCCCTCTGGAA230 AY603042
FAS lig rGTTCATGATCTTCCCCTCCA
FAS fCAAATGCACGTGAGGCTCTA476 XM_547385
FAS rGCTCTGGAAACTCGAAGGTG
Table 2. Primer for qRT-PCR
PrimerSequenceLength of ampliconAccession no.
FAS-L fCTGGCTGAACTCCGAGAGTCTAC82 bp AY603042
FAS-L r:AAGGTGGATTGGGTTGACCTATT
FAS fTGCGATGGAGAGCATGGC104 bp XM_543595
FAS rTCGCACGGAGAGACGTCA
β-Actin f: (ACTA1-F):TCGCTGACAGGATGCAGAAG127 bpNM_001195845 XM_845524
d-Bact-R (ACTA1-R):GTGGACAGTGAGGCCAGGAT
d-Bactin-P (ACTA1-P):CTGAGCGCAAGTACT 
dGAPDH-V2 F:TCCACCCACGGCAAATTC119 bp AB038241.1
dGAPDH-V2 R:GCATCACCCCATTTGATGTTG
dGAPDH-V2 P:TCAAGGCTGAGAACGGGAAACTTGTCA

Statistical analyses

All values are given as mean ± SD. The Kolmogorov–Smirnov test was conducted to establish whether the distribution of groups was homogenous. As data were not normally distributed, groups were compared using the Mann–Whitney U test. All calculations were carried out with the SPSS software (Version 14 for Windows, SPSS Inc., Chicago, IL, USA). A p value of <0.05 was considered statistically significant.

Results

The RNA integrity numbers (RIN) of groups were 8.33 (controls), 8.48 (group I), 6.83 (group II) and 8.04 (group III). In all tissues samples (whole uterine wall) from pregnant and early diestrous animals, RNA for Fas and FasL (Fig. 1) was detectable. However, in pre-implantation embryos, only FasL was detected.

Figure 1.

Expression of FasL in uterine tissue of pregnant bitches (n = 6) during early implantation (day 18–25) and during the post implantation period (day 28–45)

Expression of FasL in pre-implantation uterine tissues (group I: 8.3 ± 2.0) resembled that of non-pregnant bitches in early dioestrus (control), however, then decreased significantly towards placentation (GAPDH: group III: 3.1 ± 0.9; p < 0.05) (Fig. 2). With β-actin, this decrease was significant between the implantation (group II: 3.3 ± 0.8) and placentation stage (group III: 1.1 ± 0.1; p < 0.05) (Fig. 2).

Figure 2.

Gene expression of FasL in uterine tissue from non-pregnant bitches in early diestrus (Embryo-, day 10–12), and from pregnant bitches before implantation (Preimpl., day 10–12), during early implantation (Impl., day 18–25) and during the post implantation period (Placent., day 28–45). *Points with equal indices differ significantly (p < 0.05)

Differences in Fas expression in uterine tissues were not significant between pregnancy stages; however, an increase from pre-implantation (group I: 43.9 ± 13.9) towards implantation (group II: 51.2 ± 27.3) was followed by a marked decrease (group III: 11.5 ± 6.4) (Fig. 3). (GAPDH: control group IV: 25.2 ± 8.7).

Figure 3.

Gene expression of Fas in uterine tissue from non-pregnant bitches in early diestrus (Embryo-, day 10–12) and from pregnant bitches before implantation (Preimpl., day 10–12), during early implantation (Impl., day 18–25) and during the post implantation period (Placent., day 28–45)

Expression of Fas was mostly significantly higher than that of FasL, except during the post-implantation period, when both parameters showed lowest expression (Fas and FasL; GAPDH: 11.5 ± 6.4 and 3.1 ± 0.9; β-actin: 3.5 ± 1.5 and 1.1 ± 0.1).

Discussion

The Fas/FasL system, also known as CD95/CD95L or TNFRSF6, is active in many organs. A defect or lack of this system may cause severe organ lesions as well as an autoimmune response (Evan and Vousden 2001). The system, among others, provides shelter against cytotoxic Fas expressing T-lymphocytes, as FasL-bearing trophoblasts are able to destroy invading lymphocytes (Aschkenazi et al. 2002; Minas et al. 2007). During apposition and adhesion of human embryos, blastocysts actively suppress apoptosis of endometrium epithelial cells, thus facilitating successful adhesion. Gruslin et al. (2001) and Straszewski-Chavez et al. (2004) supposed that the embryo secreted ‘X-linked inhibitor of apoptosis’ (XIAP) might be the reason for the suppression of apoptosis. The following implantation phase is marked by an increased rate of apoptosis, probably induced by a decrease in XIAP expression and the activated Fas/FasL system facilitating implantation. We suppose that the activation is supported by the expression of FasL in pre-implantation embryos. After binding to Fas expressing maternal endometrial cells, Fas might be activated and induce the caspase-triggered local apoptosis of endometrial cells. Human trophoblast cells mainly express FasL, whereas the endometrium epithelial cells mainly express Fas (Straszewski-Chavez et al. 2004). The relevance of this mechanism for implantation is underpinned by the following observations: treatment of mouse endometrium epithelial cells with anti-Fas-antibodies significantly reduced blastocyst implantation rate (Straszewski-Chavez et al. 2004). In humans, disturbance of the Fas/FasL system causes eclampsia and abortion (Aschkenazi et al. 2002). In human placental tissue obtained after abortion, numbers of FasL-bearing lymphocytes and expression of FAS on trophoblast cells as well as the rate of apoptotic cells are increased (Minas et al. 2007).

The high expression of Fas and low expression of FasL in canine uterine tissue are in contrast to the findings in early human pregnancy (Aschkenazi et al. 2002) and are probably owing to the fact that whole uterine tissue was assessed in our study. Expression of both factors separately for trophoblast cells and uterine cells is under investigation.

During normal pregnancy, apoptotic activity is regulated by anti-apoptotic factors such as cytokines from TH2 cells (Aschkenazi et al. 2002). These cytokines prevent attacks from cytotoxic T-cells despite the expression of Fas on trophoblast cells. This is supported by the additional molecules belonging to the so-called B7 family (Petroff et al. 2002). This family of immunomodulatory cell-associated proteins participates in the regulation of local lymphocyte distribution. They were detected especially in the foetal part of the human placenta and at the maternal–foetal interface. Some members like the B7-H1 are now believed to suppress cytotoxic maternal leucocytes thus preventing attacks from the maternal immune system (Petroff et al. 2002).

The high levels of FAS expression found in uterine tissue in this study resemble findings in pregnant mice uteri where expression was limited to stromal cells, whereas expression of FAS-L was restricted to single trophoblast, endothelial and decidual stromal cells. Furthermore, similar as in human and mouse pregnancy, the system seems to lose relevance at placentation. In decidualized cells of human placental tissue, FasL was at undetectable level (Minas et al. 2007). In the present study, both Fas and FasL, and especially the latter, were less expressed as pregnancy advanced and reached lowest value during the post-implantation period, which is in accordance to the findings in other species (Mor et al. 1998; Balkundi et al. 2000; Pongcharoen et al. 2004; Schulze 2007). This might be explainable by the progressing decidualization during implantation and placentation, rendering the growth regulating apoptotic system less important. This was already supposed by Lala and Graham (1990), who detected a relatively constant FasL expression throughout gestation, and a striking reduction at term, particularly by villous syncytiotrophoblast, which, according to the authors’ suggestion, may be associated with reduced invasiveness of the trophoblast with increasing gestational age.

The detection of Fas and FasL in uterine tissue of healthy, non-pregnant and early diestrous bitches points to a regulatory function of this apoptosis system during the physiological sexual cycle; however, the latter has yet to be proven.

In conclusion, these preliminary results indicate a regulatory function of the Fas/FasL system during early canine pregnancy. However, further studies investigating protein expression of endometrial, decidual and trophoblast cells, local presence and distribution of lymphocytes as well as in vitro studies using blocking peptides should follow and provide further insight into the local regulation of embryo and placental growth and angiogenesis.

Conflicts of interest

None of the authors have any conflicts of interest to declare.

Author contributions

S Schäfer-Somi: Experimental setting, RT-PCR, drafted the manuscript; S Sabitzer and D Klein: responsible for RT-qPCR results; C. Tomaszewski: responsible for RT-PCR, H Kanca, HB Beceriklisoy, I Kucukaslan, D Kaya, H Ceyhun Macun contributed equally to examination and operation of bitches as well as sampling, storage and shipment of tissues; S Aslan: experimental setting and supervision. All authors contributed to the final manuscript.

Ancillary